A method for constructing a rapid multi-time biotin modified nucleic acid transcription ligation sequencing library and application thereof
By simplifying the steps of multi-time biotin-modified nucleic acid transcriptional ligation sequencing, using streptavidin magnetic beads C1 and a new buffer system, and optimizing the enzyme reaction on the magnetic beads, the problems of long library preparation time and low success rate were solved, and a rapid and efficient experimental procedure was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF BIOLOGICAL & MEDICAL ENG GUANGDONG ACAD OF SCI
- Filing Date
- 2022-12-22
- Publication Date
- 2026-07-31
AI Technical Summary
Existing multi-time biotinylated nucleic acid transcriptional ligation sequencing technology is cumbersome, has long library preparation time, low experimental success rate, and requires a lot of materials, making it difficult to be widely used.
The experimental procedures were simplified by using streptavidin magnetic beads C1 and a new buffer system, optimizing the enzyme reaction on the magnetic beads, reducing the number of magnetic bead enrichment cycles, and adopting a new buffer elution system to shorten the experimental process.
The time required to build the database has been reduced from 26 hours to 14 hours, improving the success rate of experiments, reducing material requirements, and expanding application scenarios.
Smart Images

Figure HDA0004012463120000011 
Figure HDA0004012463120000021
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing a rapid multi-time biotin-modified nucleic acid transcriptional ligation sequencing library and its application. Background Technology
[0002] Multi-temporal biotinylated nucleic acid transcriptional ligation sequencing (TV-PRO-seq) (Zhang et al., 2021) is an improved method based on biotinylated nucleic acid transcriptional ligation sequencing (PRO-seq) (Mahat et al., 2016). This method improves the transcriptional ligation procedure of biotinylated nucleic acid transcriptional ligation sequencing by employing multiple transcriptional ligation times. Therefore, TV-PRO-seq can detect the pause time of RNA polymerase II at each single-base transcriptional pause site at the whole genome level.
[0003] Multitemporal biotinylated nucleic acid transcriptional ligation sequencing (MTRS) is currently the only method capable of detecting RNA polymerization and transcriptional cessation at single-base resolution at the transcriptome level. This method has the potential to be applied to near-promoter cessation of RNA polymerase II, cessation of RNA polymerase II in the genome, and kinetic studies of RNA polymerase I and RNA polymerase III, thus providing a theoretical basis for drug development. However, library construction for MTRS requires up to 26 hours and more than three working days to complete, and the process is cumbersome, involving three biotinylated magnetic bead enrichment steps and three Trizol RNA extraction / purification steps. The long library construction time, large amounts of starting biological materials, and low experimental success rate all contribute to the limited scope and difficulty of its application in related fields.
[0004] Mahat,DB,Kwak,H.,Booth,GT,Jonkers,IH,Danko,CG,Patel,RK,Waters,CT,Munson,K.,Core,LJ,Lis,JT,2016.Base-pair-resolution genome-wide mapping of active RNA polymerases usin g precision nuclear run-on(PRO-seq).Nat Protoc 11, 1455–1476. https: / / doi.org / 10.1038 / nprot.2016.086.
[0005] Zhang, J., Cavallaro, M., Hebenstreit, D., 2021. Timing RNA polymerasepausing with TV-PRO-seq. Cell Reports Methods 1, 100083. https: / / doi.org / 10.1016 / j.crmeth.2021.100083. Summary of the Invention
[0006] The purpose of this invention is to simplify the steps of multi-time biotin-modified nucleic acid transcriptional ligation sequencing technology, thereby shortening library preparation time, reducing the required materials, and improving experimental efficiency.
[0007] The technical solution adopted in this invention is:
[0008] A first aspect of the present invention provides a method for constructing a sequencing library, comprising the following steps:
[0009] S1: Add labeled nucleotides to the sample to be tested;
[0010] S2: RNA is extracted from the sample and fragmented to obtain RNA fragments;
[0011] S3: Add a 3' end connector;
[0012] S4: Add magnetic beads to purify the connector bonding product;
[0013] S5: Adding a 5' end connector yields the connection product;
[0014] S6: Elute the magnetic beads to obtain the purified ligation product;
[0015] S7: Perform PCR amplification on the purified ligation product to obtain the sequencing library.
[0016] In some embodiments of the present invention, the sample to be tested is permeabilized before step S1.
[0017] In some embodiments of the present invention, the labeling described in step S1 is a biotinylated label. The present invention adds biotin-labeled nucleotides to a transcriptional system (such as surface-permeable cells or an in vitro transcription system) to the newly generated RNA, which is also called a transcriptional ligation.
