Luding lily his internal reference gene, primer and application thereof

Abstract

The application provides a luding lily HIS internal reference gene and primers and application thereof, and belongs to the field of genetic engineering. The nucleotide sequence of the luding lily HIS internal reference gene is shown as SEQ ID No. 1. The application provides a 402 bp long luding lily HIS gene sequence, which can be used as an internal reference gene for luding lily fusarium wilt disease resistance gene expression profile analysis. According to research needs, corresponding gene expression analysis (including RT-PCR, qRT-PCR) internal reference primers are designed to analyze the expression of fusarium wilt disease resistance related genes in luding lily or other plants of the lily genus with close genetic relationship. The provided pair of qRT-PCR analysis internal reference primers can be directly used as internal reference primers for qRT-PCR analysis of the expression of luding lily fusarium wilt disease resistance related genes in luding lily tissue culture seedlings induced by lily fusarium at different times.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a HIS internal reference gene of Luding lily, its primers, and its applications. Background Technology

[0002] Lilies (Lilium spp.) are perennial bulbous flowering plants belonging to the genus Lilium in the family Liliaccae. They are beloved for their beautiful blooms and vibrant colors. Lilies rank third in global flower market value and first in my country, with the market demand for cut lilies increasing year by year. However, with the continuous expansion of lily cut flower cultivation, lily diseases have become increasingly serious. Lily Fusarium wilt, caused by the transformed form of Fusarium oxysporum f.sp.Lilii, is currently the most significant disease affecting cut lily and bulb production. Fusarium oxysporum is a soil-borne fungus, and chemical control is largely ineffective. Utilizing disease-resistant lily resources and cultivating disease-resistant lily varieties is the most economical and effective method for controlling Lily Fusarium wilt. Some wild lily resources unique to China, including the Luding lily, have shown good resistance to Lily Fusarium wilt.

[0003] Yunnan is one of the distribution centers of the genus *Lilium*, with abundant wild lily resources. *Lilium sargentiae* Wilson, a lily species endemic to my country, boasts beautiful, pure white, and fragrant flowers. It is highly adaptable and exhibits good resistance to *Fusarium wilt*. Although *Lilium sargentiae* is an important parent species in lily breeding and has been used for disease-resistant lily breeding, its resistance mechanism to *Fusarium wilt* remains unclear.

[0004] In recent years, with the development of plant molecular biotechnology, researchers have increasingly focused on the molecular-level disease resistance mechanisms of lilies. Researchers often utilize widely available detection techniques, such as transcriptome sequencing, to screen and discover disease-resistant genes from resistant lily resources, aiming to elucidate the molecular mechanisms of lily resistance to Fusarium wilt. Simultaneously, qRT-PCR is frequently used to validate the expression levels of disease-resistant genes screened from transcriptome sequencing results. However, the accuracy of qRT-PCR results is easily affected by factors such as RNA quality, reverse transcription efficiency, primer specificity, sample size, and PCR efficiency. To ensure the accuracy of qRT-PCR results, one or more stable internal reference genes must be introduced to correct and standardize the results. In plant research, relatively highly expressed and stable housekeeping genes are often used as internal reference genes. Ideally, internal reference genes should be expressed stably in all cells, physiological states, and sample types. However, recent studies have shown that there are no genes with absolutely stable expression. The so-called constant expression of any housekeeping gene is only constant under certain cell types or experimental conditions. Therefore, it is crucial to screen suitable internal reference genes based on different species, sample types, and experimental conditions.

[0005] When analyzing the expression profiles of genes related to resistance to Fusarium wilt in lilies, the selected internal reference genes vary due to differences in the lily species, tissue samples, and experimental conditions studied. This variation even exists among different lilies under the same experimental conditions. For example, when analyzing the expression of Fusarium wilt resistance-related genes in Minjiang lilies, the most commonly used internal reference gene is GAPDH, while in Fusarium-induced Lanzhou lilies, the 18S internal reference gene is used. Furthermore, there are few reports on the screening and identification of the most suitable internal reference genes for Fusarium wilt resistance gene expression analysis in Luding lilies. Therefore, it is necessary to screen and identify the most suitable internal reference genes for Fusarium wilt resistance-related gene expression analysis in Luding lilies. Summary of the Invention

