Inhibitory anti-enpp1 antibodies

Abstract

In certain aspects, provided herein are inhibitory anti-ENPP1 antibodies and antigen-binding fragments thereof. In some aspects, provided herein are methods of using the antibodies provided herein to treat myocardial infarction. In certain aspects, provided herein are nucleic acid molecules encoding the antibodies provided herein, host cells comprising such nucleic acids, and methods of using such host cells to make the antibodies provided herein. In some aspects, provided herein are also pharmaceutical compositions comprising the antibodies provided herein.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 019,773, filed May 4, 2020, the contents of which are incorporated herein by reference in their entirety.

[0003] Government support

[0004] This invention is supported by the government under grant numbers HL137241 and AR075867 from the National Institutes of Health and W81XWH-17-1-0464 from the Department of Defense. The government holds certain rights to this invention. Background Technology

[0005] Following acute ischemic injury, the heart's ability to regenerate dead myocardium is poor, and the lost myocardium is replaced by non-contractile scar tissue. This scar tissue increases the hemodynamic burden on the remaining myocardium, and over time, ventricular failure often occurs, leading to a cycle of ventricular dilation, worsening fibrosis, and progressive decline in cardiac function. Scar tissue is an independent predictor of death and cardiovascular outcomes following cardiac injury. More than 700,000 patients are diagnosed with heart failure each year, with over 40% being a result of heart attack or myocardial infarction. Therefore, modulating cardiac wound healing to redirect the cardiac injury response from a fibrotic one to a reparative one, while minimizing adverse cardiac remodeling and decline, represents an unmet need in cardiovascular therapy. Summary of the Invention

[0006] In some respects, this document provides compositions and methods relating to antibodies that specifically bind to and inhibit ENPP1, such antibodies which can be used, for example, to promote cardiac wound healing in subjects following myocardial infarction. Therefore, in some embodiments, this document provides antibodies specific to ENPP1, pharmaceutical compositions comprising such antibodies, methods for preparing such antibodies, and methods for using such antibodies, for example, to treat myocardial infarction, improve cardiac wound healing, and prevent heart failure. Attached Figure Description

[0007] Figure 1 The role of ENPP1 in cardiac wound healing is demonstrated. (A) Injury leads to the release of ATP from muscle cells. (B) Injury induces the expression of ENPP1 in cardiac fibroblasts, which hydrolyzes ATP into AMP and PPi. (C) AMP / PPi or other downstream substances induce the expression of inflammatory cytokines. (D) Inflammatory cytokines act on fibroblasts, macrophages, and endothelial cells to induce cell death. (E) Cell death of non-muscle cells leads to the interruption of wound healing.

[0008] Figure 2A Exemplary qPCR results are shown, indicating that ENPP1 expression was increased in the damaged areas of the heart compared to the undamaged areas of the same heart (n = 10 animals / group, **p < 0.01).

[0009] Figure 2B Exemplary Western blot analysis of ENPP1 in undamaged and damaged regions of the same heart following ischemic cardiac injury (M1, M2, and M3 refer to the hearts of animals that underwent ischemic injury), with GAPDH as a loading control, and a semi-quantitative density assay showing the degree of increase in ENPP1 protein expression in damaged versus undamaged regions of the same heart (n = 5 animals / group, *p < 0.05).

[0010] Figure 2C These are exemplary micrographs showing hematoxylin and eosin staining of undamaged and damaged areas of the heart (top image) and immunostaining with ENPP1 (bottom image, green). Boxes indicate the areas imaged. Representative images from n=5 animals.

[0011] Figure 3 This is an exemplary micrograph showing ENPP1 expression by cardiac fibroblasts in the injured area of ​​the heart following ischemic cardiac injury. Seven days post-injury, ENPP1 was expressed by cardiac fibroblasts in TCF21MerCreMer:R26R. tdtomato (Figure A) and Col1a2CreERT:R26R tdtomato (Figure B) shows ENPP1 expression in undamaged and damaged areas of the heart (day 7 post-injury), revealing a significant increase in ENPP1 (green) expression in cardiac fibroblasts (red, arrow). Immunostaining of vimentin (a fibroblast marker, Figure C) in wild-type mice after injury showed that cardiac fibroblasts expressing vimentin (red, arrow) also expressed ENPP1.

[0012] Figure 4A and 4B This is an exemplary result of single-cell RNA sequencing of non-muscle cells in the heart 7 days after injury, performed using the 10X Genomics platform. Figure 4A This is a clustering illustration of different cell populations in the heart using typical transcriptomics markers 7 days after injury, showing populations of cardiac fibroblasts, macrophages, and other cell types. Figure 4B This is an overlay of ENPP1 expression, showing that fibroblasts predominate in its expression, while macrophages and other dispersed cell types show lower levels of expression.

[0013] Figure 5AThis is a heatmap showing the gene expression of different exonucleases in the heart at different time points after cardiac injury. The red rectangles indicate ENPP1 expression, which was significantly increased in the injured tissue (In) compared to the uninjured tissue (Un) at 3, 7, 14, and 21 days post-injury.

[0014] Figure 5B This is an exemplary graph showing the ATP hydrolytic activity of damaged tissues extracted from wild-type and ENPP1 mutant (ENPP1asj / asj) mice, and demonstrating a significant increase in hydrolytic activity in damaged tissues from wild-type mice, while no such result was observed in mutant mice (*p<0.05, n=5).

[0015] Figure 6A These are exemplary micrographs showing that co-culture of cardiac fibroblasts (green) and myocardial cells (red) expressing ENPP1 induced cell death in cardiac fibroblasts in the presence of ATP. In the absence of ATP (Fig. A) or in the presence of ATP (Fig. B), control cardiac fibroblasts (green) were co-cultured with neonatal rat cardiomyocytes, and cell viability was estimated by flow cytometry. In the absence of ATP (Fig. C) or in the presence of ATP (Fig. D), cardiac fibroblasts overexpressing ENPP1 (green) were co-cultured with cardiomyocytes. The significant reduction in green-stained cells in Fig. D indicates a significant reduction in the number of viable cardiac fibroblasts. No significant cardiomyocyte death was observed in this system.

[0016] Figure 6B It is displayed Figure 6A An exemplary figure of the results of flow cytometry assays performed in the study.

[0017] Figure 7 These are exemplary bright-field micrographs and quantitative images showing that ENPP1 induces the release of pro-apoptotic molecules from cardiomyocytes, which induce cell death, exacerbate cell death, and promote inflammation in various resident cardiac cells. ENPP1 and ATP were added to cardiomyocytes and conditioned medium was collected. ENPP1 conditioned medium was added to other resident cardiac cells, such as macrophages, endothelial cells, cardiac fibroblasts, and smooth muscle cells, grown on separate culture dishes. After incubation with either control or conditioned medium for 48 hours, the treated cells were imaged using a bright-field microscope, and the cells were subjected to flow cytometry to determine the degree of cell death by PI staining. The data showed that treatment with ENPP1 and ATP conditioned medium resulted in a decrease in the number of adherent cells, an increase in cell death, and a significant increase in the number of PI-positive cells under a bright-field microscope (**p<0.01, *p<0.05, n=6).

[0018] Figure 8 This is a graph showing the genetic variation of ENPP1 expression in 100 mouse strains after control or isoproterenol infusion. Normalized ENPP1 expression in the hearts of 100 mouse strains 3 weeks after isoproterenol infusion. The genetic variation of ENPP1 expression after isoproterenol infusion (red bars) in most strains indicates increased cardiac ENPP1 expression after isoproterenol infusion compared to the control condition (black bars).