[0018] In some embodiments of the present invention, the biotin-labeled nucleotides include: biotin-labeled adenine nucleoside triphosphate, biotin-labeled guanine nucleoside triphosphate, biotin-labeled cytosine nucleoside triphosphate, and biotin-labeled uracil nucleoside triphosphate.
[0019] In some embodiments of the present invention, step S1 is specifically performed by adding the surface-permeable sample to a ligation reaction solution containing biotin-labeled nucleotides, specifically by using a geometric series of 0.2 to 60 minutes to perform four ligation reactions of different time lengths.
[0020] In some embodiments of the present invention, step S3 includes: adding a 3' end adapter to the RNA fragment and incubating at 20-28°C for 1-4 hours.
[0021] In some embodiments of the present invention, after adding the 3' end connector in step S3, heat treatment is performed, specifically at 60-75°C for 30-60 seconds; after heat treatment, the mixture is cooled to room temperature for incubation.
[0022] In some embodiments of the present invention, the sequence of the 3' end connector is GAUCGUCGGACUGUAGAACUCUGAAC (SEQ ID NO.1).
[0023] In some embodiments of the present invention, the magnetic beads include C1 magnetic beads or T1 magnetic beads.
[0024] In some preferred embodiments of the present invention, the magnetic bead is a C1 magnetic bead.
[0025] In some embodiments of the present invention, the reaction conditions for step S4 are: room temperature reaction for 0.5-1 h.
[0026] In some embodiments of the present invention, steps S4 to S6 include cleaning the magnetic beads using a magnetic bead cleaning solution, wherein the magnetic bead cleaning solution includes 4sU DRB-seq buffer or TimeLapse-seq buffer.
[0027] In some embodiments of the present invention, the 4sU DRB-seq buffer comprises 0.5–1.5 M sodium chloride, 2–3 mM Tris-HCl buffer, and 0.02–0.03% Tween.
[0028] In some embodiments of the present invention, the 4sU DRB-seq buffer comprises 1M sodium chloride, 2.5mM Tris-HCl buffer, and 0.025% Tween.
[0029] In some embodiments of the present invention, the TimeLapse-seq buffer comprises 0.5–1.5 M sodium chloride, 80–120 mM Tris-HCl buffer, 0.03–0.07% Tween, and 8–12 mM ethylenediaminetetraethyl disodium.
[0030] In some embodiments of the present invention, the TimeLapse-seq buffer comprises 1M sodium chloride, 100mM Tris-HCl buffer, 0.05% Tween, and 10mM ethylenediaminetetraethyl disodium.
[0031] In some embodiments of the present invention, the pH of the buffer solution is 7.0 to 7.8.
[0032] In some embodiments of the invention, the Tween includes Tween-20.
[0033] In some embodiments of the present invention, prior to step S5, 5' end enzyme treatment is performed using RNA 5′ pyrophosphate hydrolase and polynucleotide kinase.
[0034] In some embodiments of the present invention, step S5 includes: adding a 5' end adapter, RNA ligase I and its buffer, and incubating at room temperature for 1-4 hours.
[0035] In some embodiments of the present invention, the sequence of the 5' end connector is CCUUGGCACCCGAGA AUUCCA (SEQ ID NO.2).
[0036] In some embodiments of the present invention, step S6 specifically involves using Trizol to elute RNA from the magnetic beads.
[0037] In some embodiments of the present invention, step S7 includes reverse transcription and PCR amplification.
[0038] In some embodiments of the present invention, the reverse transcription primers include: AATGATACGGCGACCACCGAGATCTACACGT TCAGAGTTCTACAGTCCGA (SEQ ID NO.3).
[0039] In some embodiments of the present invention, the primers for the PCR amplification include: CAAGCAGAAGACGG CATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA (SEQ ID NO. 4).
[0040] In some embodiments of the present invention, the PCR amplification products can be further subjected to electrophoretic detection after PCR amplification, and DNA fragments can be recovered.
[0041] A second aspect of the present invention provides a sequencing library prepared according to the method described in the first aspect of the present invention.
[0042] A third aspect of the present invention provides a sequencing method, the method comprising sequencing a sequencing library prepared by the method described in the first aspect of the present invention.
[0043] A fourth aspect of the present invention provides the application of the construction method described in the first aspect of the present invention, the sequencing library described in the second aspect of the present invention, or the sequencing method described in the third aspect of the present invention, preferably in the application of RNA polymerase II near promoter pausing, RNA polymerase II pausing in the genome, kinetic studies of RNA polymerase I and RNA polymerase III, biological genetic analysis, systems biology research, synthetic biology research, and drug preparation.
