Kits for detecting genes related to precision medication for hypertension

CN115927579BActive Publication Date: 2026-08-14YINFENG BIOLOGICAL GRP LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-15
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

但是由于代谢酶基因多态性等原因,治疗高血压的药物在不同患者身上体现出明显的个体反应差异,因此需要通过基因检测判断药物代谢酶及药靶受体的基因型,以实现抗高血压药物的个性化给药

Benefits of technology

[0080]1、节约成本:针对抗高血压药物相关基因CYP2D6、ADRB1、NPPA、CYP3A5、ACE、CYP2C9、AGTR1设计对应的通用Taqman探针和反向引物,仅利用错配正向引物的不同,可以进行特异性扩增识别相应的基因多态性;相较于引物的锁核酸设计、MGB探针法、双探针法,极大地节约了成本。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927579B_ABST
    Figure CN115927579B_ABST
Patent Text Reader

Abstract

This invention discloses a kit for detecting genes related to precision medication for hypertension, comprising reaction solution I, reaction solution II, reaction solution III, reaction solution IV, and reaction solution V. Reaction solution I is a reagent essential for PCR reactions. Reaction solutions II, III, IV, and V include wild-type forward primers, mutant forward primers, a shared wild-type and mutant reverse primer, and a shared fluorescent probe for detecting the CYP2D6, ADRB1, NPPA, CYP3A5, ACE, CYP2C9, and AGTR1 genes. This invention also discloses a method for detecting genes related to precision medication for hypertension using this kit. This kit for detecting genes related to precision medication for hypertension requires only 4 tubes of PCR reaction to accurately detect 21 genotypes at 7 loci in a single sample. It is simple, efficient, and highly sensitive, and can effectively guide the clinical application of antihypertensive drug-related genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a kit for detecting genes related to precision medication for hypertension, belonging to the field of gene detection technology. Background Technology

[0002] Hypertension is currently the leading cause of death worldwide, with an incidence rate as high as 23.2%. Its harm surpasses that of cancer and diabetes, and its mortality rate exceeds that of complications from heart and kidney diseases. Controlling blood pressure through medication to reduce hypertension complications is the primary treatment for hypertension. The main types of drugs for treating hypertension include beta-blockers, angiotensin II receptor antagonists (ARBs), angiotensin-converting enzyme inhibitors (ACEIs), diuretics, and calcium channel blockers (CCBs). However, due to factors such as metabolic enzyme gene polymorphism, the response of antihypertensive drugs varies significantly among different patients. Therefore, genetic testing is needed to determine the genotype of drug-metabolizing enzymes and drug target receptors to achieve personalized medication administration for antihypertensive drugs. Currently, the NMPA has only approved one company's genotyping kit for hypertension medication guidance containing the CYP2D6 target, but this product only detects five targets and cannot cover the medication guidance of all five pharmacological antihypertensive drugs. This invention proposes to construct a 4-tube multiplex qPCR system for genotyping seven target sites: ADRB1, AGTR1, CYP2C9, CYP2D6, ACE, CYP3A5, and NPPA. Twenty-one genotypes of these seven antihypertensive drug-related genes can be accurately detected using only four tubes of reaction solution. Summary of the Invention

[0003] In view of the above-mentioned prior art, the present invention provides a kit for detecting genes related to precision medication for hypertension. The kit of the present invention requires only 4 tubes of PCR reaction to accurately detect 21 genotypes of 7 antihypertensive drug-related genes (ADRB1, AGTR1, CYP2C9, CYP2D6, ACE, CYP3A5, NPPA), exhibiting high sensitivity and specificity. It can be used with automated instruments and is easy to operate.

[0004] This invention is achieved through the following technical solution:

[0005] A kit for detecting genes related to precision medication for hypertension, comprising reaction solution I, reaction solution II, reaction solution III, reaction solution IV and reaction solution V;

[0006] The reaction solution I contains the reagents necessary for the PCR reaction, including: AceTaq DNA polymerase, Heat-labile UDG, Specific ROX Reference, dNTP / dUTP mix, and Mg. 2+ ;

[0007] The reaction solution II includes wild-type forward primers, wild-type shared reverse primers, and shared fluorescent probes for detecting the CYP2D6 gene, ADRB1 gene, NPPA gene, and CYP3A5 gene.

[0008] The reaction solution III includes mutant forward primers for detecting CYP2D6, ADRB1, NPPA and CYP3A5 genes, wild-type shared reverse primers and fluorescent probes;

[0009] The reaction solution IV includes wild-type forward primers for detecting the ACE gene, CYP2C9 gene, and AGTR1 gene, a wild-type shared reverse primer, and a shared fluorescent probe;

[0010] The reaction solution V includes mutant forward primers for detecting the ACE gene, CYP2C9 gene, and AGTR1 gene, a wild-type shared reverse primer, and a shared fluorescent probe.

