Mining of SNPs in the 5B genome sequence of the wheat grain weight gene and development and application of KASP molecular markers

By mining closely linked SNP variant sites on wheat chromosome 5B and developing KASP molecular markers, the problem of grain weight trait identification in wheat breeding was solved, enabling rapid and accurate identification of grain traits and molecular marker-assisted selection, thus improving breeding efficiency.

CN115927701BActive Publication Date: 2026-07-03INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2022-07-21
Publication Date
2026-07-03

Smart Images

  • Figure CN115927701B_ABST
    Figure CN115927701B_ABST
Patent Text Reader

Abstract

This invention discloses the mining of SNPs in the 5B genomic sequence of the wheat grain weight gene and the development and application of KASP molecular markers. This invention provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype based on SNP883 in the genomic DNA of the wheat to be tested is AA, GG, or AG; wheat with the AA genotype has superior grain traits compared to wheat with the GG genotype. This invention also provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype based on SNP1672 in the genomic DNA of the wheat to be tested is GG, CC, or GC; wheat with the GG genotype has superior grain traits compared to wheat with the CC genotype. This invention has promising applications in marker-assisted selection and molecular design breeding for improving wheat grain weight.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the mining of SNPs in the 5B genome sequence of wheat grain weight gene and the development and application of KASP molecular markers. Background Technology

[0002] Wheat is a widely cultivated grass species worldwide, with approximately 40% of the world's population relying on it as a staple food. Therefore, utilizing molecular biology techniques to identify genes related to thousand-grain weight, studying their biological functions and regulatory mechanisms, and developing functional molecular markers based on these markers will provide important reference gene resources for marker-assisted breeding of wheat. This has significant scientific and practical value in accelerating wheat breeding in my country and increasing wheat yield.

[0003] Thousand-grain weight is one of the three major factors affecting wheat yield, possessing over 80% stable heritability. Therefore, in production and breeding practices, thousand-grain weight is often used as an indicator of grain size, mainly composed of grain shape traits such as grain length, width, and thickness, and is significantly positively correlated with yield. Currently, several grain weight-related genes have been cloned in rice, a model plant of the Poaceae family. These genes are mostly involved in cell expansion and division, primarily functioning through various physiological and biochemical pathways, including ubiquitination of proteases, signaling pathways involving G proteins, and hormone regulation. However, in the field of wheat grain weight research, due to the large and complex genome structure of wheat, although numerous grain weight-related QTLs have been discovered, examples of directly isolating individual wheat grain weight genes using map-based cloning methods are still rare. On the other hand, in recent years, comparative genomics, developed based on the good collinearity of the genomes of Poaceae crops, has provided a theoretical basis for cloning important wheat genes. Reported wheat grain shape / grain weight genes isolated using this method include: ubiquitin degradation pathway... TaGW2 Genes, ubiquitin pathway DA1 Genes, key genes in the wheat starch synthesis pathway TaSus2 , OsGS5 Homologous genes in wheat TaGS-D1 and TaGS5 Genes, etc. Summary of the Invention

[0004] The purpose of this invention is to provide the mining of SNPs in the 5B genome sequence of wheat grain weight gene and the development and application of KASP molecular markers.

[0005] This invention provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps:

[0006] Using the genomic DNA of the wheat to be tested as a template, KASP amplification was performed using specific primer group A to obtain genotyping results, which were AA genotype, GG genotype or AG genotype;

[0007] The grain traits of AA genotype wheat are superior to those of GG genotype wheat.

[0008] The present invention also provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps:

[0009] Using the genomic DNA of the wheat to be tested as a template, KASP amplification was performed using specific primer set B to obtain genotyping results, which were GG genotype, CC genotype or GC genotype;

[0010] Grain traits of GG genotype wheat are superior to those of CC genotype wheat.

[0011] The present invention also provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype based on the SNP883 site in the genomic DNA of the wheat to be tested is AA, GG, or AG; the grain traits of AA genotype wheat are superior to those of GG genotype wheat; the SNP883 site is the 41st nucleotide in sequence 6 of the sequence listing, and is A or G.

[0012] The present invention also provides a method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype based on the SNP1672 site in the genomic DNA of the wheat to be tested is GG, CC, or GC; the grain traits of GG genotype wheat are superior to those of CC genotype wheat; the SNP1672 site is the 39th nucleotide in sequence 10 of the sequence listing, and is G or C.