[0044] The beneficial effects of this invention are:
[0045] This invention simplifies the TV-PRO-seq experimental procedure by optimizing the enzyme reaction system on magnetic beads, reducing three magnetic bead enrichments to a single step. Furthermore, it replaces the original method's streptavidin magnetic beads M280 with streptavidin magnetic beads C1 (Thermo Fisher Scientific, 65001) and uses a new buffer elution system; this increases the enrichment rate of labeled molecules while shortening the experimental process. These changes significantly reduce the library preparation time for multi-time biotinylated nucleic acid transcription-linked sequencing from 26 hours to 14 hours. Figure 1 The overall reduction in experimental time also reduced the possibility of nascent RNA degradation, improved the success rate of the experiment (from 32 out of 54 samples to 8 out of 8 samples, a significant increase in success rate, P<0.05), reduced the amount of starting cells required for the experiment (from ten million to one million), and also greatly reduced the loss of materials in the experiment, thereby broadening the application scenarios of multi-time biotinylated nucleic acid transcription ligation sequencing.
[0046] This invention simplifies unnecessary RNA recovery steps by using a reaction system on magnetic beads, accelerating the experimental process while reducing sample requirements. Simultaneously, this invention effectively improves the success rate of library construction for multi-time biotin-modified nucleic acid transcription-ligation sequencing and reduces experimental costs. Attached Figure Description
[0047] Figure 1 This is a flowchart of the rapid multi-time biotin-modified nucleic acid transcriptional ligation sequencing process of the present invention.
[0048] Figure 2 This is a PAGE gel electrophoresis image from Example 1. Figure 2 The bands in A, from left to right, are: Marker, 0.5 minutes for connecting samples 1 and 2, and 2 minutes for connecting samples 1 and 2; Figure 2 The bands B, from left to right, are: 8-minute strung samples 1 and 2, 32-minute strung samples 1 and 2, and Marker. Detailed Implementation
[0049] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0050] Fast-TV-PRO-seq: Fast time variant precise(Biotin-NTP) run-onsequencing.
[0051] Time variant: refers to the biotin-labeled transcriptional linking in this invention having multiple times.
[0052] Biotin-NTP: Biotin-labeled nucleotide.
[0053] Run-on: Transcriptional ligation, which involves adding a labeled nucleotide (e.g., bromine or biotin) to a transcriptional system (e.g., a living cell or in vitro transcription system) to make the newly generated RNA labeled.
[0054] Sequencing: In this patent, it specifically refers to second-generation sequencing.
[0055] Rapid multi-time biotinylated nucleic acid transcriptional ligation sequencing library construction and RNA extraction from animal cells undergoing transcription were performed. The residence time of RNA polymerase at corresponding sites was estimated by changes in the number of 3' reads. First, cells were rapidly cryopreserved in liquid nitrogen after membrane permeation treatment. After thawing for 1 minute, the membrane-permeable cells were added to a ligation reaction solution containing biotinylated nucleotides for four different ligation time series (0.2 to 60 minutes, e.g., 0.5 min, 2 min, 8 min, 32 min). After ligation, the reaction was quickly terminated with Trizol, and total RNA was extracted. This RNA was further fragmented, and adapters were added to its 3' ends using RNA ligase. The adapter-added RNA was co-incubated with streptavidin magnetic beads for 30 minutes, and the reaction solution was washed away. RNA 5' pyrophosphate hydrolase and buffer were added to the magnetic beads, and the reaction was carried out at 37°C for 60 minutes, after which the reaction solution was washed away. T4 polynucleotide kinase and reaction solution were added to the magnetic beads again, and the mixture was incubated at 37°C for 30 minutes. The reaction solution was then washed away. Adapters were added to the 5' ends of the RNA on the magnetic beads using RNA ligase. After adapter addition, the RNA was eluted from the magnetic beads using Trizol and reverse transcribed. The cDNA was amplified by polymerase chain reaction, purified by polyacrylamide gel electrophoresis, and then sequenced.
[0056] Example 1: Rapid multi-time biotinylated nucleic acid transcriptional ligation sequencing
[0057] 1. Cell permeation treatment
[0058] Prepare the cell permeation buffer by adding 15 mL of 1 mol / L sucrose (Sigma-Aldrich, SO389), 2.5 mL of 1% polysorbate-20 (Sigma-Aldrich, P9416), 0.5 mL of 1 mol / L pH 7.4 Tris-HCl buffer (Sigma-Aldrich, T2663), 0.5 mL of 0.1 mol / L ethylene glycol bis(2-aminoethyl ether)tetraacetic acid (Sigma-Aldrich, E3889), and 10%... NP40 (Thermo Fisher Scientific, 85124) 0.5 mL, 2 mol / L potassium chloride (Sigma-Aldrich, P9333) 0.25 mL, 1 mol / L magnesium chloride (Sigma-Aldrich, M2670) 0.25 mL, 1 mol / L dithiothreitol (Sigma-Aldrich, D0632) 25 μL, RNase inhibitor (Ambion, AM2696) 5 μL, protease inhibitor (Roche, 11873580001) one tablet, and add diethyl pyrocarbonate water (Thermo Fisher Scientific, 10514065) to a final volume of 50 mL.