[0011] The nucleotide sequences of the primers and probes in reaction solution II are shown below (direction: 5'-3') (F represents the forward primer, R represents the reverse primer, and P represents the Taqman detection probe). Different fluorescent labels are attached to the four probes:

[0012] (1) CYP2D6-WF: GCTGGGCTGCACGCTAAC; as shown in SEQ ID NO.1;

[0013] (2) CYP2D6-R: CCTCCCTCACCTGGTCGAA; as shown in SEQ ID NO.2;

[0014] (3) CYP2D6-P: ACCAGGCCCCCTGCCACTGC, as shown in SEQ ID NO.3; 5' end is marked FAM, 3' end is marked BHQ1;

[0015] (4) ADRB1-WF: CGCAAGAGCCTTGCAGG; as shown in SEQ ID NO.4;

[0016] (5) ADRB1-R: TGGGTCGCGTGGCG; as shown in SEQ ID NO.5;

[0017] (6)ADRB1-P: ACTGCTCTGCTGCGCGCGC, as shown in SEQ ID NO.6; the 5' end is marked with VIC, and the 3' end is marked with BHQ1;

[0018] (7) NPPA-WF: AGATATGTCTGTGTTCTCTTTGCAGTGCT; as shown in SEQ ID NO.7;

[0019] (8) NPPA-R: GGCAACAAGATGACACAAATGC; as shown in SEQ ID NO.8;

[0020] (9) NPPA-P: CAGACTGCAAGAGGCTCCTGTCCCC, as shown in SEQ ID NO.9; the 5' end is marked NED, and the 3' end is marked BHQ2;

[0021] (10) CYP3A5-WF: GTGGTCCAAACAGGGAAGAGATGT; as shown in SEQ ID NO.10;

[0022] (11) CYP3A5-R: CATTATGGAGAGTGGCATAGGAGAT; as shown in SEQ ID NO.11;

[0023] (12) CYP3A5-P: CATTCGTTAAGCTGGGTGGTACATACGTGG, as shown in SEQ ID NO.12; the 5' end is marked CY5, and the 3' end is marked BHQ3.

[0024] The nucleotide sequences of the primers and probes in reaction solution III are shown below (direction: 5'-3'), and different fluorescent labels are attached to the four probes:

[0025] (1) CYP2D6-MF: GCTGGGCTGCACGCTAGT; as shown in SEQ ID NO.13;

[0026] (2)CYP2D6-R: CCTCCCTCACCTGGTCGAA;

[0027] (3)CYP2D6-P:ACCAGGCCCCCTGCCACTGC, 5' end is marked with FAM, 3' end is marked with BHQ1;

[0028] (4) ADRB1-MF: CGCAAGGCCTTGCAGC; as shown in SEQ ID NO.14;

[0029] (5)ADRB1-R:TGGGTCGCGTGGCG;

[0030] (6)ADRB1-P: ACTGCTCTGCTGCGCGCGC, 5' end is marked with VIC, 3' end is marked with BHQ1;

[0031] (7) NPPA-MF: GATATTGTCTGTGTTCTCTTTGCAGTGCC; as shown in SEQ ID NO.15;

[0032] (8)NPPA-R: GGCAACAAGATGACACAAATGC;

[0033] (9)NPPA-P: CAGACTGCAAGAGGCTCCTGTCCCC, 5' end marked NED, 3' end marked BHQ2;

[0034] (10) CYP3A5-MF: GTGGTCCAAACAGGGAAGAGATGC; as shown in SEQ ID NO.16;

[0035] (11)CYP3A5-R:CATTATGGAGAGTGGCATAGGAGAT;

[0036] (12)CYP3A5-P:CATTCGTTAAGCTGGGTGGTACATACGTGG, 5' end is marked CY5, 3' end is marked BHQ3.

[0037] The nucleotide sequences of the primers and probes in reaction solution IV are shown below (direction: 5'-3'), and different fluorescent labels are attached to the three probes:

[0038] (1) ACE-DF: ACCTGCTGCCTATACAGTCACTTTTA; as shown in SEQ ID NO.17;

[0039] (2) ACE-R: GGGACGTGGCCATCACA; as shown in SEQ ID NO.18;

[0040] (3) ACE-P: CAAGGCATTCAAACCCCTACCAGATCTG, as shown in SEQ ID NO.19; the 5' end is labeled FAM, and the 3' end is labeled BHQ1;

[0041] (4) CYP2C9-WF: GTGCACGAGGTCCAGAGCTACA; as shown in SEQ ID NO.20;

[0042] (5) CYP2C9-R: CGAAAACATGGAGTTGCAGTGT; as shown in SEQ ID NO.21;

[0043] (6) CYP2C9-P: TGACCTTCTCCCCACCAGCCTGC, as shown in SEQ ID NO.22; the 5' end is marked NED, and the 3' end is marked BHQ2;

[0044] (7) AGTR1-WF: CAGCACTTCACTACCAAATGACCA; as shown in SEQ ID NO.23;

[0045] (8) AGTR1-R: TTCATCGAGTTTCTGACATTGTTCT; as shown in SEQ ID NO.24;

[0046] (9) AGTR1-P: TTGCATTAGACAGATGACGGCTGCTCG, as shown in SEQ ID NO.25; the 5' end is marked CY5, and the 3' end is marked BHQ3.