[0019] Figure 9 This is an exemplary plot showing the correlation between cardiac traits (heart mass, ejection fraction, LVID (ventricular size), E / A ratio, interstitial fibrosis, and heart rate) and cardiac ENPP1 expression in 100 strains. In each plot, each point represents a mouse strain, and normalized ENPP1 expression is plotted along the X-axis. The Y-axis represents the measurements of the cardiac trait. Two different conditions are shown (control and after isoproterenol infusion). ENPP1 is not strongly correlated with cardiac traits under the control condition. ENPP1 is strongly correlated with heart mass, fibrosis, ventricular size, E / A ratio, and ejection fraction after isoproterenol infusion. Strains exhibiting higher ENPP1 expression have greater myocyte mass (proliferation), more fibrosis, and show reduced ejection fraction and shortening fraction, as well as ventricular dilation. For cases showing the specificity of these genetic correlations, ENPP1 is not correlated with heart rate (p-values ​​and bicorrelation coefficients are shown in red).

[0020] Figure 10 It is a network module, and it shows that ENPP1 (highlighted with a red circle) is an important node in this network module (Yu et al. 2018).

[0021] Figure 11A and 11B It is Cre(-)ENPP1 fl / fl Exemplary M-mode echocardiogram frames of control and ENPP1 CKO mice.

[0022] Figure 11C and 11D It is displayed in Cre(-)ENPP1 fl / fl Exemplary plots of EF / FS and LVID measurements during systole and diastole in ENPP1 CKO mice (at each time point, n = 17 mice for control and n = 22 mice for ENPP1 CKO, *P < 0.01, **p < 0.05).

[0023] Figure 12A and 12BThis is an exemplary heart slice cut sequentially from the ligation site, through the middle ventricle to the base (Figure B). Cre(-)ENPP1 fl / fl Mice or ENPP1 CKO mice underwent cardiac injury. Four weeks after cardiac injury, hearts were collected and sequentially sectioned.

[0024] Figure 12C and 12D It is displayed Figure 12A Exemplary plots of the average fibrotic area from sections obtained from the mid-ventricle and apex of the heart, and the percentage of animals exhibiting severe fibrosis (>40%), moderate fibrosis (20%–40%), and mild fibrosis (<20%) in each group (for Cre(-), n = 9; for ENPP1 CKO, n = 12. *p < 0.05).

[0025] Figure 13A and 13B The scatter plot shows that WT(Cre-) mice have significantly higher expression of activated fibroblast markers and activated macrophage markers compared to ENPP1 CKO mice.

[0026] Figure 13C This is an exemplary diagram of the GO pathway between WT and ENPP1cKO mice, showing that, compared to ENPP1cKO animals, the expression of genes regulating pro-inflammatory pathways, collagen, and extracellular matrix was significantly increased in WT. Inhibition of ENPP1 significantly attenuated this pro-inflammatory and pro-fibrotic pathway (three hearts from each group were used for single-cell sequencing analysis).

[0027] Figure 14A and 14B These are M-mode echocardiogram frames showing the ventricles and cardiac walls 7 days after ischemic injury following the administration of either a mediator (Fig. A) or myricetin (Fig. B) (starting on the day of injury).

[0028] Figure 14C and 14D This is an exemplary plot showing the quantitative values ​​of ejection fraction and shortening fraction in animals injected with the medium and myricetin over 4 weeks (n = 8 animals / group; p < 0.05).

[0029] Figure 15This is an exemplary affinity binding curve for an ENPP1 monoclonal antibody (mAb) targeting human ENPP1. HEK cells overexpressing full-length ENPP1 were incubated with different concentrations of ENPP1 mAb, followed by flow cytometry to determine the mean fluorescence intensity, which was used as a binding readout. The data were then plotted in Graph Pad Prism, and Kd was calculated to be 3.516 nM. IgG at the same concentration was used as a control.

[0030] Figure 16 These are example property spectra showing the molecular weight and characterization of the reduced and deglycosylated ENPP1 monoclonal antibodies. The ENPP1 monoclonal antibody prepared by recombinant synthesis in the CHO cell line is an IgG1κ isotype with a heavy chain of approximately 48 kDa and a light chain of approximately 24 kDa.

[0031] Figure 17 This is an exemplary graph illustrating the role of monoclonal antibody 12-J-4 in inhibiting ENPP1. In a luciferase-based assay, ATP was incubated with luciferase in the presence or absence of ENPP1+ / - mAb or an IgG control. A high luminescence signal was obtained in the absence of ENPP1. However, luminescence decreased upon the addition of ENPP1, but was significantly higher in samples containing 12-J-4 compared to IgG.

[0032] Figure 18A These are exemplary micrographs showing the inhibition of ENPP1-mediated cell death by ENPP1 mAb. Cardiac fibroblasts (green) were co-cultured with cardiomyocytes (red), and then a mediator was added (Fig. A) or recombinant ENPP1 and ATP and IgG (Fig. B) or recombinant ENPP1 and ATP and 12-J-4ENPP1 mAb (Fig. C). Images were acquired after 48 hours, and cell death and detachment of cardiac fibroblasts were observed in the IgG control wells (Fig. B). However, cell death and detachment were significantly reduced in the presence of ENPP1 mAb (Fig. C).

[0033] Figure 18B It is displayed according to the Figure 18A An exemplary graph shows the results of cell death (PI+) measured by flow cytometry using the assay performed in this study. The results indicate that PI+ cells are significantly reduced in the presence of ENPP1mAb. Detailed Implementation

[0034] This document describes antibodies (e.g., monoclonal antibodies) that specifically bind to ENPP1. Therefore, this document provides isolated antibodies, methods for preparing such antibodies, methods for treating myocardial infarction, methods for promoting cardiac wound healing, methods for preventing heart failure, and pharmaceutical compositions comprising the ENPP1-specific antibodies disclosed herein.

[0035] In some aspects, this document provides anti-ENPP1 antibodies associated with antibody 12-J4-A (e.g., having one or more CDRs identical to antibody 12-J4-A and / or competing with 12-J4-A for antigen binding). The CDR sequence of antibody 12-J4-A is provided in Table 1. In some embodiments, the antibodies provided herein comprise a light chain variable region comprising CDRL1 of SEQ ID NO:1, CDRL2 of SEQ ID NO:2, and CDRL3 of SEQ ID NO:3. In some embodiments, the antibodies comprise a heavy chain variable region comprising CDRH1 of SEQ ID NO:4, CDRH2 of SEQ ID NO:5, and CDRH3 of SEQ ID NO:6.

[0036] Table 1.12-J4-A CDR Sequence

[0037]

[0038]

[0039] In some embodiments, the 12-J4-A-related antibody provided herein comprises a heavy chain variable region and / or a light chain variable region, the heavy chain variable region and / or the light chain variable region comprising an amino acid sequence and / or encoded by a nucleic acid sequence having at least 90% identity with the sequences listed in Table 2 (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and / or 100% identity).

[0040] Table 2.12-J4-A Variable Region Sequence

[0041]

[0042]

[0043] In some aspects, this document provides anti-ENPP1 antibodies associated with antibody 14-O17-A (e.g., having one or more CDRs identical to antibody 14-O17-A and / or competing with 14-O17-A for antigen binding). The CDR sequence of antibody 14-O17-A is provided in Table 3. In some embodiments, the antibodies provided herein comprise a light chain variable region comprising CDRL1 of SEQ ID NO:11, CDRL2 of SEQ ID NO:12, and CDRL3 of SEQ ID NO:13. In some embodiments, the antibodies comprise a heavy chain variable region comprising CDRH1 of SEQ ID NO:14, CDRH2 of SEQ ID NO:15, and CDRH3 of SEQ ID NO:16.

[0044] Table 3.14-O17-A Sequence

[0045] L1 RASQSISKYLH 11 L2 YISQSIS 12 L3 QQSYSWPWT 13 H1 GYTFTSY 14 H2 NPYNDG 15 H3 RGYYDYDGLDY 16

[0046] In some embodiments, the 14-O17-A-related antibody provided herein comprises a heavy chain variable region and / or a light chain variable region, the heavy chain variable region and / or the light chain variable region comprising an amino acid sequence and / or encoded by a nucleic acid sequence having at least 90% identity with the sequences listed in Table 4 (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and / or 100% identity).