[0059] For cell storage, add the following to a 15 mL centrifuge tube: 0.4 μL of 0.5 mol / L ethylenediaminetetraacetic acid (Thermo Fisher Scientific, AM9260G), 20 μL of 1 mol / L pH 8.0 Tris-HCl buffer (Ambion, 93283), 10 μL of 1 mol / L magnesium chloride (Sigma-Aldrich, M2670), 10 μL of 1 mol / L dithiothreitol (Sigma-Aldrich, D0632), 0.5 mL of glycerol (Sigma-Aldrich, G5516), and 1.46 mL of diethyl pyrocarbonate water (Thermo Fisher Scientific, 10514065).
[0060] HEK293 cells were cultured in T75 dishes until 60% completion, then the medium was changed and incubated overnight. The cells were treated with 5 mL of trypsin and 15 mL of DMEM medium (Sigma-Aldrich, D5796) containing FBS (Gibco, 10099141C) was added. Cells were collected by centrifugation at 4°C and 500g for 5 min (approximately one to three million cells; original multi-time biotinylated nucleic acid transcription-linked sequencing required over ten million cells). The supernatant was removed, and cells were gently washed with ice-cooled pH 7.4 PBS buffer (Thermo Fisher Scientific, 10728775), and collected by centrifugation at 4°C and 500g for 5 min. The supernatant was removed, and cells were resuspended by gently pipetting with 20 mL of ice-cooled cell permeation solution, incubated on ice for 5 min, and then collected by centrifugation at 4°C and 500g for 5 min. Remove the supernatant, add 15 mL of ice-cooled cell permeation buffer, gently pipette to resuspend the cells, and centrifuge at 500g for 5 min at 4°C to collect the cells. Remove the supernatant, add 15 mL of ice-cooled cell permeation buffer, gently pipette to resuspend the cells, and centrifuge at 500g for 5 min at 4°C to collect the cells. Remove the supernatant, use a pipette to remove as much residual liquid as possible, and add 2 mL of ice-cooled cell stock solution. Gently pipette to fully resuspend the cells, and aliquot 50 μL into 1.5 mL centrifuge tubes. Quickly transfer the aliquoted cells into a storage container filled with liquid nitrogen. Cells prepared in this step can be stored at -80°C for one month.
[0061] 2. Multitemporal transcriptional ligations
[0062] Preparation of transcription ligation buffer: 2.25 μL 1 mol / L magnesium chloride (Sigma-Aldrich, M2670), 4.5 μL 1M pH 8.0 Tris-HCl buffer (Ambion, 93283), 4.5 μL 0.1 mol / L dithiothreitol (Sigma-Aldrich, D0632), 9 μL RNase inhibitor (Ambion, AM2696), 22.5 μL 1 mmol / L biotin-labeled adenine triphosphate (PerkinElmer, NEL544001EA), 1 mmol / L biotin-labeled guanine triphosphate (PerkinElmer, N... EL545001EA) 22.5 μL, 1 mmol / L biotin-labeled cytosine triphosphate (PerkinElmer, NEL542001EA) 22.5 μL, 1 mmol / L biotin-labeled uracil triphosphate (PerkinElmer, NEL543001EA) 22.5 μL, 2 mol / L potassium chloride (Sigma-Aldrich, P9333) 67.5 μL, diethyl pyrocarbonate water (Thermo Fisher Scientific, 10514065) 272.25 μL.
[0063] Eight tubes of membrane-permeable cells prepared in step 1 were preheated in a 37°C metal bath for 1 min. 50 μL of transcription ligation buffer was added to each tube, and the mixture was gently pipetted to mix. The reaction was terminated by adding 500 μL of Trizol (Ambion, 115596018) to two centrifuge tubes at 0.5 min, 2 min, 8 min, and 32 min, respectively. The mixture was then pipetted to ensure complete mixing, and the tubes were placed on ice.
