Application of Hsp90 in Lepidoptera pest control

Abstract

This invention provides the application of Hsp90 in the control of lepidopteran pests, belonging to the field of biological pest control technology. Specifically, this invention targets the Hsp90 gene, designs corresponding dsRNA preparations, and applies them to various lepidopteran pests such as fall armyworm, cotton bollworm, and beet armyworm to specifically silence the target gene. Compared with the control group, the mortality rate of the above three lepidopteran pests is significantly increased. This invention relates to dsRNA preparations and their convenient, rapid, green, and safe application methods, greatly simplifying the pest control process, allowing pest control to be achieved through conventional methods such as irrigation. This invention provides an effective candidate gene for RNA interference (RNAi)-mediated pest control strategies. Furthermore, due to the specificity and high lethality of this invention, it has significant practical implications for the control of lepidopteran pests and provides a new strategy and approach for pest control in green agricultural production.

Description

Technical Field

[0001] This invention belongs to the field of biological pest control technology, specifically relating to the application of Hsp90 in the control of lepidopteran pests. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] RNA interference (RNAi) is a highly conserved cellular mechanism in eukaryotes, also known as posttranscriptional gene silencing. It specifically reduces or shuts down the expression of target genes and was named one of the top ten scientific technologies by *Science* in both 2001 and 2002. RNA interference was first described and defined by Drs. Fire and Mello in their research on *Caenorhabditis elegans* in 1998. Since its discovery, RNA interference technology has often been used as a reverse genetics tool for gene function analysis and is also considered a potential means of pest control. The promotion of RNA interference technology can reduce the use of traditional chemical pesticides and achieve precision pest control, which is of great significance for promoting sustainable agriculture. Applying RNA interference technology to pest control has great potential, currently mainly through the delivery of dsRNA, a gene lethal to pests, via transgenic crops. However, due to the potential environmental risks of transgenic plants, rigorous assessments are often required before application. In addition, there are several other dsRNA delivery methods, such as microinjection, feeding, and immersion. Insects mainly utilize three RNAi pathways: exogenous siRNA, endogenous siRNA, and miRNA. Studies have shown that inhibiting the expression of important genes during insect growth and development can cause growth and developmental disorders or even death in insects. Since its discovery, RNAi has been widely used as a common reverse genetics tool for gene function analysis.

[0004] Heat shock proteins (HSPs), also known as heat shock proteins or heat stress proteins, are a class of highly conserved polypeptides widely found in prokaryotes and eukaryotes in nature. Studies have found that these proteins can be induced by various environmental stressors, such as heat, hypoxia, heavy metals, hormones, and ultraviolet radiation. Organisms express these proteins under both normal growth and stress conditions, and they play important physiological functions. HSPs are indispensable for maintaining cellular and protein homeostasis, ensuring the basic growth and development of insects under normal environmental conditions. Japanese scholar Morimoto classified the HSP superfamily into four families: the HSP90 family (molecular weight approximately 83-90 kD), the HSP70 family (molecular weight approximately 66-78 kD), the HSP60 family (molecular weight approximately 60 kD), and the low molecular weight HSP family (sHSPs, molecular weight approximately 15-30 kD). Among them, HSP90 plays many important roles, including assisting in protein folding, intracellular transport, maintenance and degradation, and promoting cell signaling. In insects, HSP90 is widely involved in various aspects of growth and development, heat tolerance, and pesticide resistance. In Drosophila, HSP90 is associated with muscle and germ cell development, as well as defects in polyphenotypic features such as wings, antennae, and eyes. Studies in the red flour beetle have shown that HSP83 (cytoplasmic HSP90) plays a crucial role in ovarian development; interference with HSP83 expression using RNAi technology prevents females from developing mature egg cells. HSP90 exhibits some interaction with chemical pesticide stress, possibly reflecting an adaptive response in insects, such as the differential expression of HSP90 in Italian honeybee larvae (Apis mellifera) and green mirid bugs (Apolygus lucorμm) under chemical stimulation. Furthermore, certain members of the HSP90 family play important functions in various aspects, including biological heat tolerance, biological immunity, and regulation of cytoskeleton dynamics. However, to date, no applications of HSP90-based biological control of lepidopteran pests have been found. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides an inhibitory effect on Hsp90 and its application in the control of lepidopteran pests. This invention targets the Hsp90 gene, designs corresponding dsRNA preparations, and applies them to various lepidopteran pests such as the fall armyworm, cotton bollworm, and beet armyworm to specifically silence the target gene. Compared with the control group, the mortality rate of these three lepidopteran pests is significantly increased. Based on the above research results, this invention is thus completed.