[0047] Table 4.14-O17-A Variable Region Sequence

[0048]

[0049] In some aspects, this document provides anti-ENPP1 antibodies associated with antibody 5-H7-A (e.g., having one or more CDRs identical to antibody 5-H7-A and / or competing with 5-H7-A for antigen binding). The CDR sequence of antibody 5-H7-A is provided in Table 5. In some embodiments, the antibodies provided herein comprise a light chain variable region comprising CDRL1 of SEQ ID NO:21, CDRL2 of SEQ ID NO:22, and CDRL3 of SEQ ID NO:23. In some embodiments, the antibodies comprise a heavy chain variable region comprising CDRH1 of SEQ ID NO:24, CDRH2 of SEQ ID NO:25, and CDRH3 of SEQ ID NO:26.

[0050] Table 5.5-H7-A CDR Sequence

[0051]

[0052] In some embodiments, the 5-H7-A-related antibodies provided herein comprise heavy chain variable regions and / or light chain variable regions, which comprise amino acid sequences and / or are encoded by nucleic acid sequences having at least 90% identity with the sequences listed in Table 6 (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and / or 100% identity).

[0053] Table 6.5-H7-A Variable Region Sequence

[0054]

[0055]

[0056] In some embodiments, the antibodies provided herein specifically bind to ENPP1. In some embodiments, the antibodies provided herein bind to ENPP1 and inhibit ENPP1.

[0057] As used herein, the term "antibody" includes complete antibodies as well as any antigen-binding fragments (i.e., "antigen-binding portions") or single chains thereof. In one embodiment, an "antibody" refers to a glycoprotein or its antigen-binding portion comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain consists of a heavy chain variable region (abbreviated herein as V). H The heavy chain constant region consists of three domains: CH1, CH2, and CH3. In some naturally occurring antibodies, each light chain consists of a light chain variable region (abbreviated as V in this paper). L It consists of a light chain constant region and a structural domain CL. H District and V L The region can be further subdivided into highly variable regions, called complementary determinant regions (CDRs), interspersed with more conservative regions called frame regions (FRs). Each V H and V LIt consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant regions of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0058] Antibodies typically bind specifically to their homologous antigens with high affinity, said high affinity being 10... -5 Up to 10 -11 M or a smaller dissociation constant (K) D ) indicates. Anything greater than approximately 10 -4 M of K D This is generally considered to represent nonspecific binding. As used herein, an antibody that "specifically binds" to an antigen refers to an antibody that binds to an antigen with high affinity and to substantially the same antigen, meaning that it possesses K... D 10 -7 M or smaller, preferably 10 -8 M or smaller, or even more preferably 5×10 -9 M or smaller, and most preferably in 10 -8 M and 10 -10 M is between or smaller, but does not bind to unrelated antigens with high affinity. If an antigen exhibits a high degree of sequence identity with a given antigen, for example, if it exhibits at least 80%, at least 90%, preferably at least 95%, more preferably at least 97%, or even more preferably at least 99% sequence identity with a given antigen, then it is “substantially identical” to the given antigen.

[0059] In some embodiments, the antibodies provided herein may be derived from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG, and IgM. IgG isotypes are subdivided in some species: in humans, IgG1, IgG2, IgG3, and IgG4, and in mice, IgG1, IgG2a, IgG2b, and IgG3. Immunoglobulins, such as IgG1, exist in several isotypes that differ from each other at most a few amino acids. "Antibody" includes, for example, both naturally occurring and non-naturally occurring antibodies; both monoclonal and polyclonal antibodies; both chimeric and humanized antibodies; both human and non-human antibodies; fully synthetic antibodies; and single-chain antibodies.

[0060] In some embodiments, this document provides antigen-binding portions of antibodies disclosed herein (e.g., antibodies associated with 12-JA-A, 14-O17-A, and / or 5-H7-A). As used herein, the term "antigen-binding portion" of an antibody refers to one or more fragments of an antibody that maintain the ability to specifically bind to an antigen (e.g., ENPP1). Such "fragments" are, for example, between about 8 and about 1500 amino acids in length, suitably between about 8 and about 745 amino acids in length, suitably between about 8 and about 300, for example between about 8 and about 200 amino acids in length, or between about 10 and about 50 or 100 amino acids in length. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments covered within the term "antigen-binding portion" of an antibody, as described herein, include (i) Fab fragments, which are formed by V L V H (ii) a monovalent segment consisting of CL and CH1 domains; (iii) a divalent segment consisting of two Fab segments connected by a disulfide bridge in the hinge region; and (iv) a Fd segment consisting of V... H (iv) The Fv fragment, which consists of the V-arm of the antibody, and the CH1 domain; L and V H The structural domain is composed of the (v)dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of V H The structural domains consist of (vi) separate complementarity-determining regions (CDRs) or (vii) combinations of two or more separate CDRs, which may optionally be connected by a synthesis joint. Furthermore, although the two structural domains V of the Fv segment... L and V H Encoded by different genes, but they can be linked together using recombination methods via synthetic adapters that allow them to be prepared as single protein chains, wherein V L and V H Regions pair to form monovalent molecules (called single-chain Fvs (scFvs); see, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding moiety" of the antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and their utility is screened in the same manner as for intact antibodies. Antigen-binding moieties can be produced via recombinant DNA technology or by enzymatic or chemical cleavage of intact immunoglobulins.

[0061] In some embodiments, the antibodies provided herein comprise one or more CDRs of antibody 12-JA-A, 14-O17-A, and / or 5-H7-A (e.g., as provided in Tables 1, 3, and 5). An antibody's "CDR" is an amino acid residue within a hypervariable region identified according to the definitions and / or conformational definitions of Kabat, Chothia, AbM, Contact, or any CDR determination method well known in the art. Antibody CDRs can be identified as hypervariable regions originally defined by Kabat et al. See, for example, Kabat et al., 1992, Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, NIH, Washington DC. The location of a CDR can also be identified as a structural loop structure originally described by Chothia et al. See, for example, Chothia et al., 1989, Nature 342:877-883. Other methods for CDR identification include the "AbM definition," a compromise between Kabat and Chothia, which uses Oxford Molecular's AbM antibody modeling software (now...). The CDR can be derived from, or based on the “contact definition” of the observed antigen contact, as illustrated in MacCallum et al., 1996, J. Mol. Biol., 262:732-745. In another approach, referred to herein as the “conformation definition” of the CDR, the position of the CDR can be identified as a residue that contributes enthalpy to antigen binding. See, for example, Makabe et al., 2008, Journal of Biological Chemistry, 283:1156-1166. Other CDR boundary definitions may not strictly follow one of the above methods, but will still overlap with at least a portion of the Kabat CDR, although they may be shortened or lengthened based on predictions or experimental results of specific residues or groups of residues, or even the entire CDR may not significantly affect antigen binding. As used herein, a CDR can refer to a CDR defined by any method (including combinations of methods) known in the art. The methods used herein can employ CDRs defined according to any of these methods. For any given implementation containing more than one CDR, the CDR can be defined according to any of the following definitions: Kabat, Chothia, extension, AbM, Contact, and / or conformation.

[0062] In some embodiments, the antibodies provided herein are monoclonal antibodies. As used herein, the term "monoclonal antibody" refers to an antibody exhibiting a single binding specificity and affinity for a particular epitope, or a composition of antibodies in which all antibodies exhibit a single binding specificity and affinity for a particular epitope. Thus, the term "human monoclonal antibody" refers to an antibody or antibody composition exhibiting a single binding specificity and having a variable region and optionally a constant region derived from a human germline immunoglobulin sequence. In one embodiment, the human monoclonal antibody is produced by a hybridoma comprising B cells fused to immortalized cells obtained from a transgenic nonhuman animal (e.g., a transgenic mouse) having a genome comprising human heavy chain transgenes and light chain transgenes.

[0063] In some embodiments, the antibodies provided herein are humanized antibodies. A “humanized” antibody is an antibody in which some, most, or all of the amino acids outside the CDR domain of a non-human antibody are replaced by corresponding amino acids derived from human immunoglobulins. In one embodiment of the humanized form of the antibody, some, most, or all of the amino acids outside the CDR domain have been replaced by amino acids derived from human immunoglobulins, while some, most, or all of the amino acids within one or more CDR regions remain unchanged. Minor additions, deletions, insertions, substitutions, or modifications of amino acids are permitted, as long as they do not eliminate the antibody’s ability to bind to a specific antigen. “Humanized” antibodies maintain antigen specificity similar to that of the original antibody.

