A DNA framework for facilitating circRNA looping and overexpression and methods of construction and use thereof

Abstract

This invention provides a DNA framework for promoting circRNA circularization and overexpression, its construction method, and its uses. The DNA framework comprises an upstream circularization driver sequence, a target circRNA gene sequence, and a downstream circularization driver sequence. The upstream circularization driver sequence is shown in SEQ ID NO: 1, and the downstream circularization driver sequence is shown in SEQ ID NO: 2. The intron flanking complementary sequence described in this invention is essential for circUACA circularization, and this complementary sequence can effectively promote circUACA overexpression, with an overexpression efficiency up to 500-fold.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, and in particular relates to a DNA framework for promoting circRNA circularization and overexpression, its construction method, and its uses. Background Technology

[0002] Circular RNA (circRNA) is a class of non-coding RNAs with a covalently closed circular structure, playing a crucial role in regulating physiological and pathological processes. In recent years, researchers have utilized deep RNA sequencing and bioinformatics technologies to discover a large number of circRNAs in organisms. circRNAs are formed from precursor RNA through backsplicing. RNA-binding proteins or flanking intron sequences located on either side of exons are key elements in circRNA circularization. circRNAs are closed circular structures, resistant to cleavage by the exonuclease RNase R. Compared to linear RNA molecules, circRNAs are relatively stable in organisms and have the potential to serve as biomarkers for disease occurrence and development. Circular RNAs possess the following biological functions: regulating gene transcription and splicing in the cell nucleus; acting as a "sponge" to adsorb miRNAs and inhibit their function; binding to proteins to regulate protein activity and function; and serving as templates for translation, encoding proteins or peptides. Studies have shown that circRNAs participate in numerous physiological and pathological processes, including tumors, neurological diseases, and viral hepatitis. Circular RNAs have become a new frontier and hot topic in the biomedical field due to their unique conformation and increasingly discovered important biological functions.

[0003] Exploring the molecular mechanisms of circRNAs and their feasibility as biomarkers requires molecular experimental techniques. Expressing specific circular RNA molecules in vitro is a crucial step in studying circRNA molecular mechanisms. Currently, circRNA overexpression suffers from low efficiency and instability, and there is a lack of flanking complementary sequence combinations and vector DNA frameworks to promote circularization and overexpression, thus hindering functional experiments on circular circRNAs. Flanking complementary sequences can promote circRNA circularization, and synthesizing DNA vector sequences is easier to manipulate than synthesizing RNA-binding proteins. To date, no technical indications exist regarding the application of our provided flanking complementary sequence in promoting circRNA circularization and overexpression, nor are there any technical indications regarding the vector backbone synthesized from this flanking complementary sequence or the method for constructing such a vector.

[0004] Therefore, developing a universally applicable circularization method for various circRNAs, and a flanking complementary sequence and overexpression vector that can stably and efficiently express circRNAs, is an urgent scientific problem to be solved. Summary of the Invention

[0005] In view of this, the present invention aims to overcome the deficiencies in the prior art and proposes a DNA framework for promoting circRNA circularization and overexpression, as well as its construction method and uses.

[0006] To achieve the above objectives, the technical solution created by this invention is implemented as follows: A first aspect of the present invention provides a sequence combination for promoting circRNA circularization and overexpression, the sequence combination comprising the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0007] A second aspect of the present invention provides a DNA framework for promoting circRNA circularization and overexpression, comprising an upstream circularization driver sequence, a target circRNA gene sequence, and a downstream circularization driver sequence, wherein the upstream circularization driver sequence is shown in SEQ ID NO: 1, and the downstream circularization driver sequence is shown in SEQ ID NO: 2.