[0047] The nucleotide sequences of the primers and probes in reaction solution V are shown below (direction: 5'-3'), and different fluorescent labels are attached to the three probes:

[0048] (1) ACE-IF: GGGATTACAGGCGTGATACAGTC; as shown in SEQ ID NO.26;

[0049] (2)ACE-R:GGGACGTGGCCATCACA;

[0050] (3) ACE-P: CAAGGCATTCAAACCCCTACCAGATCTG, 5' end marked FAM, 3' end marked BHQ1;

[0051] (4) CYP2C9-MF: GTGCACGAGGTCCAGAGATCCC; as shown in SEQ ID NO.27;

[0052] (5)CYP2C9-R:CGAAAACATGGAGTTGCAGTGT;

[0053] (6)CYP2C9-P:TGACCTTCTCCCCACCAGCCTGC, 5' end marked with NED, 3' end marked with BHQ2;

[0054] (7) AGTR1-MF: AGCACTTCACTACCAAATGAGGC; as shown in SEQ ID NO.28;

[0055] (8) AGTR1-R: TTCATCGAGTTTTCTGACATTGTTCT;

[0056] (9)AGTR1-P: TTGCATTAGACAGATGACGGCTGCTCG, 5' end marked CY5, 3' end marked BHQ3.

[0057] Furthermore, the kit also includes positive and negative controls.

[0058] Furthermore, the positive control includes an ADRB1 wild-type plasmid, an ADRB1 mutant plasmid, and an ACE insert plasmid. The negative control is a buffer solution free of the target gene, preferably water.

[0059] The method for detecting hypertension precision medication-related genes using the above kit (multiplex fluorescence PCR): Genomic DNA is extracted from the sample to be tested (using an oral swab), and PCR amplification and detection are performed using the above kit, divided into 4 reaction systems:

[0060] Wild-type quadruple reaction system W1: consists of genomic DNA of the sample, positive control, negative control, reaction solution I, and reaction solution II;

[0061] The mutant quadruple reaction system M1 consists of genomic DNA from the sample, positive control, negative control, reaction solution I, and reaction solution III;

[0062] The wild-type triple reaction system W2 consists of genomic DNA from the sample, positive control, negative control, reaction solution I, and reaction solution IV;

[0063] The mutant triple reaction system M2 consists of genomic DNA from the sample, positive control, negative control, reaction solution I, and reaction solution V;

[0064] The test results are then interpreted. The genotype is determined by directly reading the Cq value of the qPCR detection system and using the difference ΔCq between the wild-type and mutant wells to determine the wild-type, mutant, or heterozygous genotype. Specifically, in a quadruple reaction system, when ΔCq ≤ 3, the result is heterozygous; when ΔCq(wCq-mCq) > 3, the result is mutant; and when ΔCq(mCq-wCq) > 3, the result is wild-type. In a triple reaction system, when ΔCq ≤ 2, the result is heterozygous; when ΔCq(wCq-mCq) > 2, the result is mutant (ACE insertion); and when ΔCq(mCq-wCq) > 2, the result is wild-type (ACE deletion).

[0065] Furthermore, the four reaction systems are specifically shown in Tables 1, 2, 3, and 4.

[0066] Table 1 Wild-type quadruple reaction system W1

[0067] PCR reaction solution I PCR Reaction Solution II Sample DNA (10 ng / μL) Positive quality control Negative control (water) 10μL 9μL 1μL 10μL 9μL 1μL 10μL 9μL 1μL

[0068] Table 2 Mutant Quadruple Reaction System M1

[0069] PCR reaction solution I PCR Reaction Solution III Sample DNA (10 ng / μL) Positive quality control Negative control (water) 10μL 9μL 1μL 10μL 9μL 1μL 10μL 9μL 1μL

[0070] Table 3 Wild-type (deleted) triple reaction system W2

[0071] PCR reaction solution I PCR reaction solution IV Sample DNA (10 ng / μL) Negative control (water) 10μL 9μL 1μL 10μL 9μL 1μL

[0072] Table 4. Mutant (Insertion) Triple Reaction System M2

[0073] PCR reaction solution I PCR reaction solution V Sample DNA (10 ng / μL) Positive quality control Negative control (water) 10μL 9μL 1μL 10μL 9μL 1μL 10μL 9μL 1μL

[0074] In reaction solutions II and III, the concentration of primers for each gene is 0.2 μM, and the concentration of probes is 0.1 μM. In reaction solutions IV and V, the concentration of the forward primer for AGTR1 is 0.4 μM, the concentration of other primers is 0.2 μM, and the concentration of probes is 0.1 μM.

[0075] Furthermore, the reaction procedure is shown in Table 5.

[0076] Table 5

[0077]

[0078] This invention relates to a kit for detecting genes related to precision medication for hypertension. It utilizes mismatch-modified AS-Taqman qPCR technology, amplifying human genomic DNA with mismatch-modified AS-specific primers. Amplification is effective when the primers perfectly match the target sequence; otherwise, amplification is inhibited. The amplified products are detected using Taqman probes, enabling parallel detection of seven hypertension loci in the sample DNA on a real-time fluorescence PCR platform. This achieves high specificity and high sensitivity, and the genotype of the detected locus is determined based on the magnitude of ΔCq.