[0006] To address the aforementioned issues, this invention provides a Luding lily HIS internal reference gene, its primers, and its applications. This invention provides a 402 bp Luding lily HIS gene sequence, which can be used as an internal reference gene for analyzing the expression profile of Fusarium wilt resistance-related genes in Luding lily. Appropriate gene expression analysis (including RT-PCR and qRT-PCR) internal reference primers can be designed according to research needs to analyze the expression of Fusarium wilt resistance-related genes in Luding lily or other closely related lily species. The provided pair of qRT-PCR analysis internal reference primers can be directly used as qRT-PCR internal reference primers to analyze the expression of Fusarium wilt resistance-related genes in Luding lily tissue culture seedlings induced by Fusarium wilt at different time points.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] This invention provides a Luding lily HIS internal reference gene, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0009] The present invention also provides a primer for amplifying the HIS internal reference gene of Luding lily described in the above technical solution. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3.

[0010] This invention also provides the application of the HIS internal reference gene of *Lilium ludingense* described in the above technical solution in the study of expression analysis of genes related to resistance to Fusarium wilt in *Lilium ludingense*.

[0011] Preferably, the disease resistance-related genes of *Fusarium wilt* of *Lilium lucida* include one or more of the following: peroxidase gene, phenylalanine ammonia-lyase gene, chitinase 1 gene, DIR protein gene, jasmonic acid-amide synthase JAR1 gene, and calcium-binding protein CML49 gene.

[0012] Preferably, qRT-PCR is used for analysis and research.

[0013] Preferably, the amplification system used for analysis and research using qRT-PCR is: 1 μL cDNA, 10 μmol·L⁻¹ upstream primer. -1 1 μL, downstream primer 10 μmol·L -1 1 μL, 2×Taq Master Mix 10 μL, ddH2O 7 μL, total 20 μL.

[0014] Preferably, the amplification program used for analysis and research by qRT-PCR is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 10 min, and storage at 4℃.

[0015] This invention utilizes software such as geNorm, Normfider, and Bestkeeper to analyze the expression stability of nine candidate internal reference genes, including HIS, in Luding lily samples induced by Fusarium oxysporum at six different time points, as well as six corresponding time points under sterile water treatment (as controls). Based on the analysis results of the three software programs, the geometric mean method was used to calculate the comprehensive ranking of the expression stability of the nine candidate internal reference genes. The most stable internal reference gene, HIS, was selected using this comprehensive ranking. Then, using HIS as the internal reference gene, qRT-PCR analysis was performed to verify the expression of six disease-resistant genes related to different disease resistance pathways in the transcriptome sequencing results of Fusarium oxysporum-induced Luding lily. The verification results showed that the analysis results of the expression profiles of the six disease-resistant genes using qRT-PCR internal reference primers designed based on the HIS gene nucleotide sequence were completely consistent with the expression of these six disease-resistant genes in the transcriptome sequencing results of Luding lily samples under Fusarium oxysporum and sterile water treatment for 24 hours. In summary, based on a comprehensive evaluation of the stability of the qRT-PCR results of the nine candidate internal reference genes, combined with the validation results of six disease resistance-related genes in *Lilium lucida*, it was demonstrated that the HIS gene showed the least expression difference and the most stable performance in *Lilium lucida* samples treated with *Fusarium oxysporum* and sterile water at different time points. A pair of qRT-PCR internal reference primers designed based on this HIS nucleotide sequence can be used as internal reference primers for analyzing the expression of disease resistance-related genes in *Lilium lucida*.

[0016] The beneficial effects of this invention are as follows:

[0017] (1) This invention discloses an internal reference gene for HIS in *Lilium sargentiae* Wilson and a pair of internal reference primers designed based on the nucleotide sequence of this gene for qRT-PCR analysis. This is the first reported internal reference gene and qRT-PCR primers from *Lilium sargentiae* Wilson that can be used for analyzing the expression profile of genes related to resistance to Fusarium wilt. These internal reference primers can be directly used as internal reference primers for qRT-PCR analysis of the expression of genes related to resistance to Fusarium wilt in *Lilium sargentiae* Wilson. Internal reference primers for semi-quantitative RT-PCR analysis of the expression of these resistance-related genes can also be designed based on the nucleotide sequence of the HIS gene.