[0008] TTTTTTTTATTTTTTTATTTTTTTGAGACAGAGTTTCGCTCTTGTTGCCCAGGCTGGTTGTGCAATGGCACAATCTTGGCTCACTGCAACCTCTGTCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTGCAGGAAT GCACCACCACCCCTGGCTAATTTTGTATTTTTAGCAGAAACGGGGTTTCTTCATGTTGGTCAGGCTGGTCTTGGACTCCCGACCTCTGGTGATGTGCCCACCTCAGCCTCCCAAAGTACTGGGATTACAGGCGTGAGCCACTGTGCCCGGCC (SEQ ID NO: 1).

[0009] GGCTGGGCGCGGATCACTTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGCGAAACCACATCTCTACCAAAAATACAAAAATTAGCTAGTGTGGTGGTGCGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTCCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCTGAGATCATGCCACTGCGCTGGCAACAGAGCGAGACTCTTGTCTCAAAAAAAAAAAA (SEQ ID NO: 2).

[0010] A third aspect of the invention provides a vector for promoting circRNA circularization and overexpression, the vector carrying the above-described DNA framework or its complementary sequence.

[0011] Preferably, the vector is a eukaryotic expression vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

[0012] More preferably, the vector is a pcDNA3.1+ vector.

[0013] A fourth aspect of the present invention provides a method for constructing the vector described above for promoting circRNA circularization and overexpression, the method comprising the step of linking the sequence combination described above for promoting circRNA circularization and overexpression or the DNA framework for promoting circRNA circularization and overexpression into the multiple cloning site of a backbone vector.

[0014] Preferably, the multiple cloning sites are HindIII 5' restriction site and EcoRI 3' restriction site.

[0015] A fifth aspect of the present invention provides the above-described method for promoting circRNA circularization and overexpression, the method comprising the step of linking the above-described sequence combination for promoting circRNA circularization and overexpression or the DNA framework for promoting circRNA circularization and overexpression into the multiple cloning site of a backbone vector.

[0016] A sixth aspect of the invention provides the use of the above-described sequence combinations, DNA frameworks, or vectors in the preparation of circular RNA overexpression products.

[0017] Compared with existing technologies, the present invention has the following advantages: This invention discovers for the first time that an intron flanking complementary sequence is essential for circUACA circularization, and this complementary sequence can effectively promote circUACA overexpression, with an overexpression efficiency up to 500-fold. More importantly, this invention also discovers for the first time that this flanking complementary sequence can promote the circularization and overexpression of other circRNAs, indicating that this flanking complementary sequence has universality for overexpressing circRNAs. Furthermore, this invention provides a vector backbone capable of overexpressing multiple circRNAs and a method for constructing such a vector. This invention provides a powerful research tool for studying the function and mechanism of circRNAs, and provides theoretical support for further research and development of circRNA molecules as novel biomarkers and therapeutic targets. In addition, this vector can overexpress multiple circRNAs, possessing significant commercial translational value. Attached Figure Description

[0018] Figure 1This is a diagram illustrating the cyclic pattern of circUACA. Figure 2 Complementarity analysis of flanking complementary sequences; Figure 3 Diagram of plasmid construction; Figure 4 This is a schematic diagram of a universal plasmid vector DNA framework. Figure 5 Gel electrophoresis and sequencing results for plasmids (A: Gel electrophoresis of plasmids #1 and #3; B: Sanger sequencing of plasmid #1). Figure 6 The graphs show the expression and sequencing results of circUACA (A: circUACA expression detection; B: Sanger sequencing of circUACA RT-qPCR products). Figure 7 The sequencing results for plasmids #6 and #7 are shown. Figure 8 The graph shows the expression promotion of circFAM126A and circMYLK by plasmids #8 and #9. Detailed Implementation

[0019] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art to which this invention pertains. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.

[0020] The invention will be described in detail below with reference to specific embodiments.