[0064] In some implementations, the antibodies provided herein are chimeric antibodies. A "chimeric antibody" is an antibody in which the variable region is derived from one species and the constant region is derived from another species, such as an antibody in which the variable region is derived from a mouse antibody and the constant region is derived from a human antibody.

[0065] In some embodiments, the antibodies provided herein can be of any isotype. As used herein, "isotype" refers to an antibody class encoded by a heavy chain constant region gene (e.g., IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE). In some embodiments, the antibodies provided herein are isotype antibodies of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, or IgE.

[0066] The “Fc region” (crystallizable fragment region), “Fc domain”, or simply “Fc” refers to the C-terminal region of the heavy chain of an antibody that mediates the binding of immunoglobulins to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells) or to the first component (C1q) of the classical complement system. Therefore, the Fc region comprises the constant region of the antibody, excluding the first constant region immunoglobulin domain (e.g., CH1 or CL). In IgG, IgA, and IgD antibody isotypes, the Fc region comprises two identical protein fragments derived from the second (C1q) component of the two heavy chains of the antibody. H2 ) and the third (C H3 Constant structural domains; the IgM and IgE Fc regions contain three heavy chain constant structural domains (C1, C2, ..., C3, ..., C4, ..., C5, ..., C6, ..., C7, ..., C8, ..., C9 ... H Domains 2-4). For IgG, the Fc region contains immunoglobulin domains Cγ2 and Cγ3, as well as a hinge between Cγ1 and Cγ2. Although the boundaries of the Fc region of the immunoglobulin heavy chain may vary, the human IgG heavy chain Fc region is generally defined as extending from an amino acid residue at C226 or P230 (or an amino acid between these two) to the carboxyl terminus of the heavy chain, where numbering is based on the EU index in Kabat. The C... H2 The domain extends from approximately amino acid position 231 to approximately amino acid position 340, while C H3 The structural domain is located in C within the Fc region. H2 The C-terminal side of the domain extends from approximately amino acid 341 to approximately amino acid 447 of IgG. As used herein, the Fc region can be the native sequence Fc, including any allotype, or variant Fc (e.g., a non-naturally occurring Fc). Fc can also refer to this region alone or in the context of a protein polypeptide containing the Fc, such as "binding protein containing the Fc region," also known as "Fc fusion protein" (e.g., antibody or immunoadhesin).

[0067] A “natural sequence Fc region” or “natural sequence Fc” contains an amino acid sequence identical to that of an Fc region found in nature. Natural sequence human Fc regions include the natural sequence human IgG1 Fc region; the natural sequence human IgG2 Fc region; the natural sequence human IgG3 Fc region; and the natural sequence human IgG4 Fc region, as well as their naturally occurring variants. Natural sequence Fc includes various allotypes of Fc (see, for example, Jefferis et al. (2009) mAbs 1:1).

[0068] The term "hinge," "hinge domain," "hinge region," or "antibody hinge region" refers to the structural domain that connects the CH1 domain to the CH2 domain within the heavy chain constant region, including the upper, middle, and lower portions of the hinge (Roux et al., J. Immunol. 1998, 161:4083). The hinge provides varying degrees of flexibility between the antibody binding region and the effector region, and also provides sites for intermolecular disulfide bonds between the two heavy chain constant regions. As used herein, for all IgG isotypes, the hinge begins at Glu216 and ends at Gly237 (Roux et al., 1998, J Immunol 161:4083).

[0069] The term "hinge" includes wild-type hinges and their variants (e.g., non-naturally occurring hinges or modified hinges). For example, the term "IgG2 hinge" includes wild-type IgG2 hinges and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or up to 5, 4, 3, 2 or 1 mutation (e.g., substitution, deletion or addition). Exemplary IgG2 hinge variants include IgG2 hinges in which 1, 2, 3 or all 4 cysteine ​​residues (C219, C220, C226 and C229) are changed to another amino acid. In one specific embodiment, IgG2 contains a C219S substitution. In some embodiments, the hinge is a heterozygous hinge comprising sequences from at least two isotypes. For example, the hinge may comprise an upper hinge, middle hinge or lower hinge from one isotype and the remainder of the hinge from one or more other isotypes. For example, the hinge can be an IgG2 / IgG1 hinge and can include, for example, an upper and middle hinge of IgG2 and a lower hinge of IgG1. The hinge may or may not have effector functionality. For example, the lower hinge of wild-type IgG1 provides effector functionality.

[0070] The term "CH1 domain" refers to the heavy-chain constant region that connects a variable domain to a hinge in the heavy-chain constant domain. As used herein, the CH1 domain begins at A118 and ends at V215. The term "CH1 domain" includes wild-type CH1 domains and their variants (e.g., non-naturally occurring CH1 domains or modified CH1 domains). For example, the term "CH1 domain" includes wild-type CH1 domains and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or up to 5, 4, 3, 2 or 1 mutation (e.g., substitution, deletion or addition). Exemplary CH1 domains include mutated CH1 domains that modify the biological activity of an antibody, such as ADCC, CDC or half-life. This document provides modifications to the CH1 domain that affect the biological activity of antibodies.

[0071] The term "CH2 domain" refers to the heavy chain constant region that connects the hinge to the CH3 domain within the heavy chain constant domain. As used herein, the CH2 domain begins at P238 and ends at K340. The term "CH2 domain" includes wild-type CH2 domains and their variants (e.g., non-naturally occurring CH2 domains or modified CH2 domains). For example, the term "CH2 domain" includes wild-type CH2 domains and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or up to 5, 4, 3, 2 or 1 mutation (e.g., substitution, deletion or addition). Exemplary CH2 domains include mutated CH2 domains that modify the biological activity of the antibody, such as ADCC, CDC, or half-life. In some embodiments, the CH2 domain contains the substitution A330S / P331S, which reduces effector function. Other modifications to the CH2 domain that affect the biological activity of the antibody are provided herein.

[0072] The term "CH3 domain" refers to the C-terminus of the CH2 domain located within the heavy chain constant region. As used herein, the CH3 domain begins at G341 and ends at K447. The term "CH3 domain" includes wild-type CH3 domains and their variants (e.g., non-naturally occurring CH3 domains or modified CH3 domains). For example, the term "CH3 domain" includes wild-type CH3 domains and variants having 1, 2, 3, 4, 5, 1-3, 1-5, 3-5 and / or up to 5, 4, 3, 2 or 1 mutation (e.g., substitution, deletion or addition). Exemplary CH3 domains include mutated CH3 domains that modify the biological activity of an antibody, such as ADCC, CDC or half-life. This document provides modifications to the CH3 domain that affect the biological activity of antibodies.

[0073] The term "epitope" or "antigenic determinant" refers to a site on an antigen (e.g., ENPP1) that is specifically bound to an immunoglobulin or antibody. Epitopes can be formed from consecutive amino acids (typically linear epitopes) or from discontinuous amino acids juxtaposed through the ternary folding of a protein (typically conformational epitopes). Epitopes formed from consecutive amino acids are generally preserved upon exposure to denaturing solvents, but not always, while epitopes formed from ternary folds are generally lost upon treatment with denaturing solvents. Epitopes typically contain at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids with a unique spatial conformation. Methods for determining epitopes bound to a given antibody (i.e., epitope mapping) are well known in the art and include, for example, immunoblotting and immunoprecipitation assays, in which the reactivity of overlapping or consecutive peptides (e.g., ENPP1) with a given antibody (e.g., anti-ENPP1 antibody) is tested. Methods for determining the spatial conformation of epitopes include techniques in the art and described herein, such as X-ray crystallography, 2D nuclear magnetic resonance, and HDX-MS (see, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, edited by GEMorris, (1996)).