[0018] (2) An ideal internal reference gene should be consistently expressed under various tissue, cell, and environmental conditions. However, numerous studies have shown that no gene expresses absolutely stably; the so-called constant expression of any internal reference gene is only "range-dependent" within a certain type of cell or environment. Therefore, the internal reference genes and primers used in previous literature to analyze the expression profiles of Fusarium wilt resistance-related genes in other plants or other lilies may not be suitable as internal reference genes and primers for analyzing the expression of Fusarium wilt resistance-related genes in *Lilium lucida* or other lily species (different from the other lilies already reported in the literature). Moreover, there are few publicly reported studies on the screening and identification of the most suitable internal reference genes for analyzing the expression of Fusarium wilt resistance-related genes in *Lilium lucida* and other lilies of the same genus. This application provides a nucleotide sequence of the HIS internal reference gene from *Lilium lucida* and a pair of primers for qRT-PCR analysis, which can be used as an internal reference gene and qRT-PCR primers for analyzing the expression of Fusarium wilt resistance-related genes in *Lilium lucida*. In addition, since the conservation of the same type of internal reference genes in closely related species of the same genus is relatively high, the HIS gene can also be used as the most suitable internal reference gene for expressing and analyzing Fusarium wilt resistance-related genes in other lily species that are closely related to Luding lily, as well as as an internal reference primer for qRT-PCR analysis.

[0019] (3) The primers used for qRT-PCR analysis amplify relatively short fragments, generally from tens of bp to 200 bp, while the amplification fragments required for semi-quantitative RT-PCR analysis are longer. Therefore, primers used for qRT-PCR analysis are not necessarily suitable for RT-PCR analysis. This invention not only provides a pair of internal reference gene primers that can be directly used for qRT-PCR analysis of the expression profile of genes related to resistance to Fusarium wilt in Luding lily, but also provides a conserved nucleotide sequence of the gene of 402 bp. Researchers can design internal reference primers for semi-quantitative RT-PCR analysis based on the nucleotide sequence of this gene according to their own research needs. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0021] Figure 1 The qRT-PCR amplification curves of nine candidate internal reference genes, including HIS;

[0022] Figure 2 The melting curves of qRT-PCR for 9 candidate internal reference genes, including HIS;

[0023] Figure 3This is a distribution plot of Ct values ​​for nine candidate internal reference genes, including HIS. The boxes represent the range of Ct values, the horizontal line in the center of the box represents the median, the top and bottom edges of the box represent the upper and lower quartiles, respectively, and the top and bottom ends of the box represent the maximum and minimum values, respectively.

[0024] Figure 4 The results of qRT-PCR analysis of the expression of six disease resistance-related genes in *Lilium ludingense* using HIS as an internal reference gene are shown. F represents *Lilium ludingense* tissue culture seedlings treated with *Fusarium lilyum*, and W represents control *Lilium ludingense* tissue culture seedlings treated with sterile water. 0h, 6h, 12h, 24h, 48h, and 72h represent *Lilium ludingense* tissue culture seedling samples after *Fusarium lilyum* treatment and sterile water treatment, respectively, at 0, 6, 12, 24, 48, and 72 hours. *, **, and *** represent p<0.05, p<0.01, and p<0.001, respectively. Detailed Implementation

[0025] This invention provides a HIS internal reference gene for Luding lily, the nucleotide sequence of which is shown in SEQ ID No. 1, and is as follows:

[0026] Atggccgggaagggcggcaagggactgatcgccggcaagaccacctctgccgccaaggacaaggacaagaagcgccccacctcccgctcctctcgcgctg gcctccagtttccggtggggaggattcacaggcagttgaagtcgcggatcgcggcgaacggccgcgtgggtgcgacggcggcggtgtactcggcggcgatt ctggagtacctgacggctgaggtgctggagctggcggggaatgcgagcaaggatctgaaggtgaagcgcataacgcccaggcatctgcagctggcgatccg tggggatgaggagctggatacgctgatcaaggggactattgctgggggtggtgtgattccgcacatccataagtctctgatcaacaaatctgcgaaggag.

[0027] This invention also provides primers for amplifying the HIS internal reference gene of *Lilium ludingense* described in the above technical solution. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3, as detailed below:

[0028] SEQ ID No.2: 5'-gattcacaggcagttgaagt-3';

[0029] SEQ ID No. 3: 5'-ttcagatccttgctcgcat-3'.