[0079] The kit for detecting genes related to precision medication for hypertension of this invention detects polymorphisms at the following loci: rs1065852 of the CYP2D6 gene, rs1801253 of the ADRB1 gene, rs5065 of the NPPA gene, rs776746 of the CYP3A5 gene, rs1057910 of the CYP2C9 gene, rs5186 of the AGTR1 gene, and rs4646994 of the ACE gene. Only four PCR tubes are needed to accurately detect 21 genotypes at seven loci in a single sample. It is simple, efficient, and highly sensitive, effectively guiding the clinical application of antihypertensive drug-related genes. It has the following advantages:

[0080] 1. Cost-saving: Universal Taqman probes and reverse primers are designed for antihypertensive drug-related genes CYP2D6, ADRB1, NPPA, CYP3A5, ACE, CYP2C9, and AGTR1. By using only the different mismatched forward primers, specific amplification and identification of the corresponding gene polymorphisms can be performed. Compared with primer locked nucleic acid design, MGB probe method, and dual probe method, it greatly saves costs.

[0081] 2. Detection is performed using real-time PCR technology. The detection system incorporates the UDG enzyme anti-contamination system and is conducted in a closed tube throughout the process, which can greatly reduce the risk of contamination and improve the accuracy of detection.

[0082] 3. Rapid detection and simple, feasible interpretation methods.

[0083] 4. Except for ACE(II) and ADRB1, other loci do not require positive controls; the genotype of the corresponding locus can be determined solely by the CT value.

[0084] 5. Genomic DNA is extracted using oral swabs. No needles or skin punctures are required, and it will not cause any pain. People with high blood pressure will be more relaxed and less stressed during the DNA collection process. Attached Figure Description

[0085] Figure 1 Schematic diagram of the amplification curve of the wild-type quadruple detection system W1.

[0086] Figure 2 Schematic diagram of the amplification curve of the mutant quadruple detection system M1.

[0087] Figure 3 A schematic diagram of the amplification curve of the wild-type (deleted) triple detection system W2.

[0088] Figure 4 A schematic diagram of the amplification curve of the mutation (insertion) quadruple detection system W2.

[0089] Figure 5 Amplification detection image of wild-type CYP2D6 (rs1065852).

[0090] Figure 6 Amplification detection diagram of CYP2D6(rs1065852) mutant.

[0091] Figure 7 Amplification detection diagram of CYP2D6(rs1065852) heterozygous type.

[0092] Figure 8 Amplification detection image of wild-type ADRB1 (rs1801253).

[0093] Figure 9 Amplification detection diagram of the ADRB1 (rs1801253) mutant.

[0094] Figure 10 Amplification detection diagram of the heterozygous ARB1 (rs1801253).

[0095] Figure 11 Amplification detection diagram of wild-type NPPA (rs5065).

[0096] Figure 12 Amplification detection diagram of NPPA(rs5065) mutant.

[0097] Figure 13 Amplification detection diagram of NPPA(rs5065) heterozygous type.

[0098] Figure 14 Amplification detection image of wild-type CYP3A5 (rs776746).

[0099] Figure 15 Amplification detection diagram of CYP3A5 (rs776746) mutant.

[0100] Figure 16 Amplification detection diagram of CYP3A5 (rs776746) heterozygous type.

[0101] Figure 17 Amplification detection diagram of ACE(rs4646994) deletion type.

[0102] Figure 18 Amplification detection diagram of ACE(rs4646994) insertion.

[0103] Figure 19 Amplification detection diagram of ACE(rs4646994) heterozygous type.

[0104] Figure 20 Amplification detection image of wild-type CYP2C9 (rs1057910).

[0105] Figure 21 Amplification detection diagram of CYP2C9 (rs1057910) mutant.

[0106] Figure 22 Amplification detection diagram of CYP2C9 (rs1057910) heterozygous type.

[0107] Figure 23 Amplification detection image of wild-type AGTR1 (rs5186).

[0108] Figure 24Amplification detection diagram of AGTR1 (rs5186) mutant.

[0109] Figure 25 Amplification detection diagram of AGTR1 (rs5186) heterozygous type. Detailed Implementation

[0110] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0111] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0112] In the embodiments of this invention, the primers and Taqman probes involved were all synthesized by their respective design companies. Taqmix was purchased from Nanjing Novizan Biotech Co., Ltd.

[0113] The design process of the primers and Taqman probes involved in this invention is as follows:

[0114] (1) Determining primer sequences using single-system methods

[0115] AS forward primer sequences, universal reverse primer sequences, and probe sequences were designed for CYP2D6 (rs1065852), ADRB1 (rs1801253), NPPA (rs5065), CYP3A5 (rs776746), ACE (rs4646994), CYP2C9 (rs1057910), and AGTR1 (rs5186). Except for ADRB1, the AS primers for the other six sites exhibited extremely weak specificity, almost unable to distinguish between wild-type, heterozygous, and mutant types. Therefore, mismatch design was added to the AS forward primer sequences, introducing mismatched bases at the second, third, and fifth positions of the 3' end of the primers to enhance primer specificity. Suitable primers were screened using a singlet qPCR system.