[0006] Specifically, the present invention relates to the following technical solutions:

[0007] In a first aspect, the invention provides the application of substances that inhibit the expression of the Hsp90 encoding gene and its expression products in the control of lepidopteran pests.

[0008] Specifically, the control of lepidopteran pests is manifested in any action that can limit the damage caused by lepidopteran pests and act on lepidopteran pests, including but not limited to promoting the death of lepidopteran pests, inhibiting the growth and development of lepidopteran pests, altering the reproductive capacity or growth of lepidopteran pests in a way that causes less damage to plants, reducing the number of offspring produced by lepidopteran pests, producing fewer normal lepidopteran pests, or preventing lepidopteran pests from feeding on plants.

[0009] Lepidoptera pests are numerous and can harm trees, fruit trees, vegetables, grain crops, and cash crops. Common insects commonly known as butterflies and moths are mostly Lepidoptera. In one specific embodiment of the present invention, the Lepidoptera pests include, but are not limited to, fall armyworm, cotton bollworm, and beet armyworm.

[0010] The substances that inhibit the expression of the Hsp90 encoding gene and its expression products include, but are not limited to, RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against the Hsp90 protein itself or its upstream and downstream molecules, such as anti-Hsp90 antibodies; preferably, the substances are RNA interference molecules targeting Hsp90 of lepidopteran pests.

[0011] More specifically, the RNA interference molecule may be selected from the polynucleotide sequence of interfering ribonucleic acid obtained based on any one or more polynucleotide sequences shown in SEQ ID NO.2-7 as a template.

[0012] Furthermore, the polynucleotide sequence also includes a complementary sequence of the polynucleotide sequence.

[0013] Specifically, the interfering ribonucleic acid polynucleotide sequence can be dsRNA, which is synthesized by in vitro transcription using the sequence described in SEQ ID NO. 2-7 as a template. Specifically, those skilled in the art can synthesize it manually or automatically using chemical or enzymatic methods, such as by using an existing known kit (in vitro Transcription T7 Kit).

[0014] In a second aspect, the present invention provides an interfering ribonucleic acid (RNA) that, after being ingested by lepidopteran pests, downregulates the expression of the Hsp90 gene in the lepidopteran pests. Specifically, the interfering RNA may be dsRNA, which is synthesized by in vitro transcription using the sequences described in SEQ ID NO. 2-7 as templates.

[0015] A third aspect of the present invention provides a composition for controlling lepidopteran pests, said composition comprising at least the interfering ribonucleic acid described in the second aspect above, and at least one agriculturally suitable carrier, excipient, or diluent. Specifically, the composition of the present invention can be formulated and delivered to plants according to conventional agricultural practices used in the biopesticide industry. When ingested by lepidopteran pests, the interfering ribonucleic acid downregulates the expression of the target gene Hsp90 within the pests.

[0016] The composition of this invention can be presented in any suitable physical form for application to lepidopteran pests. For example, the composition can be present in solid form (e.g., powder, granules, or bait), liquid form (e.g., spray), or gel form. The composition can be applied to a matrix to protect said matrix from lepidopteran pests. Simultaneously, the above composition can also be used to protect any matrix or material sensitive to lepidopteran pest infestation or damage caused by lepidopteran pests.