[0021] Example 1: Flanking Complementary Sequence This embodiment provides a set of flanking complementary sequences that promote circRNA circularization. Based on circRNA information indexed in the authoritative circRNA database circBase (http: / / circrna.org / ), the circRNA ID of circUACA is hsa_circ_0036103, and the mature circRNA sequence is 524 nt, named circUACA. The circRNA circularization pattern of circUACA is shown in the diagram below. Figure 1As shown, analysis using the UCSC online database (http: / / genome.ucsc.edu / ) revealed that the circUACA gene is located on human chromosome 15, chr15:70,979,878-70,991,999 (strand: -), spanning 12121 bp, and is formed by circularization of exons 2-7 of the UACA gene. Sequence analysis of the UACA gene identified two conserved sequences within it.

[0022] The upstream flanking complementary sequence is: TTTTTTTTATTTTTTTATTTTTTTGAGACAGAGTTTCGCTCTTGTTGCCCAGGCTGGTTGTGCAATGGCACAATCTTGGCTCACTGCAACCTCTGTCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTGCAGGAAT GCACCACCACCCCTGGCTAATTTTGTATTTTTAGCAGAAACGGGGTTTCTTCATGTTGGTCAGGCTGGTCTTGGACTCCCGACCTCTGGTGATGTGCCCACCTCAGCCTCCCAAAGTACTGGGATTACAGGCGTGAGCCACTGTGCCCGGCC (SEQ ID NO: 1).

[0023] The downstream flanking complementary sequence is: GGCTGGGCGCGGATCACTTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGCGAAACCACATCTCTACCAAAAATACAAAAATTAGCTAGTGTGGTGGTGCGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTCCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCTGAGATCATGCCACTGCGCTGGCAACAGAGCGAGACTCTTGTCTCAAAAAAAAAAAA (SEQ ID NO: 2).

[0024] like Figure 2 As shown, the comparative analysis revealed that the complementarity of this complementary sequence reached 67.31%.

[0025] Example 2: Construction of plasmids The plasmid vector was designed by our research group and constructed by Genewiz (Suzhou) Co., Ltd. using gene synthesis methods. The backbone plasmids were all commercially available pcDNA3.1(+)(Ampicillin). The DNA framework of the circRNA overexpression plasmid vector consisted of: upstream flanking complementary sequence + (5' KpnI restriction site, GGTACC) target circRNA gene sequence + downstream flanking complementary sequence, named cR-pcDNA3.1(+), and its structural diagram is shown below. Figure 4 As shown in the diagram. Specifically, the gene sequence was synthesized conventionally, and 5' HindIII and 3' EcoRI were added. The above vector DNA framework was cloned into the backbone plasmid pcDNA3.1(+) using 5' HindIII and 3' EcoRI (using a recombination method). 5' KpnI restriction sites were added between the upstream and downstream flanking complementary sequences to facilitate the subsequent insertion and assembly of the circRNA sequence. The constructed plasmid schematic diagram is shown in the diagram. Figure 3 As shown, the details are as follows: Plasmid #1: Construction of a universal circRNA overexpression vector DNA framework: upstream flanking complementary sequence + GGTACC + downstream flanking complementary sequence; wherein, the GGTACC is cut by restriction enzyme digestion (5'KpnI restriction site, GGTACC), and then the target circRNA sequence is inserted between the upstream and downstream flanking complementary sequences to construct the circRNA overexpression plasmid. The vector DNA framework is shown in the following sequence SEQ ID NO: 3: Plasmid #2: circUACA sequence; Plasmid #3: upstream flanking complementary sequence + circUACA sequence + downstream flanking complementary sequence; Plasmid #4: upstream flanking complementary sequence + circUACA sequence; Plasmid #5: circUACA sequence + downstream flanking complementary sequence; The insertion sites were both 5' HindIII and 3' EcoRI.

[0026] Images of gel electrophoresis and sequencing verification of the universal circRNA overexpression vector plasmid by Genewiz (Suzhou) Co., Ltd. are shown below. Figure 5 As shown in the figure, the size of the amplified product is consistent with the expectation, and sequencing verification confirms its correctness, proving that the plasmid construction was successful. All plasmids were verified by agarose gel electrophoresis and sequencing, confirming their successful construction.