[0064] 3. RNA extraction
[0065] Transfer the centrifuge tubes from step 2 from ice to room temperature and incubate for 7 min. Add 130 μL of chloroform (Thermo Fisher Scientific, 10488400) to each tube, mix vigorously with a shaker for 15 seconds, and incubate at room temperature for 1 min. Centrifuge at 14000g for 2 min at 4°C, and transfer the supernatant to a new centrifuge tube. Add 1 μL of GlycoBlue (Thermo Fisher Scientific, 10301575) and an equal volume of isopropanol (Thermo Fisher Scientific, BP2618) to each tube, and mix with a shaker for 10 seconds. Incubate at room temperature for 10 min, then centrifuge at 14000g for 20 min at 4°C. Remove the supernatant, add 30 μL of diethyl pyrocarbonate-water, and dissolve the RNA precipitate.
[0066] 4. RNA fragmentation
[0067] Place the RNA solution from step 3 on ice, add 7.5 μL of 1N sodium hydroxide (Thermo Fisher Scientific, 10396240), and incubate on ice for 10 min. Add 37.5 μL of pH 6.8 Tris-HCl buffer (VWR International Ltd, A4987). Mix the solution with a pipette, add it to a P-30 filter column, and centrifuge at 1000g for 4 min at 4°C. Add 125 μL of diethyl pyrocarbonate-water, 1 μL of L LycoBlue, 8 μL of 5mol / L sodium chloride (Sigma-Aldrich, S9888), and 0.5 mL of ethanol (Sigma-Aldrich, 51976-500ML) refrigerated at -20°C to the filtrate. Gently vortex to mix the solution in the centrifuge tube, and centrifuge at 16000g for 30 min at 4°C. Remove the supernatant, add 7 μL of diethyl pyrocarbonate-water, and dissolve the RNA precipitate.
[0068] 5. Add a connector to the 3' end.
[0069] Add 0.5 μL of 20 μmol / L 3' RNA adapter (rGrArUrCrGrUrCrGrGrArCrUrGrArCrUrCrUrGrArC / invert dT / ) to the RNA solution from step 4, incubate at 65°C in a metal bath for 40 seconds for denaturation, and then cool on ice. Add the following to each tube: 2 μL of 10X T4 RNA ligase buffer (NEB, MO204S), 1.5 μL of T4 RNA Ligase I (NEB, MO204S), 6 μL of PEG8000 (NEB, MO204S), 1 μL of RNase inhibitor, and 2 μL of 10 mmol / L adenine triphosphate (NEB, P0756S). Mix the solutions in the tubes using a pipette and incubate at 26°C for one hour.
[0070] 6. Magnetic bead bonding
[0071] Prepare a double-concentration magnetic bead cleaning solution: Add 10 mL of 5 mol / L sodium chloride, 250 μL of 1 mol / L pH 7.4 Tris-HCl buffer, 2.5 mL of 1% Tween-20, and 12.25 mL of diethyl pyrocarbonate (DEPC) water to a 50 mL centrifuge tube. Add 160 μL of streptavidin magnetic beads C1 (Thermo Fisher Scientific, 65001) to the centrifuge tube, place it on a magnetic separator, and remove the solution. Rinse the magnetic beads twice with 500 μL of diethyl pyrocarbonate water containing 0.1 N sodium hydroxide and 50 mM sodium chloride, and then rinse the magnetic beads once with 100 mM sodium chloride. Remove the centrifuge tube from the magnetic separator, add 165 μL of the double-concentration magnetic bead cleaning solution, mix well by pipetting, and add 20 μL to each of the 8 centrifuge tubes from step 5. Incubate at room temperature on a rotary incubator for 30 min. Place the centrifuge tubes on a magnetic separator and remove the liquid. Use a 1:1 dilution of diethyl pyrocarbonate and water to dilute the magnetic bead cleaning solution to a concentration of 2, and then use this solution to clean the magnetic beads.
[0072] 7. 5' terminal enzyme treatment
[0073] Pit the liquid from step 6 and add 15 μL of diethyl pyrocarbonate water, 1 μL of RNA 5′ pyrophosphate hydrolase (NEB, M0356S), 2 μL of reaction buffer (NEB, M0356S), and 1 μL of RNase inhibitor to the magnetic beads in each centrifuge tube. Gently vortex to mix each centrifuge tube and incubate at 37°C for 1 hour.
[0074] Place the centrifuge tubes on a magnetic separator and wash the magnetic beads with magnetic bead cleaning solution. Aspirate the cleaning solution and add 1 μL T4 polynucleotide kinase, 2 μL reaction buffer, 2 μL 10 mmol / L adenine triphosphate, 1 μL RNase inhibitor, and 13 μL diethyl pyrocarbonate water to each centrifuge tube. Gently vortex to mix each tube and incubate at 37°C for 30 minutes.
[0075] 8. Add a connector to the 5' end.