[0116] (2) Multiple system validation of primer specificity

[0117] The genes CYP2D6, ADRB1, NPPA, and CYP3A5 related to β-blockers, diuretics, and calcium antagonists were used as a quadruple reaction system; the genes ACE, CYP2C9, and AGTR1 related to angiotensin were used as a triple reaction system; and the specificity of the primers and probes screened by the single qPCR system was verified using 200 samples.

[0118] (3) Verify primer stability by amplification efficiency

[0119] Heterozygous samples were selected for each sample, and multiplex qPCR experiments were performed at sample concentrations of 40ng, 20ng, 10ng, 5ng, 2.5ng, and 1.25ng, respectively. Robustness analysis of the experimental results was conducted, and suitable primers were finally determined. The experimental system was stable, and the experimental results were all within the expected range.

[0120] Example 1

[0121] A kit for detecting genes related to precision medication for hypertension, comprising reaction solution I, reaction solution II, reaction solution III, reaction solution IV and reaction solution V;

[0122] The reaction solution I contains the reagents necessary for the PCR reaction, including: AceTaq DNA polymerase, Heat-labile UDG, Specific ROX Reference, dNTP / dUTP mix, and Mg. 2+ ;

[0123] The reaction solution II includes wild-type forward primers, wild-type shared reverse primers, and shared fluorescent probes for detecting the CYP2D6 gene, ADRB1 gene, NPPA gene, and CYP3A5 gene.

[0124] The reaction solution III includes mutant forward primers for detecting CYP2D6, ADRB1, NPPA and CYP3A5 genes, wild-type shared reverse primers and fluorescent probes;

[0125] The reaction solution IV includes wild-type forward primers for detecting the ACE gene, CYP2C9 gene, and AGTR1 gene, a wild-type shared reverse primer, and a shared fluorescent probe;

[0126] The reaction solution V includes mutant forward primers for detecting the ACE gene, CYP2C9 gene, and AGTR1 gene, a wild-type shared reverse primer, and a shared fluorescent probe.

[0127] The nucleotide sequences of the primers and probes in reaction solution II are shown below (direction: 5'-3'), and different fluorescent labels are attached to the four probes:

[0128] (1)CYP2D6-WF:GCTGGGCTGCACGCTAAC;

[0129] (2)CYP2D6-R: CCTCCCTCACCTGGTCGAA;

[0130] (3)CYP2D6-P:ACCAGGCCCCCTGCCACTGC, 5' end is marked with FAM, 3' end is marked with BHQ1;

[0131] (4) ADRB1-WF: CGCAAGGCCTTTGCAGG;

[0132] (5)ADRB1-R:TGGGTCGCGTGGCG;

[0133] (6)ADRB1-P: ACTGCTCTGCTGCGCGCGC, 5' end is marked with VIC, 3' end is marked with BHQ1;

[0134] (7)NPPA-WF: AGATATGTCTGTGTTCTCTTTGCAGTGCT;

[0135] (8)NPPA-R: GGCAACAAGATGACACAAATGC;

[0136] (9)NPPA-P: CAGACTGCAAGAGGCTCCTGTCCCC, 5' end marked NED, 3' end marked BHQ2;

[0137] (10)CYP3A5-WF: GTGGTCCAAACAGGGAAGAGATGT;

[0138] (11)CYP3A5-R:CATTATGGAGAGTGGCATAGGAGAT;

[0139] (12) CYP3A5-P: CATTCGTTAAGCTGGGTGGTACATACGTGG, 5' end labeled with CY5, 3' end labeled with BHQ3. The nucleotide sequences of the primers and probes in reaction solution III are shown below (direction: 5'-3'), and different fluorescent labels are attached to the four probes:

[0140] (1)CYP2D6-MF:GCTGGGCTGCACGCTAGT;

[0141] (2)CYP2D6-R: CCTCCCTCACCTGGTCGAA;

[0142] (3)CYP2D6-P:ACCAGGCCCCCTGCCACTGC, 5' end is marked with FAM, 3' end is marked with BHQ1;

[0143] (4)ADRB1-MF:CGCAAGGCCTTGCAGC;

[0144] (5)ADRB1-R:TGGGTCGCGTGGCG;

[0145] (6)ADRB1-P: ACTGCTCTGCTGCGCGCGC, 5' end is marked with VIC, 3' end is marked with BHQ1;

[0146] (7)NPPA-MF: GATATGTCTGTGTTTCTCTTGCAGTGCC;

[0147] (8)NPPA-R: GGCAACAAGATGACACAAATGC;

[0148] (9)NPPA-P: CAGACTGCAAGAGGCTCCTGTCCCC, 5' end marked NED, 3' end marked BHQ2;

[0149] (10)CYP3A5-MF: GTGGTCCAAACAGGGAAGAGATGC;

[0150] (11)CYP3A5-R:CATTATGGAGAGTGGCATAGGAGAT;

[0151] (12)CYP3A5-P:CATTCGTTAAGCTGGGTGGTACATACGTGG, 5' end is marked CY5, 3' end is marked BHQ3.