[0027] Example 3: Flanking complementary sequences of circUACA promote its circularization and efficient overexpression. Our research group designed primers for circUACA and verified their specificity. First, total RNA was extracted from collected cells and then reverse transcribed into cDNA. Specific primers across the circUACA splice site were designed. The sequences are as follows: Forward: 5'-GGAGCGGATGTTAATTCCAG-3'; Reverse:5'-CCCCCTTTTTAGCAAGGATT-3'; The amplification product was 132 bp in size. The PCR product was subjected to agarose gel electrophoresis to verify the singleness of the band. The circularization site sequence in the amplification product was verified by Sanger DNA sequencing, proving that the primer is a specific primer for circUACA.

[0028] GAPDH was selected as the internal reference correction gene, and the primer sequences are as follows: GAPDH-F:5'GGTGGTCTCCTCTGACTTCAACA3' GAPDH-R:5' GTTGCTGTAGCCAAATTCGTTGT 3' The amplification product of the primers is 127 bp in size; Plasmid transfection: 250,000 293T cells were seeded into 6-well plates and transfected after 24 hours of cell adhesion. Before transfection, a mixture of 125 μL serum-free DMEM, 2.5 μg plasmid, and 5 μL P300 was prepared; a liposome mixture of 125 μL serum-free DMEM and 7.5 μL Lipofectamine was prepared; the two mixtures were then mixed in equal proportions and incubated at room temperature for 10 min; transfection was then performed according to the transfection reagent (Lipofectamine). TM Follow the instructions in the TransfectionReagent (Thermo Fisher Scientific, #2367427) manual; the final volume of liquid in the 6-well plate was 2 ml. After 8 hours of transfection, the medium was replaced with 2 ml of normal medium (10% fetal bovine serum and 90% DMEM). Cell culture conditions were 37°C and 5% CO2. Cell transfection was performed in 5 groups: empty vector, plasmid #2, plasmid #3, plasmid #4, and plasmid #5.

[0029] Total RNA extraction: Strictly follow the RNAiso Plus (TAKARA, Cat#9109) instructions. Add 1 ml Trizol to each well of a 6-well plate, and repeatedly pipette 10 times using a 1 ml pipette tip to collect the RNA into an EP tube. Add 200 μl chloroform, vortex vigorously for 15 seconds, incubate at room temperature for 15 minutes, and centrifuge at 10,000 rpm for 15 minutes at 4°C. Transfer the supernatant to a new enzyme-free EP tube. Add 0.6 ml isopropanol, vortex thoroughly, and incubate at -20°C for 1 hour. Centrifuge at 12,000 rpm for 10 minutes at 4°C until RNA precipitates at the bottom; discard the supernatant. Add 1 ml 75% ethanol, gently invert the tube, centrifuge at 12,000 rpm for 10 minutes, and discard the supernatant. Air dry at room temperature, add 20 μl DEPC water, and pipette until the RNA is fully dissolved. Then, determine the RNA concentration.

[0030] RT-qPCR: Prepare reverse transcription reaction solution A according to the Promega (A5001, USA) instructions and place it in a 200 μL enzyme-free EP tube.

[0031] Table 1: Reverse Transcription Reaction Solution A The reverse transcription reaction solution A was pre-denatured at 70°C for 5 min, and then removed and placed on ice.

[0032] Prepare reverse transcription reaction solution B according to Table 2.

[0033] Table 2: Reverse Transcription Reaction Solution B Perform the reverse transcription reaction under the following conditions: annealing at 25°C for 5 min, extension at 42°C for 60 min, and reverse transcriptase inactivation at 70°C for 15 min. Perform the resulting cDNA experiment immediately or store it at 4°C.

[0034] Real-time quantitative PCR reaction. Prepare the real-time quantitative PCR reaction system according to Table 3.