[0076] Place the centrifuge tubes from step 7 on a magnetic separator and wash the magnetic beads with magnetic bead cleaning solution. Aspirate the cleaning solution and add the following to each centrifuge tube: 6.5 μL diethyl pyrocarbonate water, 0.5 μL 20 μmol / L 5' RNA adapter (rCrCrUrUrGrGrCrCrArCrCrCrGrArGrArArUrUrCrCrA), 2 μL 10X T4 RNA ligase buffer, 1.5 μL T4 RNA Ligase I, 6 μL PEG8000, 1 μL RNase inhibitor, and 2 μL 10 mmol / L adenine triphosphate. Mix the solution in the tubes using a pipette and incubate at 26°C for 1 hour.
[0077] 9. Magnetic bead elution
[0078] Place the centrifuge tube from step 8 on a magnetic separator and wash the magnetic beads twice with magnetic bead cleaning solution. Add 300 μL of Trizol to the centrifuge tube, mix by pipetting, and incubate at room temperature for 3 min. Transfer the solution to another centrifuge tube, add 200 μL of Trizol to the magnetic beads, mix by pipetting, and incubate at room temperature for 3 min before combining with the Trizol solution in the other centrifuge tube. Add 100 μL of chloroform to the 500 μL solution in the tube and vortex for 15 seconds. Incubate for 1 min, then centrifuge at 14000g for 2 min at 4°C. Transfer the supernatant to a new centrifuge tube and add an equal volume of isopropanol and 1 μL of GlycoBlue. Mix with a pipette and incubate at room temperature for 10 min. Centrifuge the tube at 16000g for 20 min at 4°C, remove the liquid, and add 12 μL of diethyl pyrocarbonate water to dissolve the RNA precipitate.
[0079] 10. Reverse transcription
[0080] Add 1 μL of 10 mmol / L deoxyribonucleotides (NEB, N0447) and 1 μL of 25 μmol / L RP1 primers (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTAC AGTCCGA) to the RNA solution from step 9. Incubate the centrifuge tubes in a 65°C metal bath for 1 min to denature, then cool on ice. Add 1.5 μL of Superscript III reverse transcriptase (Thermo Fisher Scientific, 12087539), 4 μL of First-Stand buffer (Thermo Fisher Scientific, 12087539), 1 μL of 0.1 mol / L dithiothreitol (Thermo Fisher Scientific, 12087539), and 1 μL of RNase inhibitor to each centrifuge tube. Mix the solutions in the centrifuge tubes thoroughly and transfer to 200 μL PCR tubes. Place the PCR tube in the PCR instrument and run the following program: 37℃ for 5 min, 45℃ for 15 min, 50℃ for 40 min, 55℃ for 10 min, 70℃ for 15 min, and then maintain a constant temperature of 4℃.
[0081] 11. Polymerase chain amplification
[0082] Add 4 μL of diethyl pyrocarbonate water, 25 μL of Q5 PCR mix, and 1 μL of 25 μmol / L LRPI-n primers (CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO.5)NNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA (SEQ ID NO.6)). NNNNNN represents the adapter sequences in Index 1 (RPI1) to Index 48 (RPI48) of the TruSeq Small RNA portion of Illumina's Illumina Adapter Sequences, specifically: CGTGAT, ACATCG, GCCTAA, TGGTCA, CA CTGT, ATTGGC, GATCTG, TCAAGT, CTGATC, AAGCTA, GTAGCC, TACAAG, TTGACT, GGAACT, TGACAT, GGACGG, CTCTAC, GCGGAC, TTTCAC, GGC CAC, CGAAAC, CGTACG, CCACTC, GCTACC, ATCAGT, GCTCAT, AGGAAT, CTTTTG, TAGTTG, CCGGTG, ATCGTG, TGAGTG, CGCCTG, GCCATG, AAAATG, TTGTTGG, ATTCCG, AGCTAG, GTATAG, TCTGAG, GTCGTC, CGATTA, GCTGTA, ATTATA, GAATGA, TCGGGA, CTTCGA, TGCCGA). The PCR instrument was run with the following program: 95℃ for 5 min, (95℃ for 30 seconds, 56℃ for 30 seconds, 72℃ for 30 seconds) cycled 15 times, 72℃ for 10 min, and then held at 4℃.