[0013] This invention also protects specific primer set A.

[0014] This invention also protects specific primer set B.

[0015] This invention also protects the use of specific primer set A and / or specific primer set B in identifying or assisting in the identification of wheat grain traits.

[0016] The present invention also protects a kit for identifying or assisting in the identification of wheat grain traits, comprising specific primer set A and / or specific primer set B.

[0017] This invention also protects the application of any of the methods described above in wheat breeding. The breeding objective of this wheat breeding is to select wheat varieties with different grain traits. Specifically, the breeding objective of this wheat breeding is to select wheat varieties with superior grain traits.

[0018] This invention also protects the application of specific primer set A or specific primer set B or the kit described herein in wheat breeding. The breeding objective of this wheat breeding is to select wheat varieties with different grain traits. Specifically, the breeding objective of this wheat breeding is to select wheat varieties with superior grain traits.

[0019] The specific primer set A described above consists of primer 883F1, primer 883F2, and primer 883C; primer 883F1 is a single-stranded DNA molecule as shown in sequence 3 of the sequence listing; primer 883F2 is a single-stranded DNA molecule as shown in sequence 4 of the sequence listing; and primer 883C is a single-stranded DNA molecule as shown in sequence 5 of the sequence listing.

[0020] The specific primer set B described above consists of primer 1672F1, primer 1672F2, and primer 1672C; primer 1672F1 is a single-stranded DNA molecule as shown in sequence 7 of the sequence listing; primer 1672F2 is a single-stranded DNA molecule as shown in sequence 8 of the sequence listing; and primer 1672C is a single-stranded DNA molecule as shown in sequence 9 of the sequence listing.

[0021] The above-mentioned grain traits are grain weight and / or grain length and / or grain width and / or grain thickness.

[0022] Superior grain traits are manifested in: high grain weight and / or long grain length and / or wide grain width and / or thick grain.

[0023] The particle weight can specifically be the weight of 1,000 particles.

[0024] KASP: Kompetitive Allele Specific PCR.

[0025] The KASP amplification reaction system can be as follows (5µL): 2.4µL template DNA (total DNA content is 50ng), 0.04µL MgCl2 aqueous solution, 2.4µL 2×Master Mix, 0.06µL KASP primer group A, and 0.1µL ddH2O. In the PCR reaction system, the final concentration of magnesium ions is 0.2mM, the final concentration of primers 883F1 and 883F2 is 12µM, and the final concentration of primer 883C is 30µM.

[0026] The KASP amplification reaction system can be as follows (5µL): 2.4µL template DNA (total DNA content is 50ng), 0.04µL MgCl2 aqueous solution, 2.4µL 2×Master Mix, 0.06µL KASP primer group B, and 0.1µL ddH2O. In the PCR reaction system, the final concentration of magnesium ions is 0.2mM, the final concentration of primers 1672F1 and 1672F2 is 12µM, and the final concentration of primer 1672C is 30µM.

[0027] The reaction conditions for KASP amplification can be: 94℃ for 15 min; 95℃ for 20 s, annealing for 20 s (the annealing temperature of the first cycle is 65℃, and the annealing temperature of each cycle is reduced by 1℃ compared to the previous cycle), 10 cycles; 95℃ for 20 s, 57℃ for 20 s, 30 cycles.

[0028] KASP amplification was performed on an ABI QuantStudio 7 instrument, which automatically output genotyping results.

[0029] This invention identified two closely linked SNP variant sites on wheat chromosome 5B. Marker / trait association analysis in Chinese wheat microcore germplasm revealed that these two SNPs are associated with wheat grain traits. Furthermore, this superior allelic variation has been subject to strong selection during wheat breeding in my country. Based on these two SNPs, the inventors further developed two KASP primer sets. The method provided by this invention utilizes KASP amplification for genotyping, which is then used to assist in the identification of wheat grain traits. It offers advantages such as rapid, convenient, and accurate detection. This invention shows promising application prospects in marker-assisted selection and molecular design breeding for improving wheat grain weight. Attached Figure Description

[0030] Figure 1 This is an exemplary sequencing result of SNP883 and its surrounding nucleotides in a portion of the wheat material in Example 1.

[0031] Figure 2 This is an exemplary sequencing result of SNP1672 and its surrounding nucleotides in a portion of the wheat material in Example 1.

[0032] Figure 3 The results of the SNP883 typing of some wheat materials in Example 2 are shown.