[0017] In this invention, the composition can be presented in the form of a bait. This bait is used to lure lepidopteran pests into contact with the composition. Upon contact, the composition is subsequently internalized by the lepidopteran pests through, for example, ingestion and the mediation of RNAi, thereby killing the lepidopteran pests.

[0018] The bait can also be carried back to the colony by lepidopteran pests. The bait can then serve as a food source for other members of the colony, thus providing effective control over large numbers of lepidopteran pests and potentially the entire lepidopteran population.

[0019] The above-described composition of the present invention can also be provided in the form of a spray. Therefore, the user can directly spray the composition onto lepidopteran pests. Within the lepidopteran pests, it can effectively mediate RNA interference, thereby controlling the pests. The composition can be used to adhere to lepidopteran pests (including their larvae), for example, adhering to the exoskeleton of the pest, and can enter the pest's body from the exoskeleton for internalization and absorption.

[0020] Of course, in this invention, the above composition can also be applied to environments where lepidopteran pests exist using various known prior art techniques, including but not limited to spraying, atomizing, dusting, dispersing, pouring, coating seeds, seed treatment, and introducing into the soil or irrigation water, as long as contact with lepidopteran pests is achieved. It should be noted that when treating plants susceptible to lepidopteran pest infestation, the composition can be delivered to the plant or a portion of the plant before the lepidopteran pests appear (i.e., to achieve prevention) or after signs of lepidopteran pest infestation begin to appear (i.e., to achieve control).

[0021] Obviously, the composition of the present invention may also contain at least one other agricultural agent, such as a herbicide or other insecticide, thereby achieving better pest control or other effects required in agriculture.

[0022] In a fifth aspect, the method for controlling lepidopteran pests comprises expressing an effective amount of the aforementioned interfering ribonucleic acid or composition in a plant, wherein the term "effective amount" refers to the amount or concentration of interfering ribonucleic acid required to produce a phenotypic effect on lepidopteran pests, thereby reducing the number (quantity) of lepidopteran pests invading the plant and / or reducing the amount of damage caused by the pests. Specifically, the phenotypic effect may mediate pest mortality and be achieved using interfering RNA, resulting in at least 10%-30%, preferably at least 30-50%, and more preferably at least 50% mortality of lepidopteran pests compared to a control group, thereby enhancing plant resistance to lepidopteran pests and protecting the plant from damage caused by lepidopteran pests.

[0023] When the interfering ribonucleic acid is introduced into a plant, it can be done through biologically acceptable direct transformation methods (including gene gun method, electroporation method, ultrasound method, microinjection method, PEG method) or indirect transformation methods (including DNA viral vector-mediated method, Agrobacterium-mediated method); or it can be obtained by hybridizing a plant containing the above-mentioned exogenous nucleotide sequence with another plant, so that the offspring have nucleotide sequences incorporated into its genome.

[0024] Specifically, in the above transformation process, polynucleotides (interfering ribonucleic acid) can be inserted into the construct or vector using conventional molecular cloning techniques. The construct can be a recombinant vector, such as a bacterial, viral, or yeast vector.

[0025] The plants mentioned can be any plants affected by lepidopteran pests, including but not limited to forest trees, fruit trees, vegetables, food crops, and cash crops, such as pine trees, cypress trees, apples, pears, pineapples, rapeseed, cabbage, potatoes, wheat, barley, rice, corn, tobacco, and cotton.

[0026] The RNAi target gene Hsp90 provided by the above technical solution has a highly lethal effect on lepidopteran pests, and the use of dsRNA to control lepidopteran pests has the following advantages:

[0027] 1. High specificity and precise insect resistance;

[0028] 2. Safe, with minimal impact on non-target insects; RNA is easily degraded, leaving no residue, making it an environmentally friendly reagent;

[0029] 3. High practicality: dsRNA can be prepared into formulations for spraying or irrigation, and applied over large areas in the field.