[0030] This invention also provides the application of the HIS internal reference gene of *Lilium ludingense* described in the above technical solution in the study of expression analysis of genes related to resistance to Fusarium wilt in *Lilium ludingense*.

[0031] In this invention, the disease resistance-related genes of *Fusarium wilt* of *Lilium lucida* preferably include one or more of the following: peroxidase gene, phenylalanine ammonia-lyase gene, chitinase 1 gene, DIR protein gene, jasmonic acid-amide synthase JAR1 gene, and calcium-binding protein CML49 gene.

[0032] In this invention, the nucleotide sequence of the peroxidase gene is shown in SEQ ID No. 4, and is as follows:

[0033] tgcccgagcctcttgagtacaattaaaccagtagttcagtctgcgatcaacaccgaggcgcgaatgggtgcctccctcctccgcctcttcttccacgactgctttgtcaatggctgtg acgggtcgttgttattagacgacaccgccaacttcaccggggagaagacggcaacgcccaacaacaactccgtcagaggcttcaacgtcgtcgacaacataaaaaccgtagtcgaaaa ggcctgcccgggtattgtctcgtgtgcggacatacttgccatcaccgcaatgcaatctgtaaacatacttggaggcccaagttggagtgtgaagttgggaagaagggatgcaagaaca gcgagcctttcgggggctaatagtaacatcccaccaccaacctcaagtctcagcaatatcatctccaagttttcagcacaggggctgtccacaaaggacatggttgctctagctggt.

[0034] In this invention, the nucleotide sequence of the phenylalanine ammonia-lyase gene is shown in SEQ ID No. 5, and is as follows:

[0035]

[0036] In this invention, the nucleotide sequence of the chitinase 1 gene is shown in SEQ ID No. 6, and is as follows:

[0037] Atctgtgtctccgtcttgcttatctctgtctccgtcatcttgttctatggttcggcacagcattgcggcagccagctaggagatgcagtatgccccggtggactgtgctgcagcgagttcggctactgcggatctacgaccacgtattgcggtgatggttgccagagccagtgtagcggtgatggaagcggaggaggagttgggggtggaggtggtgtgagctcgattatcagctcatcccttttcaaccagatgctgctccaccgcaacgatgctgtctgccctgccaggggtttctatacctatgatgccttcattgctgccgccaattcctttagcggcttcgggacaaccggggatgccgatactcagaagagggagatagctgctttcttggctcagacttcccatgagacgactggtgggtggtcgactgcaccagacgggcaattcgcttggggctactgctttaaacaggagcaaggcaacccgccgccagactactgtgttgagagctcacagtggccctgtgctgcagacaggaagtactacggccgaggccccatccaaatctcctacaactacaactacggcccagccggacgggacatcaactcggaccttctcaacaacccagatcttgtcatcaccgacccgacaatctctttcaagacagcattgtggttctggatgaccgcgcagtggactaagccgtcgtgccacgcggttgcgactggagaatggactccatcggcggctgaccaatcggccgggcgggttccggggtatggtgtgataacgaacatcatcaatgggggtattgagtgcgggcatggagccgacaataagatggcggataggatcgggtattacaagagatactgtgatatgctgggagtcagctatggagctaacctggactgctacaatcagcagcatttc。

[0038] In this invention, the nucleotide sequence of the DIR protein gene is shown in SEQ ID No. 7, and is as follows:

[0039] Ttgcagggcacagtcagcgggcctaacgccaccctcaccacggtggccaagacctcccccaatgcgaccctctttaccttcggaagcgtctccgtcctcgacg accttctgacagcggggccagagcggagctcaaaagaggtcgggaggtgccaggggctggtagctcaggctcaactgtcaggcccaccagcatcagtagcagc agagaatttcatcttctcaacagggaagtacaacgggagcagcctcgccatggtagggagggtggaccctgtgaccggcacgtttgagctggcggtggttggt gggagcggcctattcaggctagcgaggggctacgcactcgctaaattcctcagcataaataccacccactggtacatctctcgtcgagtacgatgtctatgtg.

[0040] In this invention, the nucleotide sequence of the jasmonic acid-amide synthase JAR1 gene is shown in SEQ ID No. 8, and is as follows:

[0041]

[0042] In this invention, the nucleotide sequence of the calcium-binding protein CML49 gene is shown in SEQ ID No. 9, and is as follows:

[0043] .