[0035] Table 3: Quantitative PCR Reaction System The reaction conditions were as follows: 95℃ for 3 min pre-denaturation, 95℃ for 40 s denaturation during the cycle, 60℃ for 60 s annealing, 72℃ for 1 min 30 s extension, for a total of 40 cycles. After each PCR cycle, the reaction was extended at 72℃ for 5 min, and then stored at 16℃.

[0036] The results of quantitative real-time PCR are as follows Figure 6 As shown, compared with plasmids transfected without flanking complementary sequences and those transfected with only upstream or downstream flanking complementary sequences, circUACA was significantly overexpressed in the plasmid transfected with flanking complementary sequences, with an overexpression efficiency of 500-fold. The absence of flanking complementary sequences prevented circUACA overexpression. After purification, the PCR products were subjected to Sanger DNA sequencing to identify the precise splicing site of circUACA. Only when the circUACA flanking complementary sequence is present can circUACA effectively form a circular structure, indicating that this flanking complementary sequence is indispensable for circUACA circularization. This demonstrates that the flanking complementary sequence and the constructed circUACA expression vector DNA framework can effectively promote circUACA circularization and overexpression.

[0037] Example 4: Flanking complementary sequences can promote the circularization and overexpression of other circRNAs. To verify whether this flanking complementary sequence has universal applicability in promoting the circularization and overexpression of other circRNAs, our research group constructed the following plasmid using the cR-pcDNA3.1(+) vector backbone: Plasmid #6: Upstream flanking complementary sequence + Sequence SEQ ID NO: 4 + Downstream flanking complementary sequence Plasmid #7: Upstream flanking complementary sequence + Sequence SEQ ID NO: 5 + Downstream flanking complementary sequence Plasmid #8: Upstream flanking complementary sequence + circFAM126A sequence + downstream flanking complementary sequence Plasmid #9: Upstream flanking complementary sequence + circMYLK sequence + downstream flanking complementary sequence Sequence SEQ ID NO: 4: (SEQ ID NO:4) SEQ ID NO:5: (SEQID NO: 5) The plasmid was transfected according to the method in Example 3, RNA was extracted for RT-qPCR, and the PCR product was purified and sequenced using Sanger DNA sequencing. The precise splicing sites of the circRNA were identified using Sanger DNA sequencing. Figure 7 and Figure 8 As shown, experiments confirm that the flanking complementary sequence and the constructed DNA framework can effectively promote the circularization and overexpression of other circRNAs. This indicates that the flanking complementary sequence and the constructed DNA framework have universality in promoting the circularization and overexpression of other circRNAs.

[0038] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A DNA framework for promoting circRNA circularization and overexpression, characterized in that: The DNA framework comprises an upstream circularization driver sequence, a target circRNA gene sequence, and a downstream circularization driver sequence, wherein the upstream circularization driver sequence is shown in SEQ ID NO: 1, and the downstream circularization driver sequence is shown in SEQ ID NO:

2.

2. A vector for promoting circRNA circularization and overexpression, characterized in that: The vector carries the DNA framework as described in claim 1.

3. The carrier according to claim 2, characterized in that: The vector is a eukaryotic expression vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

4. The carrier according to claim 2, characterized in that: The vector is pcDNA3.1+ vector.

5. A method for constructing a vector to promote circRNA circularization and overexpression, characterized in that: The construction method includes the step of linking the DNA framework of claim 1, which is used to promote circRNA circularization and overexpression, into the multiple cloning site of the backbone vector.

6. The construction method according to claim 5, characterized in that: The multiple cloning sites are HindIII 5' and EcoRI 3' restriction sites.

7. A method for promoting circRNA circularization and overexpression, characterized in that: The method includes the step of linking the DNA framework of claim 1 for promoting circRNA circularization and overexpression into the multiple cloning site of the backbone vector.

8. Use of the DNA framework of claim 1 or the vector of any one of claims 2-4 in the preparation of a circular RNA overexpression product.

Images