[0033] Figure 4 The results are based on the SNP1672 typing of some wheat materials in Example 2.

[0034] Figure 5 The study investigated the changes in thousand-grain weight and the frequencies of two alleles in wheat varieties bred in different eras. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present invention in any way. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are all commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all set up with three replicate experiments, and each replicate experiment has more than five replicate treatments, and the results are averaged.

[0036] Example 1: Discovery of SNP sites and development of detection markers

[0037] I. Discovery of SNP loci associated with wheat grain weight trait

[0038] 1. Wheat materials used in the test

[0039] Thirty-four wheat accessions (numbered C1-34, see Table 1 for details, all of which are common wheat varieties in this field) distributed in different wheat-growing areas of my country and with significant differences in grain traits were selected as materials for the discovery of polymorphic sites.

[0040] 2. Sequence alignment and phenotypic statistics

[0041] Genomic DNA was extracted from 34 wheat samples and then amplified using specific primer pairs (which consist of primer F1 and primer R1, designed to target a specific target sequence, which was obtained by the inventors through extensive sequence amplification and comparison mining in preliminary experiments).

[0042] F1 (Sequence 1 of the sequence list): 5'-CATCCCACTACATGCAGACG-3';

[0043] R1 (Sequence 2 of the sequence listing): 5'-ATTGCCTACATCCTAAAGACCTAAAC-3'.

[0044] The amplified products were subjected to agarose gel electrophoresis, and the amplified fragments were then recovered and sequenced. Sequence assembly was performed using Seqman in DNAStar, and sequence alignment was performed using MegAlign. Two SNP variant sites were identified (SNP variant sites and their surrounding nucleotides are shown in [link to SNP analysis]). Figure 1 and Figure 2The two genotypes were named SNP883 and SNP1672, respectively. SNP883 has a polymorphic form of A or G, while SNP1672 has a polymorphic form of G or C. SNP883 should exhibit one of three genotypes in different varieties: AA (homozygous), GG (homozygous), or AG. SNP1672 should exhibit one of three genotypes in different varieties: GG (homozygous), CC (homozygous), or GC (heterozygous). Since all 34 sequenced wheat accessions were cultivated varieties, the genotypes of both SNPs were homozygous; no heterozygous genotypes were detected.

[0045] Furthermore, the thousand-grain weight of 34 wheat samples was statistically analyzed (the average value was taken from three consecutive years).

[0046] The thousand-grain weights of the 34 wheat materials and their genotypes based on SNP883 and SNP1672 are shown in Table 1.

[0047] Based on SNP883: the average thousand-grain weight of AA genotype wheat was 38.12g, and the average thousand-grain weight of GG genotype wheat was 29.87g; the thousand-grain weight of AA genotype wheat was significantly higher than that of GG genotype wheat. P <0.01). Based on SNP1672: the average thousand-grain weight of GG genotype wheat was 38.12 g, and the average thousand-grain weight of CC genotype wheat was 29.87 g; the thousand-grain weight of GG genotype wheat was significantly higher than that of CC genotype wheat. P <0.01).

[0048] Based on the above results, the two SNPs exhibit close linkage in different varieties, forming two haplotypes. One haplotype is characterized by SNP 883 being nucleotide A and SNP 1672 being nucleotide G, named [name missing]. HapⅠ (AG). Another haplotype is: when the nucleotide at SNP883 is G, the nucleotide at SNP1672 is C, named... HapⅡ (GC).

[0049] Table 1. Thousand-grain weight and genotypes based on SNP883 and SNP1672 of 34 wheat materials

[0050]

[0051] II. Development of KASP Tags

[0052] KASP primer sets were designed based on the SNP sites discovered in step one.

[0053] SNP883 and its surrounding nucleotides are shown in Sequence 6 of the sequence listing, where position 41 is the SNP883 site, which is a G / A polymorphism. The KASP primer set used to detect SNP883 is KASP primer set A. KASP primer set A consists of primers 883F1, 883F2, and 883C. Primer 883F1 is shown in Sequence 3 of the sequence listing. Primer 883F2 is shown in Sequence 4 of the sequence listing. Primer 883C is shown in Sequence 5 of the sequence listing.

[0054] Sequence 6: R is G or A

[0055] GTATGAAAGCGCACACACGAGACACGACACG GTTTGCTTTR CTTGGTTGTTGTTCAGTTTCCGATGCGC

[0056] 883F1: GAAGGTGACCAAGTTCATGCT GCGCATCGGAAACTGAACAACAACCAAGC;

[0057] 883F2: GAAGGTCGGAGTCAACGGATT GCGCATCGGAAACTGAACAACAACCAAGT;

[0058] 883C: GTATGAAAGCGCACACACGAGACACGACACG.