[0044] This invention preferably employs qRT-PCR for analysis and research. In this invention, the preferred amplification system used for qRT-PCR analysis and research is: 1 μL cDNA and 10 μmol·L⁻¹ upstream primer. -1 1 μL, downstream primer 10 μmol·L -1 1 μL, 10 μL of 2×TaqMaster Mix, 7 μL of ddH2O, total 20 μL. In this invention, the preferred amplification program used for qRT-PCR analysis is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 10 min, storage at 4℃.

[0045] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] Unless otherwise stated, in this invention, the percent sign represents a percentage of mass.

[0048] *Lilium ludingense* (publicly known materials, Duan Qing, Cui Guangfen, Jia Wenjie, Ma Lulin, Wang Jihua, Du Wenwen, Wang Xiangning. Chromosome karyotype analysis of eight wild populations of *Lilium ludingense* in Yunnan Province. *Northwest Botanical Journal*, 2016, 36(3): 0472-0478) was collected near the Jinsha River in Weixi County, Diqing Prefecture, Yunnan Province. *Lilium ludingense* with the same genetic background were propagated and preserved using tissue culture technology. When the tissue culture seedlings reached approximately 6-8 cm in height in the culture room, seedlings of similar size and growth were selected, and their rhizomes were cut to induce *Fusarium solani*. After *Fusarium solani* induction, 10 seedlings of the same induction time were selected and mixed as samples for the same treatment period, while samples treated with sterile water at the corresponding time period served as controls. Three biological replicates were set up for each sample. Transcriptome sequencing analysis was performed on a portion of *Lilium ludingense* tissue culture seedlings induced by *Fusarium solani* and treated with sterile water for 24 hours. The total sample was used to screen for the stability of the optimal internal reference gene and to verify the expression of disease resistance-related genes.

[0049] Based on the names of commonly used internal reference genes in plants, the gene IDs and corresponding nucleotide sequences of these genes were searched in the transcriptome sequencing results. Then, based on the gene IDs of the internal reference genes, the FPKM values ​​of these genes in six Luding lily samples were searched at 24 h after Fusarium induction and 24 h after sterile water treatment. Internal reference genes with FPKM values ​​greater than 50 and essentially consistent across the six samples were selected as candidate internal reference genes. Nine commonly used candidate internal reference genes were screened (Table 1), among which the nucleotide sequence of the HIS internal reference gene is: atggccgggaagggcggcaagg gactgatcgccggcaagaccacctctgccgccaaggacaaggacaagaagcgccccacctcccgctcctctcgcgctggcctccagtttccggtgg ggaggattcacaggcagttgaagtcgcggatcgcggcgaacggccgcgtgggtgcgacggcggcggtgtactcggcggcgattctggagtacctga cggctgaggtgctggagctggcggggaatgcgagcaaggatctgaaggtgaagcgcataacgcccaggcatctgcagctggcgatccgtggggatgaggagctggatacgctgatcaaggggactattgctgggggtggtgtgattccgcacatccataagtctctgatcaacaaatctgcgaaggag. (SEQ ID No. 1) (underlined is the position of the internal reference primer for qRT-PCR analysis).

[0050] The other eight candidate internal control genes are: aquaporin (AQP), tubulin (TUB), glycerol phosphate dehydrogenase (GAPDH), cyclophilin (CYP), elongation factor 1-α (EF-1α), 60S ribosomal protein L13-1 (RPL13), polyubiquitin (UBQ), and phosphoglycerate kinase (PGK). Their nucleotide sequences are as follows:

[0051] Aquaporin gene (SEQ ID No. 10):

[0052] Gacaagctcaccggcaacggtcccgccacccccgctggcctcgtcgcggcctccctcgggcacgcctacgcactcttcgtcgctgtctctgtcggagccaacatctccggcggccacgttaaccccgccgtcaccttcggtgccttccttggcggcaacatcaccctcatccgcggcatcctctactggatcgcccagctcctcggctccaccgtcgcctgcttactccttcgctacaccaccggcctccccaccggtaccttcgcccttgttgagggagtcagcgtctggaacggcctggtacttgaaatcgtcatgactttcgggttggtctacaccgtctacgccaccgctattgacccgaagaagggtagtattggtaccattgccccaatcgccattggtttcatcgtcggcgctaacattcttatcggtggggcgttcagcggtgcctcgatgaacccggccatcgcttttggcccggccttggttagctggagctgggcgagccactgggtgtactgggctggtccgctcatcggcggtggccttgctgggatagtctatgagatcttcttcattgatcatcattcgcacgagccgctccccgccaacgactac。