[0083] 12. Purification and recovery
[0084] Transfer the product from step 11 to 1.5 mL centrifuge tubes. Add 750 μL of ethanol, 232 μL of diethyl pyrocarbonate-water, and 18 μL of 5 mol / L sodium chloride to each tube and mix well. Cool at -80°C for 20 min, then centrifuge at 16000g for 30 min at 4°C. Remove the supernatant and air dry in a fume hood for 5 min. Add 50 μL of diethyl pyrocarbonate-water to each tube to dissolve the DNA precipitate. Transfer 20 μL of the solution to a new centrifuge tube (store the remaining solution at -80°C for later use), and add 4 μL of 6X orange loading buffer (NEB, B7022S). Divide the sample into two wells and load onto a pre-prepared PAGE gel (Thermo Fisher Scientific, XP00100BOX). Electrophoresis at 15 mA until the loading buffer runs off the gel. Stain with SYBR Gold (S33102) for 5 min. Cut a gel from 120 bp to 500 bp using a blue light gel cutter (see [link to gel excerpt]). Figure 2 The success rate was 8 / 8, compared to 32 / 54 for the original multi-time biotin-modified nucleic acid transcription-ligation sequencing library construction method. Place the gel block into a 500μL centrifuge tube with a hole punched in the bottom using an 18G syringe needle, and then place the 500μL centrifuge tube into a 2mL centrifuge tube. Centrifuge at 5000g for 1 min to thoroughly break up the gel and transfer it to the 2mL centrifuge tube. Add 200μL of lysis buffer (NEB, T3012-1) to the centrifuge tube and incubate at 37℃ with shaking for 30 min. Add 1mL of DNA Cleanup Binding Buffer (NEB, T1030S) to each centrifuge tube, mix well, and centrifuge at 4000g for 30 seconds. Transfer approximately 580μL of the solution to the elution column and recover the DNA fragments (NEB, T1030S) according to the instructions.
[0085] Example 2: Optimization Experiment of Magnetic Bead Enrichment System
[0086] In this embodiment, the magnetic bead enrichment system was optimized using the same concentration of biotin-linked RNA as the starting material. Three different magnetic beads and three different magnetic bead pretreatment and washing systems were used. The magnetic beads included M280 beads, C1 beads, and T1 beads, and the buffers included PRO-seq, 4sU DRB-seq, and TimeLapse-seq. The experiment was repeated twice, and the average concentration of recovered RNA is shown in Table 1.
[0087] Table 1. RNA Concentration Detection (ng / μL)
[0088] M280 magnetic beads C1 magnetic beads T1 magnetic beads PRO-seq buffer 297 872 593 4sU DRB-seq buffer 362 1340 902 TimeLapse-seq buffer 497 1030 936
[0089] Prepare 18 centrifuge tubes, adding 20 μL of M280, C1, and T1 magnetic beads to each of the 6 tubes. Place the centrifuge tubes on a magnetic separator and let them stand for one minute to remove the supernatant. Wash the magnetic beads twice with 500 μL of diethyl pyrocarbonate-water containing 0.1 N sodium hydroxide and 50 mM sodium chloride, and then wash the magnetic beads once with diethyl pyrocarbonate-water containing 100 mM sodium chloride, removing the supernatant. Remove the centrifuge tubes from the magnetic separator, and perform biotinylated RNA recovery in 2 tubes for each type of magnetic bead using the three different magnetic bead washing processes.
[0090] The PRO-seq magnetic bead binding and washing method is as follows: Mix 10 μL of binding buffer with 10 μL of 2 ng / μL biotin-labeled RNA solution, add the mixture to a centrifuge tube containing the washed magnetic beads, and incubate at room temperature on a rotary incubator for 30 min. Place the centrifuge tube on a magnetic separator and remove the liquid. Wash the magnetic beads with 500 μL of low-salt buffer, incubate on the magnetic separator for 1 minute, and remove the supernatant; wash the magnetic beads with 500 μL of binding buffer, incubate on the magnetic separator for 1 minute, and remove the supernatant, repeating twice; wash the magnetic beads with 500 μL of high-salt buffer, incubate on the magnetic separator for 1 minute, and remove the supernatant, repeating twice. The low-salt buffer formulation is: 5 mM Tris-HCl pH 7.4, 0.1% Triton X-100, dissolved in diethyl pyrocarbonate water; the binding buffer formulation is: 10 mM Tris-HCl pH 7.4, 300 mM NaCl, 0.1% Triton X-100, dissolved in diethyl pyrocarbonate water; the high-salt buffer formulation is: 50 mM Tris-HCl pH 7.4, 2 M NaCl, 0.5% Triton X-100, dissolved in diethyl pyrocarbonate water.