[0074] The term “binding to the same epitope” when referring to two or more antibodies means that the antibody binds to the same segment of amino acid residues, as determined by a given method. Techniques used to determine whether an antibody binds to the “same ENPP1 epitope” as described herein include, for example, epitope mapping methods, such as X-ray analysis of antigen:antibody complex crystals, which provides epitopes at atomic resolution, and hydrogen / deuterium exchange mass spectrometry (HDX-MS). Other methods monitor the binding of antibodies to antigen fragments or mutant variations of antigens, where loss of binding due to modification of amino acid residues within the antigen sequence is generally considered an indicator of epitope components. Furthermore, computational combinatorial methods for epitope mapping can be used. These methods rely on the ability of the antibody of interest to affinity-isolate specific short peptides from a combinatorial phage display peptide library. Antibodies with the same VH and VL or the same CDR1, CDR2, and CDR3 sequences are expected to bind to the same epitope.

[0075] In some embodiments, this document provides antibodies that compete with 12-JA-A, 14-O17-A, and / or 5-H7-A for antigen binding. An antibody that “competes with another antibody for binding to an antigen” refers to an antibody that inhibits (partially or completely) the binding of another antibody to the target protein. Whether two antibodies compete with each other for binding to the target, i.e., whether one antibody inhibits the binding of the other antibody to the target, and to what extent, can be determined using known competition experiments. In some embodiments, one antibody competes with another antibody for binding to the target and inhibits the binding of the other antibody to the target by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. The level of inhibition or competition can vary depending on which antibody is a “blocking antibody” (i.e., a cold antibody that is first incubated with the target). Competitive assays can be performed, for example, as described in Ed Harlow and David Lane, Cold Spring Harb Protoc; 2006; doi:10.1101 / pdb.prot4277 or Chapter 11 of “Using Antibodies,” edited by Ed Harlow and David Lane, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA 1999. The competitive antibody binds to the same epitope, overlapping epitope, or adjacent epitope (e.g., as confirmed by steric hindrance).

[0076] Other competitive binding assays include: solid-phase direct or indirect radioimmunoassay (RIA), solid-phase direct or indirect enzyme immunoassay (EIA), sandwich competitive assay (see Stahli et al., Methods in Enzymology 9:242 (1983)); solid-phase direct biotin-avidin EIA (see Kirkland et al., J. Immunol. 137:3614 (1986)); solid-phase direct labeling assay, solid-phase direct labeling sandwich assay (see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor). Press (1988)); solid-phase direct labeling RIA using I-125 labeling (see Morel et al., Mol. Immunol. 25(1):7(1988)); solid-phase direct biotin-avidin EIA (Cheung et al., Virology 176:546(1990)); and direct labeling RIA (Moldenhauer et al., Scand. J. Immunol. 32:77(1990)).

[0077] As used herein, the terms “specific binding,” “selective binding,” “selectively binding,” and “specific binding” refer to the binding of an antibody to an epitope on a predetermined antigen. Typically, the antibody (i) binds to an epitope at a concentration of approximately less than 10-1. -7 M such as approximately less than 10 - 8 M, 10 -9 M or 10 -10 (i) Binding with an equilibrium dissociation constant (KD) of M or even smaller, as determined in a BIACORE 2000 instrument using a predetermined antigen as the analyte and an antibody as the ligand by, for example, surface plasmon resonance (SPR) technology, or Scatchard analysis of antibody binding to antigen-positive cells, and (ii) binding to the predetermined antigen with an affinity at least twice that of binding to nonspecific antigens other than the predetermined antigen or closely related antigens (e.g., BSA, casein).

[0078] In some respects, this article provides nucleic acid molecules encoding the antibodies provided herein. As used herein, the term "nucleic acid molecule" is intended to include both DNA and RNA molecules. Nucleic acid molecules can be single-stranded or double-stranded and can be cDNA.

[0079] Also provided are “conserved sequence modifications” of the sequences shown herein, for example, those listed in Tables 1-6, namely, nucleotide and amino acid sequence modifications that do not eliminate the binding of antibodies to antigens encoded by nucleotide sequences or containing amino acid sequences. Such conserved sequence modifications include conserved nucleotide and amino acid substitutions, as well as nucleotide and amino acid additions and deletions. For example, modifications can be introduced into the sequence using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conserved amino acid substitutions include amino acid substitutions in which amino acid residues are replaced by amino acid residues having similar side chains. Families of amino acid residues having similar side chains are already defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, the predicted non-essential amino acid residues in anti-ENPP1 antibodies are preferably replaced by another amino acid residue from the same side chain family. Methods for identifying conserved substitutions of nucleotides and amino acids that do not eliminate antigen binding are well known in the art (see, for example, Brummell et al., Biochem. 32:1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10):879-884 (1999); and Burks et al. Proc. Natl. Acad. Sci. USA 94:412-417 (1997)).

[0080] In some embodiments, this document provides nucleic acid molecules that are substantially homologous to the sequences provided herein. For nucleic acids, the term "substantially homologous" means that two nucleic acids or their designated sequences are identical at optimal alignment and comparison, having appropriate nucleotide insertions or deletions in at least about 80% of the nucleotides, typically at least about 90% to 95%, and more preferably at least about 98% to 99.5% of the nucleotides. Alternatively, substantial homology exists when the segment hybridizes with the complementary strand of the strand under selective hybridization conditions.

[0081] In some embodiments, antibodies having heavy and / or light chains substantially homologous to the sequences provided herein are provided. For peptides, the term “substantially homologous” means that two peptides or their designated sequences are identical at optimal alignment and comparison, having appropriate amino acid insertions or deletions in at least about 80% of amino acids, typically at least about 90% to 95%, and more preferably at least about 98% to 99.5% of amino acids.

[0082] Considering the number of gaps and the length of each gap that need to be introduced to achieve the best alignment of the two sequences, the percentage of identity between the two sequences is a function of the number of common positions shared by the sequences (i.e., homology % = number of common positions / total number of positions × 100). The comparison of sequences and the determination of the percentage of identity between the two sequences can be accomplished using mathematical algorithms, as described in the following non-limiting examples.

[0083] The percentage of identity between two nucleotide sequences can be determined using the GAP procedure in the GCG software package (web address gcg.com), using the NWSgapdna.CMP matrix and vacancy weights of 40, 50, 60, 70, or 80 and length weights of 1, 2, 3, 4, 5, or 6. The percentage of identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-17 (1989)) (incorporated into the ALIGN procedure (version 2.0)), using the PAM120 weighted residue table, a vacancy length penalty of 12, and a vacancy penalty of 4. Furthermore, the percentage of identity between two amino acid sequences can be determined using the Needleman and Wunsch (J.Mol.Biol.(48):444-453(1970)) algorithm (which has been incorporated into the GAP program in the GCG software package (http: / / www.gcg.com)) using a Blossum 62 matrix or a PAM250 matrix, with vacancy weights of 16, 14, 12, 10, 8, 6 or 4, and length weights of 1, 2, 3, 4, 5 or 6.

[0084] In some embodiments, this document provides vectors encoding the heavy and / or light chains of the antibodies provided herein. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting other nucleic acids to which it is linked. One class of vectors is the "plasmid," which refers to a circular double-stranded DNA loop in which an additional DNA segment can be linked. Another class of vectors is the viral vector, in which an additional DNA segment can be linked to a viral genome. Some vectors are capable of autonomous replication in the host cell to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and attachable mammalian vectors). Other vectors (e.g., non-attached mammalian vectors) can integrate into the host cell's genome after introduction into the host cell, thereby replicating along with the host genome. Furthermore, some vectors are capable of directing the expression of genes operatively linked to them. Such vectors are referred to herein as "recombinant expression vectors" or simply "expression vectors." Typically, expression vectors useful in recombinant DNA technology are usually in plasmid form. In this specification, "plasmid" and "vector" are used interchangeably because plasmids are the most commonly used form of vector. However, other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), also exist, which have the same function.