[0030] In summary, the above technical solutions provide candidate genes with excellent effects for RNA interference (RNAi)-mediated pest control strategies. At the same time, due to the specificity and high lethality of this invention, it has important practical significance for the control of lepidopteran pests and provides new strategies and approaches for pest control in green agricultural production. Attached Figure Description

[0031] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0032] Figure 1 This is a full-length clone diagram of SFHsp90-CDS in an embodiment of the present invention.

[0033] Figure 2 This is a clone diagram of the SFHsp90-dsRNA template in an embodiment of the present invention. Detailed Implementation

[0034] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0035] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods in the following specific embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or according to the conditions recommended by the manufacturer.

[0036] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0037] Example

[0038] This embodiment is implemented using molecular biology methods and indoor bioassay methods.

[0039] Test insects:

[0040] Fall armyworms were collected from Jiangcheng Hani and Yi Autonomous County, Pu'er City, Yunnan Province (22.59°N, 101.86°E). They were reared and purified for over 10 generations using artificial feed for Noctuidae moths. The rearing temperature was 27℃±1℃, and the photoperiod was 14L:10D. Adults were individually paired in rearing boxes with an upper diameter of 18cm, a lower diameter of 13cm, and a height of 8cm. They were fed with 5% sucrose solution. Egg masses were collected in a single-piece cup for hatching. Newly hatched larvae were reared in 24-well plates until the 3rd instar. 3rd instar larvae were transferred to 12-well plates for rearing until the 5th instar. 5th instar larvae were transferred to 6-well plates until pupation. On the 3rd to 5th day after pupation, they were transferred to a single-piece cup for individual rearing until emergence as adults.

[0041] The cotton bollworm and cotton bollworm were collected from Xinxiang City, Henan Province (35.31°N, 113.85°E). The artificial feed and rearing methods were the same as above.

[0042] Test methods

[0043] 1. Total RNA was extracted from 5th-6th instar larvae of fall armyworm using TransZol Up (TransGen). The total RNA was reconstituted with 30 μL of DEPC-treated ddH2O and stored at -80℃ for later use.

[0044] 2. Using the RNA extracted in the above steps as a template, perform an RT reaction using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme) to obtain cDNA.

[0045] 3. Utilize PCR was performed using DNA Polymerase High Fidelity (TransGen) to obtain the full-length Hsp90 cds sequence, which is 2154 bp in length. The DNA marker (2000 bp) was then extracted using the pEASYPure-Quick Gel Extraction Kit (TransGen).

[0046] 4. The recovered Hsp90 fragment was ligated into the cloning vector. -T5 Zero Cloning Kit (TransGen, CT501-01).

[0047] 5. Transformed into E. coli Trans5α Chemically Competent Cell (TransGen, CD201-01), cultured overnight at 37°C, colony PCR was performed to identify single colonies, and single colonies were picked and sent to the company for sequencing.

[0048] 6. The identified colonies were cultured in LB liquid medium at 37℃ and 200 rpm for 12-16 h with shaking. Plasmids were extracted using the FastPureEndoFree Plasmid Mini Kit (Vazyme, DC203-01) and stored at -20℃ for later use.

[0049] 7. Following the instructions in the dsRNA preparation kit (in vitro Transcription T7 Kit (TaKaRa), first synthesize dsRNA to prepare a DNA template. Design specific primers with a T7 promoter at the 5' or 3' end (5'-TAATACGACTCACTATAGGG-3'), and use a DNA polymerase capable of amplifying blunt-ended DNA. Super-Fidelity DNA Polymerase (Vazyme) was used to amplify Hsp90 in segments, dividing it into four segments: segment 1 (1-540), segment 2 (540-1121), segment 3 (1120-1700), and segment 4 (1700-2154). Eight pairs of primers were designed, and the PCR products were excised and recovered using a kit. The eight fragments were named F-T7-1, R-T7-1 (for the first segment), F-T7-2, R-T7-2 (for the second segment), F-T7-3, R-T7-3 (for the third segment), and F-T7-4, R-T7-4 (for the fourth segment). The nucleic acid concentration was measured using a NanoDrop instrument.