[0053] Tubulin gene (SEQ ID No. 11):

[0054]

[0055] Glyceraldehyde dehydrogenase gene (SEQ ID No. 12):

[0056] Tatgatcagatcaaggctgctatcaaagaagagtctgaggggaaactgaaaggaatccttggctatattgatgaggatttggtgtccactgattttgtgggtgacagcaggtcaagcatttttgatgccaaggctgggattgctttgaatgacaactttgtgaagctggtggcatggtatgacaatgaatggggctacagcactcgtgtggttgatctcctccgccacatggctgcaaccaag

[0057] Cyclophilin gene (SEQ ID No. 13):

[0058] Atggcgagcaacccccgagtcttcttcgaaatgtctgtcggtggtgcttcggctggccggatcgtgatggagctcttcgccgacgtagtcccccgaacggcggagaacttccgcgccctatgtaccggcgagaaggggaagggccgctccggtaagcccctccacttcaagggatcgagcttccaccgcgtgatccctgactttatgtgccagggcggtgactttactcgcggtaacggcaccggtggcgagtctatctatggcgagaagttcgcggatgagaatttcgtccgcaagcacactgggcctggggttttgtccatggctaatgctgggcctaataccaatgggtctcagtttttcatctgcactgctaagacggcttggctggatggtaagcatgttgtgtttgggcaggttgtggaggggttggatgtggtgaaggcgattgagaaggtggggtcgcagagcggcacgaccaagaagccggttgtgattgttgattgcggccagctt

[0059] Elongation factor gene (SEQ ID No. 14):

[0060]

[0061] 60S ribosomal protein gene (SEQ ID No. 15):

[0062] Ctctcaataaattcgccgccggctcgctctagggtttccaagcggcgacggatctagcacgaacccgccggaatcatgccgaagcagatccgtgagatcaaggatttccttctcacagctcggaggaaagacgcccgctctataaagatcaagaggagcaaggatgtcgtcaagttcaaggtccggtgctccaggtacctctacacgctctgcgtgaatgatccggagaaggcggataagttgaagcagtcacttccgccaggtttaagtgttcaagaggtt。

[0063] Polyubiquitin gene (SEQ ID No. 16):

[0064] Gagagctcggacaccattgataatgttaaggccaagattcaggacaaggagggcatccctccggaccagcagagactcatctttgctggaaagcagctagaggacggccgcacactggctgactacaacattcagaaggagtccactctccatctggtactccgcctcaggggaggtatgcagatttttgtcaagacccttacagggaaaacgatcaccctggaggttgagagctctgataccattgacaacgtcaaagcgaagattcaggacaaagagggtatccccccagaccagcagcgcctgatctttgcagggaagcaactcgaagatggccgcacccttgcggactataacattcagaaggagtccactctccatctggtactccgcctcaggggtggcatgcagatctttgtcaagacgctcaccggaaagaccattactctagaggtggagagctctgatacaatcgacaatgtgaaggcgaagatccaggacaaggagggaattcctccggaccagcagaggctcatctttgctgggaagcagctggaggacggtcgcacacttgctgattacaacattcagaaggagtcgacgctgcaccttgtcctccgtctccgtggtggccagtaatttctctattctgatccttgttggttatttctctgatctgatgcttggttttgg。

[0065] Phosphoglycerate kinase (SEQ ID No. 17):

[0066]

[0067] Meanwhile, based on the KEGG clustering results of transcriptome sequencing, six genes that may be involved in plant disease resistance pathways were selected from the differentially expressed genes (Table 1).

[0068] The nucleotide sequences of six disease resistance-related genes—peroxidase (POD), phenylalanine ammonialyase (PAL), chitinase 1 (CHI 1), dirigent-like protein (DIR), jasmonic acid-amidosynthetase JAR1 (JAR1), and calcium-binding protein CML49 (CML49)—are shown in SEQ ID No. 4–9.