[0059] SNP1672 and its surrounding nucleotides are shown in Sequence 10 of the sequence listing, where position 39 is the SNP1672 site, which is a G / C polymorphism. The KASP primer set used to detect SNP1672 is KASP primer set B. KASP primer set B consists of primers 1672F1, 1672F2, and 1672C. Primer 1672F1 is shown in Sequence 7 of the sequence listing. Primer 1672F2 is shown in Sequence 8 of the sequence listing. Primer 1672C is shown in Sequence 9 of the sequence listing.

[0060] Sequence 10: S is G or C

[0061] CAGCCGCGCGCGCTACAGCTCCCTCCG GCCGCCGGCACS CACGGGCCGCCCGCCGCCCGCTC

[0062] 1672F1: GAAGGTGACCAAGTTCATGCT GAGCGGGCGGCGGGCGGCCCGTGC;

[0063] 1672F2: GAAGGTCGGAGTCAACGGATT GAGCGGGCGGCGGGCGGCCCGTGG;

[0064] 1672C: CAGCCGCGCGCGCTACAGCCTCCTCCG.

[0065] III. Detection of wheat genotypes based on SNP883 and SNP1672 using KASP primer sets

[0066] The following steps were performed on each of the tested wheat materials in Step 1:

[0067] 1. Extract genomic DNA from the tested wheat materials.

[0068] 2. Using genomic DNA as a template, KASP amplification was performed using KASP primer set A from step two. KASP amplification was run on an ABI QuantStudio 7 instrument, which automatically output the genotyping results. The genotyping results were based on SNP883 and were classified as AA, GG, or AG genotypes.

[0069] The KASP amplification reaction system (5µL) consists of: 2.4µL template DNA (total DNA content 50ng), 0.04µL MgCl2 aqueous solution, 2.4µL 2×Master Mix, 0.06µL KASP primer group A, and 0.1µL ddH2O. In the PCR reaction system, the final concentration of magnesium ions is 0.2mM, the final concentrations of primers 883F1 and 883F2 are both 12µM, and the final concentration of primer 883C is 30µM. The full name of the 2×Master Mix is ​​"KASP V4.0 2×Master Mix 96 / 384 (Low Rox)," manufactured by Beijing LGC Company, with product catalog number KBS-1016-017.

[0070] KASP amplification reaction program: 94℃ for 15 min; 95℃ for 20 s, annealing for 20 s (the annealing temperature of the first cycle is 65℃, and the annealing temperature of each cycle is reduced by 1℃ from the previous cycle), 10 cycles; 95℃ for 20 s, 57℃ for 20 s, 30 cycles.

[0071] 3. Using genomic DNA as a template, KASP amplification was performed using KASP primer set B from step two. KASP amplification was run on an ABI QuantStudio 7 instrument, which automatically output the genotyping results. The genotyping results were based on SNP1672 and were classified as GG, CC, or GC genotypes.

[0072] The reaction system for KASP amplification is basically the same as step 2 (the only difference is that primer 1672F1 is used instead of primer 883F1, primer 1672F2 is used instead of primer 883F2, and primer 1672C is used instead of primer 883C).

[0073] The reaction procedure for KASP amplification is the same as in step 2.

[0074] The genotype test results are the same as those in Table 1.

[0075] Example 2: Functional Verification of SNP Sites

[0076] The tested wheat materials consisted of more than 200 wheat materials, all of which belong to the wheat microcore germplasm in my country.

[0077] The genotypes of the tested wheat based on SNP883 and SNP1672 were detected according to the method in step three of Example 1. The results are shown below. Figure 3 and Figure 4 .

[0078] The tested wheat was planted and cultivated in parallel, specifically in Luoyang, Henan Province in 2002 and 2005, and in Shunyi, Beijing Province in 2010. At maturity, the grain phenotypes of the tested wheat were statistically analyzed (at least three replicates were set for each sample, and the results were averaged), specifically thousand-grain weight (TKW), grain length (GL), grain width (GW), and grain thickness (GT).