[0050] 8. Following the instructions in the in vitro Transcription T7 Kit (TaKaRa), use 200-500 ng of DNA fragments with T7 promoters at the 5' and 3' ends as templates to synthesize the corresponding dsRNA. Redissolve the dsRNA in DEPC-treated water, determine the nucleic acid concentration using a NanoDrop instrument, and dilute it to the experimental concentration. Store at -80℃ for later use.

[0051] 9. Stomach poisoning treatment: 240 second-instar day-1 fall armyworm larvae of uniform growth were selected and divided into five groups (one control group and four treatment groups), with 48 larvae in each group. After starvation for 6 hours, artificial feed was evenly cut into 1mm pieces. 3 Small pieces of food were added. 1 μL of each of the four dsRNAs (4 μg / μL) was added to the surface of the feed in each of the four treatment groups, while ddH2O was added to the control group. The treated artificial feed was placed in 24-well plates and the insects were fed. After 24 hours, once all the insects had consumed the feed, approximately 1 cm of fresh feed was added. 3 They are fed with artificial feed.

[0052] 10. Insect Immersion Treatment: 240 second-instar day-1 fall armyworm larvae of uniform growth were selected and divided into five groups (one control group and four treatment groups), with 48 larvae in each group. The treatment groups were immersed in 160 ng / μL of four different dsRNAs for 30 seconds, while the control group was immersed in ddH2O. After treatment, the larvae were fed normally.

[0053] 11. Statistical analysis of larval mortality rate, adult pupation rate, and pupation time.

[0054] The interference efficiency of the Hsp90 gene was determined using qPCR: After insect treatment for 5-7 days, total RNA was extracted from the insects using TransZol Up (TransGen), and the RNA concentration was measured. 1 μg of RNA was subjected to an RT reaction using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme) to obtain cDNA. Using specific primers for the target gene and housekeeping gene, 1 μl of the cDNA obtained in the previous step was subjected to qPCR using ChamQ Universal SYBR qPCR Master Mix (Vazyme). Actin was used as an internal control gene. To ensure data reliability, three insects were used as one replicate for each treatment, and four replicates were performed per treatment. All qPCR reactions were performed in 96-well plates, and the 96-well plates were read using a 7500 Fast Realtime PCR system (Applied Biosystems). -△△Ct Independent samples t-tests were performed using the method and DPS software to analyze the relative expression levels of genes. A p-value < 0.05 was considered statistically significant.

[0055] Table 1 Primers involved in the examples

[0056]

[0057]

[0058] Note: Underlined sequences represent T7 promoter sequences, and italicized sequences represent sequences that enhance transcription.

[0059] The results are shown in Tables 2 and 3 below. Compared with the control group, dsRNA designed with Hsp90 as the target has a significant lethal effect on different lepidopteran pests.

[0060] Table 2. Lethality results of different dsRNAs designed for Hsp90 in the fall armyworm.

[0061] Comparison Hsp90-1 Hsp90-2 Hsp90-3 Hsp90-4 Stomach poisoning mortality rate 8.33％ 14.58％ 25％ 20.83％ 27.08％ Stomach toxin interference efficiency 0％ 40.56％ 68.24％ 28.4％ 45.7％ Infiltrating mortality rate 8.33％ 16.67％ 33.33％ 25％ 41.67％ Infiltrating interference efficiency 0％ 51.77％ 73.9％ 30.58％ 48.59％

[0062] Note: Hsp90-1 is a dsRNA designed using SFHsp90-scy-1 (SEQ ID NO.2) as a DNA template; Hsp90-2 is a dsRNA designed using SFHsp90-scy-2 (SEQ ID NO.3) as a DNA template; Hsp90-3 is a dsRNA designed using SFHsp90-scy-3 (SEQ ID NO.4) as a DNA template; and Hsp90-4 is a dsRNA designed using SFHsp90-scy-4 (SEQ ID NO.5) as a DNA template.