[0069] Based on the nucleotide sequences of the above candidate internal reference genes and disease resistance-related genes, primers were designed using Roche LCPDS2 software (Table 2). qRT-PCR amplification was performed on a total of 36 samples from six time periods (three biological replicates each) of *Lilium lucida* tissue culture seedlings treated with *Fusarium* and sterile water. The amplification was performed according to mirVana... TM Total RNA was extracted from each sample using the RNA Isolation Kit (Invitrogen, USA). A portion of the total RNA was analyzed for concentration and OD260 / OD280 values ​​using a NanoDrop 2000 spectrophotometer, and RNA integrity was assessed by 1% agarose gel electrophoresis. 0.5 μg of total RNA was used to synthesize cDNA according to the TransScript All-in-one SuperMix (Tiangen, Beijing) instructions. The synthesized cDNA was diluted 10-fold and stored at -20°C for later use.

[0070] use Type II Real-Time PCR Instrument (Roche, Switzerland), referencing PerfectStart TMqRT-PCR reactions were performed using the Green qPCR Super Mix (Tiangen, Beijing) according to the manufacturer's instructions. The qRT-PCR reaction system consisted of: 1 μL cDNA, 10 μmol·L⁻¹ to 11 μL upstream primer, 10 μmol·L⁻¹ to 11 μL downstream primer, 10 μL 2×Taq MasterMix, and 7 μL ddH₂O, for a total of 20 μL. The reaction program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing + extension for 30 s, 30 cycles, with 3 technical replicates per reaction. Product specificity was assessed using melting curve analysis: fluorescence signals were collected 5 times per 1℃ increase from 60℃ to 97℃. The average value of the raw Ct values ​​was calculated using Microsoft Excel 2016. The stability of the internal reference gene in different samples was analyzed using Normfider, geNorm, and Bestkeeper software. When analyzing data with NormFinder and geNorm, the raw Ct values ​​of each sample are first converted into relative expression levels (Q values) before being imported into the software. The M value, reflecting the stability of candidate genes, is then calculated. BestKeeper, on the other hand, directly analyzes the SD and CV values ​​between raw Ct values ​​to screen for the optimal internal reference gene. Smaller SD and CV values ​​indicate more stable gene expression, while SD > 1 indicates gene instability. Finally, the gene stability values ​​obtained from NormFinder, geNorm, and BestKeeper are calculated using the geometric mean method. The expression stability of all candidate genes is then comprehensively ranked, and the most stable internal reference gene is selected based on this comprehensive stability ranking.

[0071] Using HIS, the candidate gene with the most stable performance selected through comprehensive ranking, as the internal reference gene, the expression levels of six disease resistance-related genes in *Lilium ludingense* were analyzed by qRT-PCR. The qRT-PCR reaction system and procedure are as described above. qRT-PCR results were analyzed using 2... (-ΔΔCt) Data were calculated using the mean ± standard deviation method. Statistical analysis was performed using the mean ± standard deviation. Independent samples t-tests were used to compare two groups. A p-value < 0.05 was considered statistically significant, and a p-value < 0.01 was considered highly significant. Microsoft Excel 2016 and R3.2.3 software were used to process the data and create graphs.

[0072] Table 1. FPKM values ​​of 9 candidate internal reference genes and 6 disease resistance-related genes screened from Fusarium-induced transcriptome sequencing results of *Lilium ludingensis*.

[0073]

[0074] Table 2 Primers for qRT-PCR analysis of the expression of 9 candidate internal reference genes and 6 disease resistance-related genes in Luding lily.

[0075]

[0076]

[0077] Table 3. Ct value analysis of 9 candidate internal reference genes

[0078] 1 AQP 26.424 0.507 1.919％ 2 PGK2 27.813 0.569 2.045％ 3 HIS 26.641 0.729 2.737％ 4 CYP 24.449 0.723 2.958％ 5 RPL13 26.490 0.788 2.973％ 6 UBQ 23.659 0.704 2.977％ 7 EF-1α 21.526 0.646 3.003％ 8 TUB 26.769 0.859 3.210％ 9 GAPDH 32.612 1.242 3.809％

[0079] Table 4. Stability analysis results of geNorm, NormFinder, and BestKeeper on 9 candidate internal reference genes.