[0079] The statistical results of the grain phenotypes of the tested wheat are shown in Table 2 (Luoyang, Henan, 2002). For wheat with the SNP883 genotype AA, the average thousand-grain weight was 39.7 g (85 wheat varieties were used for the statistics), the average grain length was 0.66 mm (96 wheat varieties were used for the statistics), the average grain width was 0.32 mm (96 wheat varieties were used for the statistics), and the average grain thickness was 0.28 mm (96 wheat varieties were used for the statistics). For wheat with the SNP883 genotype GG, the average thousand-grain weight was 34.9 g (102 wheat varieties were used for the statistics), the average grain length was 0.63 mm (142 wheat varieties were used for the statistics), the average grain width was 0.30 mm (142 wheat varieties were used for the statistics), and the average grain thickness was 0.26 mm (142 wheat varieties were used for the statistics). Based on wheat with SNP1672 genotype GG, the average thousand-grain weight was 39.7g (85 wheat varieties were analyzed), the average grain length was 0.66mm (96 wheat varieties were analyzed), the average grain width was 0.32mm (96 wheat varieties were analyzed), and the average grain thickness was 0.28mm (96 wheat varieties were analyzed). Based on wheat with SNP1672 genotype CC, the average thousand-grain weight was 34.9g (102 wheat varieties were analyzed), the average grain length was 0.63mm (142 wheat varieties were analyzed), the average grain width was 0.30mm (142 wheat varieties were analyzed), and the average grain thickness was 0.26mm (142 wheat varieties were analyzed). The results indicate that the two SNPs are closely linked in different varieties.

[0080] Table 2

[0081]

[0082] The statistical results of the grain phenotypes of the tested wheat are shown in Table 3 (Luoyang, Henan, 2005). For wheat with the SNP883 genotype AA, the average thousand-grain weight was 36.4 g (out of 93 wheat varieties used in the statistics), the average grain length was 0.66 mm (out of 92 wheat varieties used in the statistics), the average grain width was 0.31 mm (out of 92 wheat varieties used in the statistics), and the average grain thickness was 0.29 mm (out of 92 wheat varieties used in the statistics). For wheat with the SNP883 genotype GG, the average thousand-grain weight was 31.3 g (out of 130 wheat varieties used in the statistics), the average grain length was 0.63 mm (out of 133 wheat varieties used in the statistics), the average grain width was 0.30 mm (out of 133 wheat varieties used in the statistics), and the average grain thickness was 0.28 mm (out of 133 wheat varieties used in the statistics). Based on wheat with SNP1672 genotype GG, the average thousand-grain weight was 36.4 g (out of 93 wheat varieties used in the study), the average grain length was 0.66 mm (out of 92 wheat varieties used in the study), the average grain width was 0.31 mm (out of 92 wheat varieties used in the study), and the average grain thickness was 0.29 mm (out of 92 wheat varieties used in the study). Based on wheat with SNP1672 genotype CC, the average thousand-grain weight was 31.3 g (out of 130 wheat varieties used in the study), the average grain length was 0.63 mm (out of 133 wheat varieties used in the study), the average grain width was 0.30 mm (out of 133 wheat varieties used in the study), and the average grain thickness was 0.28 mm (out of 133 wheat varieties used in the study). The results indicate that the two SNPs are closely linked in different varieties.

[0083] Table 3

[0084]

[0085] The statistical results of the grain phenotypes of the tested wheat are shown in Table 4 (Shunyi District, Beijing, 2010). For wheat with the SNP883 genotype AA, the average thousand-grain weight was 37.9 g (out of 100 wheat varieties), the average grain length was 0.69 mm (out of 100 varieties), the average grain width was 0.31 mm (out of 100 varieties), and the average grain thickness was 0.30 mm (out of 100 varieties). For wheat with the SNP883 genotype GG, the average thousand-grain weight was 32.6 g (out of 138 varieties), the average grain length was 0.66 mm (out of 138 varieties), the average grain width was 0.30 mm (out of 138 varieties), and the average grain thickness was 0.29 mm (out of 138 varieties). Based on wheat with SNP1672 genotype GG, the average thousand-grain weight was 37.9 g (out of 100 wheat varieties), the average grain length was 0.69 mm (out of 100 varieties), the average grain width was 0.31 mm (out of 100 varieties), and the average grain thickness was 0.30 mm (out of 100 varieties). Based on wheat with SNP1672 genotype CC, the average thousand-grain weight was 32.6 g (out of 138 varieties), the average grain length was 0.66 mm (out of 138 varieties), the average grain width was 0.30 mm (out of 138 varieties), and the average grain thickness was 0.29 mm (out of 138 varieties). The results indicate that the two SNPs are closely linked across different varieties.