[0063] Table 3. Lethality results of different dsRNAs designed for Hsp90 in cotton bollworm and beet armyworm.

[0064]

[0065] Note: The cotton bollworm dsRNA is a dsRNA designed using SFHsp90-scy-4 (SEQ ID NO.5) as a DNA template; the beet armyworm dsRNA is a dsRNA designed using SLHsp90-4 (SEQ ID NO.7) as a DNA template.

[0066] Nucleotide sequences involved in the examples

[0067] >SFHsp90-scy(SEQ ID NO.1)

[0068]

[0069] >SFHsp90-scy-1(SEQ ID NO.2)

[0070] ATGCCCGAAGAAATGCAGACCGATGTCGCCGAGGTGGAGACCTTCGCCTTCCAGGCGGAGATCGCCCAGCTTATGTCCCTGATCATCAACACATTCTACTCCAACAAAGAGATCTTCCTTCGTGAGTTGATTTCCAACTCTTCTGATGCCTTGGACAAGATCCGTTATGAGTCACTTACCGACCCATCGAAGCTGGACAGCGGCAAGGAGCTGTACATCAAGATCATTCCCAACAAGAGCGAAGGTACACTCACTATTATTGATACCGGTATTGGTATGACCAAGGCTGACCTCGTCAACAACCTTGGTACCATCGCCAAGTCAGGAACCAAGGCATTCATGGAGGCCCTGCAGGCAGGCGCCGACATCAGCATGATCGGTCAGTTCGGTGTGGGTTTCTACTCATGCTACCTGGTCGCTGACCGCGTGACAGTTCACTCGAAGCACAATGACGACGAGCAGTACATGTGGGAGTCGTCGGCGGGAGGCTCGTTCACGGTCCGCCCCGACCATGGCGAGCCCCTCGGACGCGGTACCAAG

[0071] >SFHsp90-scy-2(SEQ ID NO.3)

[0072] GATCGTTCTCCACATCAAGGAAGACCTCACTGAGTACCTTGAAGAGCACAAGATCAAGGAAATCGTGAAGAAGCACTCACAGTTCATCGGCTACCCCATCAAACTGATGGTTGAGAAGGAACGCGAGAAGGAGCTCTCTGATGACGAGGCTGAGGAGGAAAAGAAAGAGGACGAGAAGGAGGATGACAAGCCCAAGATCGAGGATGTGGGAGAGGACGACGAGGAGGACAAGAAGGACAAGAAGAAGAAGAAGACCATCAAGGAGAAGTACACAGAGGACGAGGAACTCAACAAGACCAAGCCCATCTGGACCCGCAATGCTGATGACATCACACAGGAGGAGTACGGTGACTTCTACAAATCCCTCACCAATGACTGGGAGGACCACCTCGCTGTCAAACACTTCTCTGTTGAAGGTCAGCTGGAGTTCAGAGCCCTGTTGTTCGTGCCCCGCCGTGCTCCCTTCGACTTGTTTGAGAACAAGAAGCGCAAGAACAACATCAAGTTGTACGTCCGCAGGGTGTTCATCATGGACAACTGTGAGGACCTTATCCCTGAGTACCTGAACTTCATCAAGGGTGT

[0073] >SFHsp90-scy-3(SEQ ID NO.4)