[0085] In some embodiments, this document provides a host cell comprising the nucleic acid molecules disclosed herein. As used herein, the term "recombinant host cell" (or simply "host cell") is intended to refer to a cell containing nucleic acids not naturally present in cells, and may be a cell into which a recombinant expression vector has been introduced. It should be understood that such terms refer not only to a specific host cell but also to progeny cells of such cells. Certain modifications may occur during successive passages due to mutations or environmental influences, and thus such progeny cells may not be substantially equivalent to the parent cells, but they are still included within the scope of the term "host cell" as used herein.

[0086] In some respects, this document provides a method for treating myocardial infarction, which is performed by administering the antibody and / or pharmaceutical composition provided herein to a subject. As used herein, “administration” means the physical introduction of a composition comprising a therapeutic agent into a subject using any of the various methods and delivery systems known to those skilled in the art. Preferred routes of administration of the antibodies described herein include intravenous, intraperitoneal, intramuscular, subcutaneous, spinal, or other parenteral administration routes, such as by injection or infusion. The phrase “parenteral administration” as used herein refers to a method of administration other than enteral and local administration, typically by injection, and includes, but is not limited to, intravenous, intraperitoneal, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intracardiac, intradermal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, spinal, epidural, and intrasternal injections and infusions, as well as in vivo electroporation. Alternatively, the antibodies described herein may be administered via non-parenteral routes, such as local, epidermal, or mucosal administration routes, for example, intranasal, oral, vaginal, rectal, sublingual, or topical administration routes. Application may also be performed, for example, once, multiple times, and / or over one or more extended time periods.

[0087] In some implementations, the methods provided herein treat a subject for myocardial infarction. As used herein, the terms "treat," "treating," and "treatment" refer to any type of intervention or procedure performed, or the administration of an active agent to a subject, with the aim of reversing, alleviating, improving, inhibiting, or slowing the progression, development, severity, or recurrence of disease-related symptoms, complications, signs, or biochemical indicators. Treatment may be directed at a subject with the disease or a subject without the disease (e.g., for prevention).

[0088] In some implementations, an effective dose of the antibody provided herein is administered to the treated subject. The term "effective dose" or "effective amount" is defined as an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutic effective amount" or "therapeutic effective dose" of a drug or therapeutic agent is any amount of a drug, when used alone or in combination with another therapeutic agent, that demonstrates promotion of disease remission by a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of disease, or prevention of damage or disability resulting from disease suffering. A therapeutic effective amount or dose of a drug includes a "preventive effective amount" or "preventive effective dose," which is any amount of a drug, when administered alone or in combination with another therapeutic agent to a subject at risk of developing the disease or experiencing a relapse of the disease, that inhibits the development or recurrence of the disease. The ability of a therapeutic agent to promote disease remission or inhibit the development or recurrence of the disease can be assessed using a variety of methods known to those in the art, such as in human subjects during clinical trials, in animal model systems predicting efficacy in humans, or by measuring the activity of the agent in an in vitro assay.

[0089] As used herein, the term "subject" includes any human or non-human animal. For example, the methods and compositions described herein can be used to treat a subject suffering from myocardial infarction. In some embodiments provided herein, the subject is a human. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, including non-human primates, sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0090] The various aspects described herein are further described in detail in the following sections.

[0091] Example

[0092] ENPP1 in cardiac fibroblasts mediates the cleavage of ATP into AMP and PPi. This ATP cleavage into AMP and PPi signals muscle cells, which subsequently release small molecules / metabolites that are pro-inflammatory and induce cell death in various non-muscle cells, including fibroblasts, macrophages, endothelial cells, and smooth muscle cells. Figure 1 Genetically induced loss of fibroblast-specific ENPP1 significantly improves post-infarction wound healing, reduces inflammation, weakens remodeling, and significantly improves cardiac function. ENPP1 inhibition increases cardiac wound healing after myocardial infarction, thereby reducing inflammation and better protecting post-injury cardiac function. This article discloses monoclonal antibodies that specifically target and inhibit ENPP1, and methods for using such antibodies as therapeutic agents for treating myocardial infarction, promoting cardiac wound healing, and preventing heart failure.

[0093] Example 1: Induction of ENPP1 expression in the heart after myocardial infarction.

[0094] Wild-type male and female mice were subjected to myocardial infarction (permanent ligation), and their hearts were harvested 7 days post-injury for qPCR and Western blotting to determine ENPP1 expression. Figure 2A and 2B Compared to undamaged areas of the heart in animals with the same heart or those subjected to sham injury, ENPP1 expression was increased in the damaged areas of the heart. Western blot analysis of the damaged heart samples showed a significant increase in ENPP1 expression. Figure 2B Immunostaining of ENPP1 showed a significant increase in ENPP1 expression in areas of myocardial injury. Figure 2C Therefore, these observations suggest that ENPP1 is induced in the injured region following ischemic cardiac injury in mice. Then, ENPP1 mutant mice lacking ENPP1 activity (ENPP1asj / asj mice) were subjected to ischemic cardiac injury, and significantly reduced ATP hydrolysis in the infarcted tissue was observed in the mutant mice (p<0.05, n=3), indicating that ENPP1 is a major mediator of extracellular ATP hydrolysis (Albright et al. 2015).

[0095] Example 2: ENPP1 is mainly expressed by cardiac fibroblasts in the damaged areas of the heart.

[0096] Wild-type male and female mice were subjected to ischemic heart injury. Hearts were harvested 7 days post-injury and subjected to dual immunostaining and flow cytometry using a suite of markers for fibroblasts, endothelial cells, smooth muscle cells, and other cardiomyocytes. Col1a2CreERT:R26R tdTomato Mice and TCF21MerCre Mer:R26R tdTomato Mice (in which fibroblasts were genetically labeled with the tdtomato fluorophore). These mice have been used to label cardiac fibroblasts, and these mice were given tamoxifen 10 days before injury to activate Cre and label cardiac fibroblasts (Acharya et al. 2012, Ubil et al. 2014). It has been found that cardiac fibroblasts are the main source of ENPP1 expression in injured hearts ( Figure 3Immunostaining revealed no ENPP1 expression in myocytes, a finding confirmed by cardiac digestion and qPCR and Western blotting of myocytes (ENPP1 expression was 1000-fold higher in fibroblasts; data not shown). Flow cytometry also indicated that cardiac fibroblasts, identified by MEFSK4 and Thy1.2 expression, comprised 80-90% of cells expressing ENPP1. Finally, single-cell sequencing of non-myoblasts in the injured heart 7 days after ischemic injury showed that ENPP1 expression was primarily observed in fibroblasts. ENPP1 was also expressed to some extent in macrophages, endothelial cells, etc. Figure 4A and 4B ).

[0097] Example 3: ENPP1 is the main enzyme that hydrolyzes extracellular ATP after cardiac injury.

[0098] RNA was sequenced from both damaged and undamaged portions of the heart, and expression changes of all reported mammalian exonucleases and other members of the ENPP1 family were analyzed. Figure 5A ).like Figure 5A As shown, ENPP1 is the only exonuclease whose gene expression was significantly increased at all time points studied compared to the undamaged state. To determine the physiological significance of ENPP1 in extracellular ATP hydrolysis compared to other known exonucleases, ENPP1 mutant mice (ENPP1...) were... asj / asj ) Suffering from ischemic heart injury. ENPP1 asj / asj Mice have been well-described in the literature, and the enzyme possesses a single amino acid substitution in its extracellular catalytic domain, rendering the catalytic domain inactive (Li et al. 2013). This leads to the ENPP1... asj / asj Mice were subjected to ischemic cardiac injury, and ATP hydrolytic activity in the infarcted tissue was measured 7 days post-injury (Albright et al. 2015). Figure 5B In the study, ATP hydrolysis activity was significantly reduced in ENPP1 mutant mice, thus confirming that ENPP1 is the main enzyme mediating ATP hydrolysis in infarcted hearts.

[0099] Example 4: ENPP1 is pro-inflammatory and can cause the release of inflammatory molecules from cardiomyocytes.