[0086] Table 4

[0087]

[0088] The results showed that, based on the SNP883 genotype, wheat with the AA genotype had higher thousand-grain weight, grain length, grain width, and grain thickness than wheat with the GG genotype. The differences in thousand-grain weight, grain length, grain width, and grain thickness were all statistically significant (see Table 5). Therefore, the A allele is the dominant allele compared to the G allele.

[0089] The results showed that, based on the SNP1672 genotype, wheat with the GG genotype had higher thousand-grain weight, grain length, grain width, and grain thickness than wheat with the CC genotype. The differences in thousand-grain weight, grain length, grain width, and grain thickness were all statistically significant (see Table 5). Therefore, the G allele is the dominant allele compared to the C allele.

[0090] Table 5 Association analysis of SNP allelic variation and grain-related traits

[0091]

[0092] Dominant genotypes: SNP883 is AA genotype, and SNP1672 is GG genotype.

[0093] Non-dominant genotypes: SNP883 is the GG genotype, and SNP1672 is the CC genotype.

[0094] Note: 2002LY represents Luoyang (2002); 2005LY represents Luoyang (2005); 2010SY represents Shunyi (2010). P <0.05, P <0.01.

[0095] In addition, analysis of the trends in the thousand-grain weight and the frequencies of the two allelic variations of varieties bred in different years revealed that ( Figure 5 Over time, the thousand-grain weight of wheat varieties bred in my country has shown an increasing trend. Consistent with this trend, the frequency of superior allelic variations in varieties from different eras has also increased. This indicates that modern breeding has exerted a strong selection effect on this allelic variation, which is significantly correlated with grain weight. Therefore, this marker can serve as a functional marker for improving wheat grain weight and for marker-assisted breeding of high-yield wheat.

[0096] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, KASP amplification was performed using specific primer group A to obtain genotyping results, which were AA genotype, GG genotype or AG genotype; The grain traits of AA genotype wheat are superior to those of GG genotype wheat; The grain characteristics are thousand-grain weight and / or grain length and / or grain width and / or grain thickness; The superior grain traits are manifested as high thousand-grain weight and / or long grain length and / or wide grain width and / or thick grain. The specific primer set A consists of primers 883F1, 883F2, and 883C; primer 883F1 is a single-stranded DNA molecule as shown in sequence 3 of the sequence listing; primer 883F2 is a single-stranded DNA molecule as shown in sequence 4 of the sequence listing; and primer 883C is a single-stranded DNA molecule as shown in sequence 5 of the sequence listing.

2. A method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, KASP amplification was performed using specific primer set B to obtain genotyping results, which were GG genotype, CC genotype or GC genotype; Grain traits of GG genotype wheat are superior to those of CC genotype wheat. The grain characteristics are thousand-grain weight and / or grain length and / or grain width and / or grain thickness; The superior grain traits are manifested as high thousand-grain weight and / or long grain length and / or wide grain width and / or thick grain. Specific primer set B consists of primers 1672F1, 1672F2, and 1672C; primer 1672F1 is a single-stranded DNA molecule as shown in sequence 7 of the sequence listing; primer 1672F2 is a single-stranded DNA molecule as shown in sequence 8 of the sequence listing; and primer 1672C is a single-stranded DNA molecule as shown in sequence 9 of the sequence listing.

3. A method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype based on the SNP883 site in the genomic DNA of the wheat to be tested is AA, GG, or AG; wheat with AA genotype has superior grain traits compared to wheat with GG genotype; the SNP883 site is the 41st nucleotide in sequence 6 of the sequence listing; the grain trait is thousand-grain weight and / or grain length and / or grain width and / or grain thickness; the superiority of the grain trait is manifested by high thousand-grain weight and / or long grain length and / or wide grain width and / or thick grain thickness.

4. A method for identifying or assisting in the identification of wheat grain traits, comprising the following steps: detecting whether the genotype of the wheat to be tested, based on the SNP1672 site, is GG, CC, or GC; the grain traits of GG genotype wheat are superior to those of CC genotype wheat; the SNP1672 site is the 39th nucleotide in sequence 10 of the sequence listing; the grain trait is thousand-grain weight and / or grain length and / or grain width and / or grain thickness; the superiority of the grain trait is manifested by high thousand-grain weight and / or long grain length and / or wide grain width and / or thick grain thickness.