[0091] The 4sU DRB-seq magnetic bead washing method is as follows: Mix 10 μL of double-concentration magnetic bead washing solution with 10 μL of 2 ng / μL biotin-labeled RNA solution, add the mixture to a centrifuge tube containing the washed magnetic beads, and incubate at room temperature on a rotary incubator for 30 min. Place the centrifuge tube on a magnetic separator and remove the liquid. Wash the magnetic beads with 500 μL of magnetic bead washing solution, incubate on a magnetic separator for 1 minute, remove the supernatant, and repeat twice. The double-concentration magnetic bead washing solution is formulated as follows: 2M sodium chloride, 5mM pH 7.4 Tris-HCl buffer, 0.05% Tween-20, dissolved in diethyl pyrocarbonate water. The magnetic bead washing solution is formulated as follows: dilute the double-concentration magnetic bead washing solution with an equal volume of diethyl pyrocarbonate water.
[0092] The TimeLapse-seq magnetic bead washing method is as follows: Mix 10 μL of magnetic bead washing solution with 10 μL of 2 ng / μL biotin-labeled RNA solution, add the mixture to a centrifuge tube containing the washed magnetic beads, and incubate at room temperature on a rotary incubator for 30 min. Place the centrifuge tube on a magnetic separator and remove the liquid. Wash the magnetic beads with 500 μL of magnetic bead washing solution, incubate on a magnetic separator for 1 minute, remove the supernatant, and repeat twice. The magnetic bead washing solution is formulated as follows: 1M sodium chloride, 100mM pH7.4 Tris-HCl buffer, 0.05% Tween-20, 10mM ethylenediaminetetraethyl disodium salt, dissolved in diethyl pyrocarbonate water.
[0093] Place each of the 18 centrifuge tubes on a magnetic separator and add 300 μL of Trizol. Mix well by pipetting and incubate at room temperature for 3 min. Transfer the solution to another centrifuge tube, add 200 μL of Trizol to the magnetic beads, mix well by pipetting, and incubate at room temperature for 3 min. Combine the Trizol solution from the first centrifuge tube with the solution from the second centrifuge tube. Add 100 μL of chloroform to the 500 μL solution in the first centrifuge tube and vortex for 15 seconds. Incubate for 1 min, then centrifuge at 14000g for 2 min at 4°C. Transfer the supernatant to a new centrifuge tube and add an equal volume of isopropanol and 1 μL of LlycoBlue. Mix well using a pipette and incubate at room temperature for 10 min. Centrifuge the tube at 16000g for 20 min at 4°C, remove the liquid, and add 12 μL of diethyl pyrocarbonate-water to dissolve the RNA precipitate. Analyze the RNA concentration using Qubit.
[0094] After comparison, the C1 magnetic beads used in TimeLapse-seq and the magnetic bead washing and buffer system used in 4sU DRB-seq were finally adopted to replace the M280 magnetic beads and PRO-seq buffer system used in the original multi-time biotin-modified nucleic acid transcription ligation sequencing library preparation method; under this system, the RNA concentration was significantly higher than that of other systems.
[0095] The above detailed embodiments have provided a comprehensive description of the present invention. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.
Claims
1. A method for constructing a rapid multi-temporal biotin-modified nucleic acid transcriptional ligation sequencing library, comprising the following steps: S1: The surface-permeable sample was added to a transcriptional ligation reaction solution containing biotin-labeled nucleotides, and four transcriptional ligation reactions of different time lengths were performed using a geometric series ranging from 0.2 to 60 minutes. S2: RNA is extracted from the sample and fragmented to obtain RNA fragments; S3: Add a 3' end connector; S4: Add magnetic beads for purification; The magnetic beads include C1 magnetic beads or T1 magnetic beads; The purification was performed once. The reaction conditions were: room temperature reaction for 0.5-1 h; S5: addition of 5' end linker to obtain the ligation product; S6: Elute the magnetic beads to obtain the purified ligation product; The elution was performed by using Trizol to elute RNA from the magnetic beads; S7: Perform PCR amplification on the purified ligation product to obtain the sequencing library; Steps S4 to S6 include cleaning the magnetic beads using a magnetic bead cleaning solution, which includes 4sU DRB-seq buffer or TimeLapse-seq buffer. The 4sU DRB-seq buffer comprises: 0.5–1.5 M sodium chloride, 2–3 mM Tris-HCl buffer, and 0.02–0.03% Tween; The TimeLapse-seq buffer comprises: 0.5–1.5 M sodium chloride, 80–120 mM Tris-HCl buffer, 0.03–0.07% Tween, and 8–12 mM ethylenediaminetetraethyl disodium.
2. The construction method according to claim 1, characterized in that, Step S3 includes: adding a 3' end adapter to the RNA fragment and incubating at 20-28°C for 1-4 hours.
3. The construction method according to claim 1, characterized in that, Step S5 includes: adding a 5' end connector and incubating at 20-28°C for 1-4 hours.
4. The application of the construction method according to any one of claims 1 to 3 in gene expression analysis or biological genetic analysis.