[0100] Ischemic cardiac injury leads to the release of extracellular ATP (secondary to the release of intracellular contents from dying cardiomyocytes and increased transmembrane transport / leakage) (Burnstock 2017). When cardiac fibroblasts overexpressing ENPP1 are co-cultured with cardiomyocytes, the addition of ATP induces severe cell death in cardiac fibroblasts, but this does not occur when cardiac fibroblasts overexpressing ENPP1 are grown in the absence of cardiomyocytes. Figure 6A and 6BTo investigate this more rigorously, conditioned medium experiments were performed, in which conditioned medium collected after treatment of cardiomyocytes with recombinant ENPP1 protein and ATP was added to smooth muscle cells of endothelial cells and fibroblasts grown in separate culture dishes. Severe cell death was observed in resident cells treated with conditioned medium derived from ENPP1 and ATP-treated cardiomyocytes. Figure 7 ENPP1 / ATP induces the release of pro-apoptotic molecules that induce cell death and inflammation by exerting pro-apoptotic death in macrophages, endothelial cells, and smooth muscle cells. Extensive metabolic expression profiling was performed using LC / MS (liquid chromatography / mass spectrometry), and ceramides, known to have pro-inflammatory effects, were preliminarily identified as a pro-inflammatory candidate. These in vitro experiments provide in-depth insights into the potential role of ENPP1 in regulating inflammation and remodeling in the damaged heart.

[0101] Example 5: Genetic evidence suggests that ENPP1 plays a crucial role in cardiac repair after myocardial infarction and is The determining factors of functional outcome.

[0102] A hybrid mouse diversity group comprising approximately 100 inbred and recombinant mouse strains was used to identify key genes regulating fibroblast activation (Rau et al. 2017, Yu et al. 2018). The hybrid mouse diversity group, comprising 100 inbred and recombinant mice, was administered isoproterenol via continuous subcutaneous infusion for 3 weeks. Isoproterenol induces cardiomyocyte proliferation and interstitial fibrosis, and isoproterenol is known to impair cardiac diastolic function and reduce myocardial compliance (Wang et al. 2016). Animals were subjected to weekly echocardiography to measure multiple cardiac traits (including those affecting cardiac compliance), and hearts were harvested to determine the progression of myocyte proliferation and interstitial fibrosis. Gene expression changes were analyzed for each mouse strain, and a mapping method identified ENPP1 as the highest “hit” closely associated with adverse outcomes (Rau et al. 2015). First, natural changes in ENPP1 expression were observed in 100 strains within the HMDP, particularly after isoproterenol infusion. Figure 8 Secondly, increased ENPP1 expression was strongly correlated with poor remodeling and cardiac outcomes. Mouse strains exhibiting increased ENPP1 expression, increased myocyte proliferation, and increased interstitial fibrosis burden in the heart showed ventricular dilatation and worsened compliance; these phenotypes are consistent with poor ventricular remodeling following isoproterenol-induced cardiac injury. Figure 9 This systematic genetic approach, utilizing mapping methods and natural variation in genes within a population, identified ENPP1 as a key module regulating cardiac fibrosis and proliferation following isoproterenol-induced cardiac injury. Figure 10(Rau et al. 2017). Therefore, these observations suggest that ENPP1 is a powerful predictor of cardiac remodeling and function after injury.

[0103] Example 6: Genetic suppression of ENPP1 leads to preservation of cardiac function after injury.

[0104] Conditional deletion of ENPP1 in cardiac fibroblasts is generated by crossing mice with the fibroblast cre driver (Col1a2CreERT) with ENPP1-anchored mice to produce ENPP1 CKOs (conditional knockout mice). Conditional deletion of ENPP1 leads to significant preservation of cardiac function and reduced adverse cardiac remodeling after injury. Figure 11A-11D Histological analysis and echocardiographic findings showed consistent functional improvements. Compared to Cre(-) littermates, ENPP1CKO mice exhibited significantly reduced fibrosis and thicker scarring. Figure 12A and 12B Scar thinning, followed by wall remodeling and ventricular dilatation, are common phenotypes secondary to poor cardiac remodeling; therefore, these data suggest that genetic deletion of ENPP1 is associated with significantly better cardiac remodeling after myocardial infarction. In ENPP1 CKO animals, the fibrotic area in the mid-ventricle was significantly reduced by 50% ( Figure 12C Then, on histological sections, the severity of fibrosis in all animals that had experienced cardiac injury was graded as severe (>40%), moderate (20-40%), and mild (<20%). Consistent with the functional data, the proportion of animals exhibiting a severe fibrotic repair response (a substitute for poor ventricular remodeling) was significantly reduced in the ENPP1 CKO group. Figure 12D Single-cell RNA sequencing was performed on the hearts of ENPP1 CKO mice and Cre(-) littermates. Decreased immune and fibrosis markers were found, along with increased angiogenesis, indicating an overall shift in wound healing from a more pro-fibrotic to a more pro-repairing mechanism. Figures 13A-13C These in vivo gene deletion experiments provide a strong underlying principle for using ENPP1 monoclonal antibodies (mAbs) to attenuate adverse remodeling after myocardial infarction.

[0105] Example 7: Pharmacological inhibition of ENPP1 after cardiac injury leads to better preservation of cardiac function after injury.

[0106] Administration of myricetin (a small molecule inhibitor of ENPP1) within the first 14 days after ischemic heart injury was associated with significant post-infarction beneficial effects and a reduction in cardiac function decline. Figures 14A-14D Therefore, these data provide compelling evidence that inhibition of ENPP1 after cardiac injury is a therapeutic strategy to prevent the development of heart failure.

[0107] Example 8: Synthesis and preparation of a monoclonal antibody against ENPP1 for use in a preclinical model of myocardial infarction. Applications in science.

[0108] The antibody against ENPP1 was generated targeting the human recombinant protein and showed significant cross-reactivity with mouse ENPP1, as this protein is largely conserved in most species. The antibody was produced in collaboration with Lake Pharma using standard techniques for monoclonal antibody (mAb) production, including immunization, collection and testing of hybridoma supernatant, hybridoma cloning, and further confirmation via multiple affinity assays, followed by recombinant selection and production of the ENPP1 mAb. Several clones were obtained, and the 12-J-4 antibody was observed to have the most potent binding and inhibitory effect on ENPP1 activity. Figure 15 Selected hybridomas have been sequenced, and recombinant monoclonal antibodies have been generated in CHO cell lines and characterized by electrophoresis and mass spectrometry. The heavy chain has a molecular weight of approximately 48 kDa, and the light chain has a molecular weight of 24 kDa. The isotype is IgG1κ( Figure 16 It can effectively inhibit ENPP1 even at nanomolar concentrations. Figure 17 ).

[0109] Then, in vitro functional assays were used to collect functional data for ENPP1 mAb. As illustrated in the examples above, ENPP1 expression induces cardiomyocytes to release pro-inflammatory and pro-apoptotic molecules, which induce cell death in many cell types at the site of injury. To test ENPP1 mAb, in vitro functional assays were performed in which cardiac fibroblasts were co-incubated with cardiomyocytes, followed by the addition of a mediator, recombinant ENPP1 and ATP and IgG, or recombinant ENPP1 and ATP and 12-J-4 ENPP1 mAb. The addition of recombinant ENPP1 and ATP induced cell death, but the concomitant addition of ENPP1 mAb (12-J-4 clone) significantly eliminated cell death. Figure 18A and 18B ).

[0110] Incorporate by reference

[0111] All publications, patents, patent applications, and serial number referenced herein are incorporated herein by reference in their entirety, as if each individual publication, patent, or patent application were specifically and separately incorporated by reference. In case of any conflict, this application (including any definitions herein) shall prevail.