[0152] The nucleotide sequences of the primers and probes in reaction solution IV are shown below (direction: 5'-3'), and different fluorescent labels are attached to the three probes:

[0153] (1)ACE-DF:ACCTGCTGCCTATACAGTCACTTTTA;

[0154] (2)ACE-R:GGGACGTGGCCATCACA;

[0155] (3) ACE-P: CAAGGCATTCAAACCCCTACCAGATCTG, 5' end marked FAM, 3' end marked BHQ1;

[0156] (4)CYP2C9-WF: GTGCACGAGGTCCAGAGCTACA;

[0157] (5)CYP2C9-R:CGAAAACATGGAGTTGCAGTGT;

[0158] (6)CYP2C9-P:TGACCTTCTCCCCACCAGCCTGC, 5' end marked with NED, 3' end marked with BHQ2;

[0159] (7) AGTR1-WF: CAGCACTTCACTACCAAATGACCA;

[0160] (8) AGTR1-R: TTCATCGAGTTTTCTGACATTGTTCT;

[0161] (9)AGTR1-P: TTGCATTAGACAGATGACGGCTGCTCG, 5' end marked CY5, 3' end marked BHQ3.

[0162] The nucleotide sequences of the primers and probes in reaction solution V are shown below (direction: 5'-3'), and different fluorescent labels are attached to the three probes:

[0163] (1)ACE-IF: GGGATTACAGGCGTGATACAGTC;

[0164] (2)ACE-R:GGGACGTGGCCATCACA;

[0165] (3) ACE-P: CAAGGCATTCAAACCCCTACCAGATCTG, 5' end marked FAM, 3' end marked BHQ1;

[0166] (4)CYP2C9-MF: GTGCACGAGGTCCAGAGATCCC;

[0167] (5)CYP2C9-R:CGAAAACATGGAGTTGCAGTGT;

[0168] (6)CYP2C9-P:TGACCTTCTCCCCACCAGCCTGC, 5' end marked with NED, 3' end marked with BHQ2;

[0169] (7)AGTR1-MF:AGCACTTCACTACCAAATGAGGC;

[0170] (8) AGTR1-R: TTCATCGAGTTTTCTGACATTGTTCT;

[0171] (9)AGTR1-P: TTGCATTAGACAGATGACGGCTGCTCG, 5' end marked CY5, 3' end marked BHQ3.

[0172] The kit also includes positive and negative controls. The positive controls include an ADRB1 wild-type plasmid, an ADRB1 mutant plasmid, and an ACE insert plasmid. The negative controls are buffer solutions that do not contain the target gene.

[0173] The method for detecting hypertension precision medication-related genes using the above kit (multiplex fluorescence PCR): Genomic DNA was extracted from the sample to be tested (using an oral swab). PCR amplification and detection were performed using the above kit, divided into four reaction systems. The composition of each reaction system is shown in Tables 6, 7, 8, and 9. The reaction procedure is shown in Table 5. The obtained amplification curves are shown in Table 5. Figure 1 , 2 As shown in Figures 3 and 4, the detection of CYP2D6 (rs1065852), ADRB1 (rs1801253), NPPA (rs5065), CYP3A5 (rs776746), ACE (rs4646994), CYP2C9 (rs1057910), and AGTR1 (rs5186) sites shows obvious peaks, indicating that these four sets of primers and probes can effectively detect these seven sites.

[0174] Table 6

[0175]

[0176] Table 7

[0177]

[0178] Table 8

[0179]

[0180] Table 9

[0181]

[0182]

[0183] Example 2: Practical Application of the Reagent Kit

[0184] The steps are as follows:

[0185] 1. Oral swab DNA samples were extracted using the QIAamp DNA Mini Kit (50), catalog number: 51304, developed by QIAamp GmbH, Germany.

[0186] 2. Mismatch-modified forward primers, reverse universal primers, and Taqman universal detection probes for sample detection are shown in Example 1.

[0187] 3. qPCR amplification: Using the four sets of primers and probes from reaction solutions II, III, IV and V, a wild-type quadruple detection system W1, a mutant quadruple detection system M1, a wild-type triple detection system W2, and a mutant triple detection system M2 were constructed. The total volume of the system was 20 μL, and the composition was the same as in Example 1.

[0188] 4. PCR reaction procedure: Same as in Example 1. Each batch of testing reaction includes a positive control (MPC) and a negative control (MNC). For the positive control, the DNA sample is replaced with a mixture of ADRB1 wild-type plasmid, mutant plasmid, and ACE insert plasmid. For the negative control, the DNA sample is replaced with sterile water.