[0074] GTAGTCGACAGTGAGGACCTGCCCCTCAACATCTCTCGTGAGATGCTCCAACAGAACAAGATCCTGAAAGTAATCAGGAAGAACTTGGTTAAGAAATGCTTGGAACTGTTCGAAGAGTTGGCTGAAGACAAAGAGAACTACAAGA AGTATTACGAACAATTCAGCAAGAACCTGAAGCTTGGTATCCACGAAGATTCCCAGAACAGGTCAAAACTGGCTGACTTGCTCCGCTACCACACATCTGCCTCTGGTGATGAGGCATGCTCCCTCAAAGAGTATGTCTCACGCAT GAAGGAGAATCAGAAACACATCTACTACATCACTGGTGAGAACCGTGACCAGGTTGCCAACTCATCATTCGTAGAGCGAGTCAAGAAGCGTGGTTATGAAGTTGTATACATGACCGAGCCCATTGATGAGTATGTAGTACAACAG ATGAGGGAGTACGATGGTAAGACTCTAGTCTCTGTCACAAAGGAGGGTCTAGAACTCCCTGAAGATGAAGAGGAGAAGAAGAAGCGCGAGGAGGACAAGGTCAAGTTCGAGGGTCTCTGCAAGGTCATGAAGAACATCCTTGACAA

[0075] >SFHsp90-scy-4(SEQ ID NO.5)

[0076] ACAAAGTTGAGAAGGTTGTTGTCTCCAACCGTCTCGTTGAGTCCCCATGCTGCATCGTCACTGCTCAGTATGGTTGGTCTGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTCCGTGACACATCCACCATGGGTTACATGGCGGCCAAGAAGCACCTTGAGATCAACCCTGACCATTCCATCGTCGAGACCCTGAGGCAGAAGGCCGAGGCCGACAAGAACGACAAGGCTGTGAAGGACCTCGTCATCCTGCTGTACGAGACTGCCCTGCTGTCATCTGGCTTCACCCTGGACGAGCCCCAGGTGCACGCCTCCCGCATTTACCGCATGATCAAGCTTGGTCTGGGCATCGACGAGGACGAGCCTATCCAGGTGGAGGAGTCGAGCGCCGGCGACGTGCCCCCACTAGAGGGCGACGCCGACGACGCGTCACGTATGGAGGAAGTGGATTAA

[0077] >HAHsp90-4(SEQ ID NO.6)

[0078] ACAAAGTTGAGAAGGTTGTTGTATCCAACCGTCTGGTTGAGTCACCCTGCTGCATCGTCACTGCTCAGTATGGTTGGTCAGCCAACATGGAGCGTATCATGAAGGCCCAGGCTCTCCGTGACACATCCACCATGGGTTACATGGCAGCTAAGAAGCACCTTGAGATCAACCCTGACCATTCCATCGTCGAGACTCTGAGGCAGAAGGCGGAGGCTGACAAGAACGACAAGGCTGTGAAGGACTTGGTCATCCTGCTGTACGAGACTGCGCTGCTGTCGTCTGGCTTCACCCTGGACGAGCCCCAGGTGCATGCCTCCCGCATCTACCGCATGATCAAGCTTGGTCTGGGCATCGACGAGGACGAGCCTATCCAGGTGGAGGAGTCGAGCGCCGGCGACGTGCCCCCGCTAGAGGGTGACGCTGATGACGCGTCGCGCATGGAGGAAGTAGATTAA

[0079] >SLHsp90-4 (SEQ ID NO.7)

[0080] ACAAAGTTGAGAAGGTTGTTGTCTCCAACCGTCTTGTTGAGTCACCATGCTGCATCGTCACTGCTCAGTATGGTTGGTCAGCCAACATGGAGCGTATCATGAAGGCTCAGGCTCTCCGTGACACATCTACCATGGGTTACATGGCAGCCAAGAAGCATCTTGAGATTAACCCTGACCATTCCATTGTTGAGACCCTGAGGCAGAAGGCCGAGGCTGACAAGAACGAC AAGGCTGTGAAAGACCTCGTCATCTTGCTGTACGAGACTGCCCTGCTGTCGTCTGGATTCACCCTGGACGAGCCCCAGGTGCACGCTTCTCGCATCTACCGCATGATCAAGCTTGGTCTAGGCATCGATGAGGACGAGCCTATCCAGGTGGAGGAGTCCAGCGCCGGCGACGTGCCCCACTAGAGGGCGACGCCGACGACGCGTCACGTATGGAGGAAGTGGATTAA