[0080]

[0081]

[0082] Table 5. Overall Stability Ranking Analysis of the 9 Candidate Internal References

[0083] 1 HIS 1.587 2 CYP 2.080 3 PGK 2.884 3 UBQ 4.121 5 AQP 4.309 6 EF-1α 5.192 7 TUB 6.000 8 RPL13 7.652 9 GAPDH 9.000

[0084] Table 1 shows that, based on the transcriptome sequencing results, the FPKM values ​​of the nine candidate internal reference genes, including HIS, exceeded 50 and were largely consistent across six samples (three replicates each) from two different treatments: Fusarium oxysporum-induced Luding lily for 24 hours (L_24_T_f) and Luding lily treated with sterile water for 24 hours (L_24_T_w). Compared to the sterile water-treated samples, all six disease resistance-related genes were upregulated in the Fusarium oxysporum-induced Luding lily 24 hours samples, with only slight differences in the fold increase.

[0085] from Figure 1 It can be seen that the amplification effects of the nine candidate internal reference genes were all good, and the repeatability of the amplification curves was good, indicating that the experimental results were accurate and reliable.

[0086] from Figure 2 It can be seen that, except for GAPDH which showed a few impurities in some samples, the melting curves of the other eight candidate internal reference genes all showed obvious single peaks, and no primer dimers were found. This indicates that the primers for the eight internal reference genes other than GAPDH have good specificity and high specificity, resulting in accurate and reliable results that meet the qRT-PCR standard. However, the primer specificity for GAPDH was relatively poor in some samples.

[0087] From Table 3 and Figure 3It can be seen that the Ct values ​​of the nine candidate internal reference genes range from 20.21 to 34.82. GAPDH has the highest average Ct(MD) at 32.612, and its expression level is also the lowest. GAPDH also has the highest coefficient of variation at 3.809%, and therefore its stability is the worst.

[0088] Table 4 shows that the analysis results from geNorm and Normfider software indicate that the HIS gene has the best stability among the nine candidate internal reference genes, while GAPDH has the worst stability. The analysis results from Bestkeeper software show that CYP has the best stability, while GAPDH also has the worst stability.

[0089] As shown in Table 5, the comprehensive evaluation results of the stability of the nine candidate internal reference genes analyzed by three software programs (geNorm, Normfider, and Bestkeep) using Excel showed that HIS had the best stability among the nine candidate internal reference genes. Therefore, HIS is also the most suitable internal reference gene for the expression analysis of Fusarium wilt resistance-related genes in Luding lilies at different time points induced by Fusarium.

[0090] from Figure 4 It can be seen that, using sterile water treatment at 0h as a control, the average expression levels of the six disease resistance-related genes in the Fusarium-treated samples were higher than those in the sterile water-treated samples (in the six time-period samples, the expression levels of four or more Fusarium-induced time-period samples were higher than those of the control samples). This was particularly evident at 24h, where the expression levels of the six disease resistance-related genes at 24h after Fusarium induction were higher than those at 24h after sterile water treatment, a result consistent with transcriptome sequencing results. The qRT-PCR validation analysis of the expression profiles of the six disease resistance-related genes further confirms that HIS expression is stable in samples from different time points under both Fusarium and sterile water treatment, and can be used as an internal reference gene for qRT-PCR expression analysis of disease resistance-related genes in *Lilium ludingense* at different time points after Fusarium induction.

[0091] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of the HIS internal reference gene of Lilium ludingense as an internal reference gene in analyzing the expression profile of genes related to resistance to Fusarium wilt in Lilium ludingense; The nucleotide sequence of the HIS internal reference gene of Luding lily is shown in SEQ ID No. 1; Primers for amplifying the HIS internal reference gene of the Luding lily, the nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

3.

2. The application according to claim 1, characterized in that, The disease resistance-related genes of *Fusarium wilt* in *Lilium lucida* include one or more of the following: peroxidase gene, phenylalanine ammonia-lyase gene, chitinase 1 gene, DIR protein gene, jasmonic acid-amide synthase JAR1 gene, and calcium-binding protein CML49 gene.

3. The application according to claim 1, characterized in that, The qRT-PCR method was used for analysis and research.

4. The application according to claim 3, characterized in that, The amplification system used in the qRT-PCR analysis was: 1 μL cDNA and 10 μmol·L⁻¹ upstream primer. -1 1 μL, downstream primer 10 μmol·L -1 1 μL, 2×Taq MasterMix 10 μL, ddH2O 7 μL, total 20 μL.

5. The application according to claim 3, characterized in that, The amplification program used in the qRT-PCR analysis was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 10 min, and storage at 4℃.

Images