[0189] 5. Experimental Results: The results are valid when both MPC and MNC are normal. After qPCR, the Cq value of the qPCR detection system is directly read. The wild-type, mutant, and heterozygous gene is determined based on the difference ΔCq between the wild-type and mutant wells in the qPCR detection system. The detection results are analyzed using the ΔCq value, and the results are shown in Table 10.

[0190] Table 10

[0191]

[0192]

[0193] Example 3: Evaluation of the detection limit of the kit

[0194] Using human genomic DNA as a sample, genomic DNA concentrations of 3 ng, 1 ng, 0.3 ng, 0.1 ng, and 0.03 ng were prepared. DNA was extracted according to the method in Example 2, and the genotype of the DNA samples was detected. Each concentration of sample was tested twice for seven detection target sites (including at least all heterozygous types).

[0195] The results showed that the seven sites CYP2D6 (rs1065852), ADRB1 (rs1801253), NPPA (rs5065), CYP3A5 (rs776746), ACE (rs4646994), CYP2C9 (rs1057910), and AGTR1 (rs5186) were detected at concentrations of 3 ng, 1 ng, 0.3 ng, and 0.1 ng, but could not be detected at a concentration of 0.03 ng. Therefore, the detection limit of the primers and probes of this invention is approximately 0.1 ng.

[0196] Example 4: Evaluation of cross-reactivity of the kit

[0197] Linear plasmid samples containing approximately 2941 copies (10 ng of human DNA sample) of homologous material were prepared and analyzed in triplicate. No cross-reactivity of homologous plasmids was observed at any of the seven detection target sites (including at least all heterozygous types). The homologous material included the homologous genes CYP2J2 and CYP2C8 of CYP2D6 (rs1065852), the homologous genes ADRB2 and ADRB3 of ADRB1 (rs1801253), the homologous gene NPPB of NPPA (rs5065), the homologous genes CYP3A4 and CYP3A7 of CYP3A5 (rs776746), the homologous genes intron 1 and intron 2 of ACE (rs4646994), the homologous genes CYP2C19 and CYP2C18 of CYP2C9 (rs1057910), and the homologous genes AGTR2 and APLNR of AGTR1 (rs5186).

[0198] DNA was extracted according to the method in Example 2, and the genotype of the samples was detected. Heterozygous genotype at each locus was detected three times. All samples were found to be heterozygous.

[0199] Using 10 ng of human genomic DNA as a background, a 50% homologous plasmid mixture sample was prepared and tested in 3 replicates. No cross-reactivity of homologous plasmids was detected in any of the 7 detection target sites (including at least all heterozygotes).

[0200] The above test results indicate that homologous substances do not cause cross-reactions.

[0201] Example 5: Methodological Consistency Comparison

[0202] DNA from oral swabs of 100 volunteers was collected and sequenced. The sequencing results were then compared with the method of this invention for methodological consistency.

[0203] Sequencing of 7 sites was performed on 100 human genomic DNA samples, and the results are shown in Table 11.

[0204] The method of this invention was used to perform multiplex quantitative PCR detection at 7 loci on 100 human genomic DNA samples. The results are as follows: Figures 5-25 As shown in Table 12.

[0205] A comparison of the results of the two methods shows that when performing genotyping on clinical samples from seven loci—CYP2D6 (rs1065852), ADRB1 (rs1801253), NPPA (rs5065), CYP3A5 (rs776746), ACE (rs4646994), CYP2C9 (rs1057910), and AGTR1 (rs5186)—the method of this invention achieves a 100% concordance rate with the sequencing method.

[0206] Table 11

[0207]

[0208]

[0209]

[0210]

[0211] Table 12

[0212]

[0213]

[0214]