[0081] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a substance which inhibits the expression of an Hsp90-encoding gene and its expression product for the control of Lepidopteran pests, characterized in that, The substance that inhibits the expression of the Hsp90 encoding gene and its expression product includes interfering ribonucleic acid targeting Hsp90; The interfering ribonucleic acid polynucleotide sequence is dsRNA, which is synthesized by in vitro transcription using the sequence described in SEQ ID NO.2-7 as a template. The lepidopteran pests mentioned are fall armyworm, cotton bollworm, and beet armyworm.

2. Use according to claim 1, wherein The control of lepidopteran pests is specifically manifested in limiting the damage caused by lepidopteran pests, including promoting the death of lepidopteran pests, inhibiting the growth and development of lepidopteran pests, altering the reproductive capacity or growth of lepidopteran pests in a way that causes less damage to plants, reducing the number of offspring produced by lepidopteran pests, producing fewer normal lepidopteran pests, or preventing lepidopteran pests from feeding on plants.

3. The application as described in claim 1, characterized in that, The substances that inhibit the expression of the Hsp90 encoding gene and its expression products also include antisense oligonucleotides, small molecule inhibitors, siRNAs, substances that carry out lentiviral infection or gene knockout, and specific antibodies against the Hsp90 protein itself or its upstream and downstream molecules.

4. A method for controlling lepidopteran pests, characterized in that, This includes exposing lepidopteran pests to compositions that interfere with ribonucleic acid or control lepidopteran pests; The interfering ribonucleic acid (RNA) downregulates the expression of the Hsp90 gene in lepidopteran pests after being ingested by them. The interfering RNA is dsRNA, which is synthesized by in vitro transcription using the sequence described in SEQ ID NO.2-7 as a template. The composition includes at least the interfering ribonucleic acid and at least one agriculturally suitable carrier, excipient or diluent; The lepidopteran pests mentioned are fall armyworm, cotton bollworm, and beet armyworm.

5. A method for improving plant resistance to lepidopteran pests, characterized in that, This includes introducing constructs that interfere with RNA into plants; The interfering ribonucleic acid (RNA) downregulates the expression of the Hsp90 gene in lepidopteran pests after being ingested by them. The interfering RNA is dsRNA, which is synthesized by in vitro transcription using the sequence described in SEQ ID NO.2-7 as a template. The lepidopteran pests mentioned are fall armyworm, cotton bollworm, and beet armyworm.

6. A method for obtaining plants that control lepidopteran pests, characterized in that, This includes introducing constructs that interfere with RNA into plants; The interfering ribonucleic acid (RNA) downregulates the expression of the Hsp90 gene in lepidopteran pests after being ingested by them. The interfering RNA is dsRNA, which is synthesized by in vitro transcription using the sequence described in SEQ ID NO.2-7 as a template. The lepidopteran pests mentioned are fall armyworm, cotton bollworm, and beet armyworm.

7. A method for protecting plants from damage caused by lepidopteran pests, characterized in that, This includes introducing a construct that interferes with RNA into plants, which then promotes the death of lepidopteran pests after being ingested by them. The interfering ribonucleic acid (RNA) downregulates the expression of the Hsp90 gene in lepidopteran pests after being ingested by them. The interfering RNA is dsRNA, which is synthesized by in vitro transcription using the sequence described in SEQ ID NO.2-7 as a template. The lepidopteran pests mentioned are fall armyworm, cotton bollworm, and beet armyworm.

Images