[0215] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. A kit for detecting genes related to precision medication for hypertension, characterized in that: Including reaction solution I, reaction solution II, reaction solution III, reaction solution IV and reaction solution V; The reaction solution I is a reagent required for PCR reaction; The reaction solution II includes wild-type forward primers, wild-type shared reverse primers, and shared fluorescent probes for detecting the CYP2D6 gene, ADRB1 gene, NPPA gene, and CYP3A5 gene. The reaction solution III includes mutant forward primers for detecting CYP2D6, ADRB1, NPPA and CYP3A5 genes, wild-type shared reverse primers and fluorescent probes; The reaction solution IV includes wild-type forward primers for detecting the ACE gene, CYP2C9 gene, and AGTR1 gene, a wild-type shared reverse primer, and a shared fluorescent probe; The reaction solution V includes mutant forward primers for detecting the ACE gene, CYP2C9 gene, and AGTR1 gene, a wild-type shared reverse primer, and a shared fluorescent probe; The reaction solution I comprises: AceTaq DNA polymerase, Heat-labile UDG, Specific ROX Reference, dNTP / dUTP mix, and Mg. 2+ ; The nucleotide sequences of the primers and probes in reaction solution II are shown below, and different fluorescent labels are attached to the four probes: (1) CYP2D6-WF:GCTGGGCTGCACGCTAAC; (2) CYP2D6-R: CCTCCCTCACCTGGTCGAA; (3) CYP2D6-P: ACCAGGCCCCCTGCCACTGC, 5' end labeled FAM, 3' end labeled BHQ1; (4) ADRB1-WF: CGCAAGGCCTTTGCAGG; (5) ADRB1-R: TGGGTCGCGTGGCG; (6) ADRB1-P: ACTGCTCTGCTGCGCGCGC, 5' end labeled VIC, 3' end labeled BHQ1; (7) NPPA-WF: AGATATGTCTGTGTTCTCTTTGCAGTGCT; (8) NPPA-R: GGCAACAAGATGACACAAATGC; (9) NPPA-P: CAGACTGCAAGAGGCTCCTGTCCCC, 5' end marked NED, 3' end marked BHQ2; (10) CYP3A5-WF: GTGGTCCAAACAGGGAAGAGATGT; (11) CYP3A5-R: CATTATGGAGAGTGGCATAGGGAT; (12) CYP3A5-P: CATTCGTTAAGCTGGGTGGTACATACGTGG, 5' end is marked CY5, 3' end is marked BHQ3; The nucleotide sequences of the primers and probes in reaction solution III are shown below, and different fluorescent labels are attached to the four probes: (1) CYP2D6-MF:GCTGGGCTGCACGCTAGT; (2) CYP2D6-R: CCTCCCTCACCTGGTCGAA; (3) CYP2D6-P: ACCAGGCCCCCTGCCACTGC, 5' end labeled FAM, 3' end labeled BHQ1; (4) ADRB1-MF:CGCAAGGCCTTTGCAGC; (5) ADRB1-R: TGGGTCGCGTGGCG; (6) ADRB1-P: ACTGCTCTGCTGCGCGCGC, 5' end labeled VIC, 3' end labeled BHQ1; (7) NPPA-MF: GATATGTCTGTGTTCTCTTTGCAGTGCC; (8) NPPA-R: GGCAACAAGATGACACAAATGC; (9) NPPA-P: CAGACTGCAAGAGGCTCCTGTCCCC, 5' end marked NED, 3' end marked BHQ2; (10) CYP3A5-MF: GTGGTCCAAACAGGGAAGAGATGC; (11) CYP3A5-R: CATTATGGAGAGTGGCATAGGGAT; (12) CYP3A5-P: CATTCGTTAAGCTGGGTGGTACATACGTGG, 5' end is marked CY5, 3' end is marked BHQ3; The nucleotide sequences of the primers and probes in reaction solution IV are shown below, and different fluorescent labels are attached to the three probes: (1) ACE-DF:ACCTGCTGCCTATACAGTCACTTTTA; (2) ACE-R:GGGACGTGGCCATCACA; (3) ACE-P: CAAGGCATTCAAACCCCTACCAGATCTG, 5' end marked FAM, 3' end marked BHQ1; (4) CYP2C9-WF: GTGCACGAGGTCCAGAGCTACA; (5) CYP2C9-R: CGAAAACATGGAGTTGCAGTGT; (6) CYP2C9-P: TGACCTTCTCCCCACCAGCCTGC, 5' end marked with NED, 3' end marked with BHQ2; (7) AGTR1-WF: CAGCACTTCACTACCAAATGACCA; (8) AGTR1-R: TTCATCGAGTTTCTGACATTGTTCT; (9) AGTR1-P: TTGCATTAGACAGATGACGGCTGCTCG, 5' end marked CY5, 3' end marked BHQ3; The nucleotide sequences of the primers and probes in reaction solution V are shown below, with different fluorescent labels attached to the three probes: (1) ACE-IF: GGGATTACAGGCGTGATACAGTC; (2) ACE-R:GGGACGTGGCCATCACA; (3) ACE-P: CAAGGCATTCAAACCCCTACCAGATCTG, 5' end marked FAM, 3' end marked BHQ1; (4) CYP2C9-MF: GTGCACGAGGTCCAGAGATCCC; (5) CYP2C9-R: CGAAAACATGGAGTTGCAGTGT; (6) CYP2C9-P: TGACCTTCTCCCCACCAGCCTGC, 5' end marked with NED, 3' end marked with BHQ2; (7) AGTR1-MF:AGCACTTCACTACCAAATGAGGC; (8) AGTR1-R: TTCATCGAGTTTCTGACATTGTTCT; (9) AGTR1-P: TTGCATTAGACAGATGACGGCTGCTCG, 5' end marked CY5, 3' end marked BHQ3.

2. The kit for detecting genes related to precision medication for hypertension according to claim 1, characterized in that: The kit also includes positive and negative controls.

3. The kit for detecting genes related to precision medication for hypertension according to claim 2, characterized in that: The positive control includes ADRB1 wild-type plasmid, ADRB1 mutant plasmid, and ACE insert plasmid; the negative control is a buffer solution that does not contain the target gene.

Citation Information

Patent Citations

  • Drug metabolic enzyme related gene SNP fluorescence labeling composite amplification kit

    CN105779601A

  • Detection composition for guiding hypertension medication, applications of detection composition, kit and detection method

    CN106367479A

  • Polymorphism detection system and kit for gene relevant to personalized medication for cardiovascular disease

    CN107641645A