[0112] Equivalent solution

[0113] Those skilled in the art will recognize or be able to determine many equivalents of the specific embodiments of the invention described herein using only conventional testing. Such equivalents are intended to be covered by the following claims. sequence list <110> University of California Board of Trustees <120> Inhibitory anti-ENPP1 antibody <130> UCH-23201 <140> 17 / 306,544 <141> 2021-05-03 <150> 63 / 019,773 <151> 2020-05-04 <160> 30 <170> PatentIn version 3.5 <210> 1 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 1 Arg Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn 1 5 10 <210> 2 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 2 His Lys Thr Arg Leu His Ser 1 5 <210> 3 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 3 Gln Gln Gly Asn Met Leu Pro Trp Thr 1 5 <210> 4 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 4 Gly Phe Thr Phe Ser Ser Tyr 1 5 <210> 5 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 5 Ser Gly Gly Gly Gly Asn 1 5 <210> 6 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 6 Arg His Tyr Gly Ser Ser Pro Tyr Ala Met Asp Tyr 1 5 10 <210> 7 <211> 121 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 7 Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Thr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45 Ala Thr Ile Ser Gly Gly Gly Gly Asn Thr Tyr Tyr Pro Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Arg Arg His Tyr Gly Ser Ser Pro Tyr Ala Met Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 8 <211> 363 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic polynucleotides <400> 8 gaagtgatgc tggtggagtc tgggggaggc ttagtgaagc ctggagggtc cctgaaactc 60 tcctgtgttg cctctggatt cactttcagt tcctatacca tgtcttgggt tcgccagact 120 ccggagaaga ggctggagtg ggtcgcaacc attagtggtg gtggtggtaa cacctactat 180 ccagacagtg tgaagggtcg attcaccatc tccagagaca atgccaagaa caccctgtac 240 ctgcaaatga gcagtctgag gtctgaggac acggccttat attactgtgc aagacgacac 300 tacggtagta gcccctatgc tatggactac tggggtcaag gaacctcagt caccgtctcc 360 tca 363 <210> 9 <211> 107 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 9 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr His Lys Thr Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Met Leu Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 10 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic polynucleotides <400> 10 gatatccaga tgacacagac tacatcctcc ctgtctgcct ctctgggaga cagagtcacc 60 atcagttgca gggcaagtca ggacattagt aattatttaa actggtatca gcagaaacca 120 gatggaactg ttaaactcct gatctaccac aaaacaagat tacactcagg agtcccatca 180 aggttcagtg gcagtgggtc tggaacagat tattctctca ccattagcaa cctggaacaa 240 gaagatattg ccacttacttttgccaacag ggtaatatgc ttccgtggac gttcggtgga 300 ggcaccaagc tggaaatcaa a 321 <210> 11 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 11 Arg Ala Ser Gln Ser Ile Ser Lys Tyr Leu His 1 5 10 <210> 12 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 12 Tyr Ile Ser Gln Ser Ile Ser 1 5 <210> 13 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 13 Gln Gln Ser Tyr Ser Trp Pro Trp Thr 1 5 <210> 14 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 14 Gly Tyr Thr Phe Thr Ser Tyr 1 5 <210> 15 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 15 Asn Pro Tyr Asn Asp Gly 1 5 <210> 16 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 16 Arg Gly Tyr Tyr Asp Tyr Asp Gly Leu Asp Tyr 1 5 10 <210> 17 <211> 120 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 17 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Val Met His Trp Val Lys Lys Lys Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn Glu Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Val Arg Arg Gly Tyr Tyr Asp Tyr Asp Gly Leu Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Thr Leu Thr Val Ser Ser 115 120 <210> 18 <211> 360 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic polynucleotides <400> 18 gaggtccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg 60 tcctgcaagg cttctggata cacattcact agttatgtta tgcactgggt gaagaagaag 120 cctgggcagg gccttgagtg gattggatat attaatcctt acaatgatgg tactaaatat 180 aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcgtccag cacagcctac 240 atggagctca gcagcctgac ctctgaggac tctgcggtct attattgtgt cagaagaggc 300 tactatgatt acgacggact tgactactgg ggccaaggca ccactctcac agtctcctca 360 <210> 19 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 19 Asp Ile Val Leu Thr Gln Ser Pro Val Thr Leu Ser Val Ile Pro Gly 1 5 10 15 Asp Arg Val Ser Leu Ser Cys Arg Ala Ser Gln Ser Ile Ser Lys Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Ser His Glu Ser Pro Arg Leu Leu Ile 35 40 45 Lys Tyr Ile Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile Asn Ser Val Glu Thr 65 70 75 80 Glu Asp Phe Gly Met Tyr Phe Cys Gln Gln Ser Tyr Ser Trp Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 20 <211> 321 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic polynucleotides <400> 20 gatattgtgc taactcagtc tccagtgacc ctgtctgtga ttccaggaga tagagtcagt 60 ctttcctgca gggccagtca aagtattagc aagtacctac actggtatca acaaaaatca 120 catgagtctc caaggcttct catcaagtat atttcccagt ccatctctgg gatcccctcc 180 aggttcagtg gcagtggatc agggacagat ttcactctca atatcaacag tgtggagact 240 gaagattttg gaatgtattt ctgtcaacag agttacagct ggccttggac gttcggtgga 300 ggcaccaagc tggaaatcaa a 321 <210> twenty one <211> 15 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty one Arg Ala Ser Glu Ser Val Asp Ser Tyr Gly Asn Ser Phe Met His 1 5 10 15 <210> twenty two <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty two Arg Ala Ser Asn Leu Glu Ser 1 5 <210> twenty three <211> 9 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty three Gln Gln Ser Asn Glu Asp Pro Leu Thr 1 5 <210> twenty four <211> 7 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> twenty four Gly Tyr Thr Phe Thr Asp Tyr 1 5 <210> 25 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 25 Ser Thr Tyr Ser Gly Asn 1 5 <210> 26 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 26 Ala Gly Tyr Tyr Ser Met Asp Tyr 1 5 <210> 27 <211> 117 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 27 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Arg Pro Gly Val 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Ala Met His Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile 35 40 45 Gly Ile Ile Ser Thr Tyr Ser Gly Asn Thr Asn Tyr Asp Gln Gln Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys 85 90 95 Ala Arg Ala Gly Tyr Tyr Ser Met Asp Tyr Trp Gly Gln Gly Thr Ser 100 105 110 Val Thr Val Ser Ser 115 <210> 28 <211> 351 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic polynucleotides <400> 28 caggtccagc tgcagcagtc tgggcctgag ctggtgaggc ctggggtctc agtgaagatt 60 tcctgcaagg gttccggcta cacattcact gattatgcta tgcactgggt gaagcagagt 120 catgcaaaga gtctagagtg gattggaatt attagtactt actctggtaa tacaaactac 180 gatcagcagt ttaagggcaa ggccacattg actgtagaca aatcctccag cacagcctat 240 atggaacttg ccagattgac atctgaggat tctgccatct attactgtgc aagagcgggc 300 tactattcta tggactactg gggtcaagga acctcagtca ccgtctcctc a 351 <210> 29 <211> 111 <212> PRT <213> Artificial sequence <220> <223> Description of artificial sequences: synthetic peptides <400> 29 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Ser Tyr 20 25 30 Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 Lys Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn 65 70 75 80 Pro Val Glu Ala Asp Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Asn 85 90 95 Glu Asp Pro Leu Thr Ile Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 110 <210> 30 <211> 333 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic polynucleotides <400> 30 gacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 60 atatcctgca gagccagtga aagtgttgat agttatggca atagttttat gcactggtac 120 caacagaaac caggacagcc acccaaactc ctcatctatc gtgcatccaa cctagaatct 180 gggatccctg ccaggttcag tggcagtggg tctaggacag acttcaccct caccattaat 240 cctgtggagg ctgatgatgt tgcaacctat tactgtcagc aaagtaatga ggatcctctc 300 acgatcggtg ctgggaccaa gctggagctg aaa 333

Claims

1. An antibody or an antigen-binding fragment thereof, said antibody or antigen-binding fragment comprising: a) A heavy chain comprising CDRH1 of SEQ ID NO: 4, CDRH2 of SEQ ID NO: 5, and CDRH3 of SEQ ID NO: 6; and b) A light chain comprising CDRL1 of SEQ ID NO: 1, CDRL2 of SEQ ID NO: 2, and CDRL3 of SEQ ID NO:

3. The antibody specifically binds to ENPP1.

2. The antibody of claim 1, wherein the antibody comprises: i) The heavy chain variable region sequence of SEQ ID NO: 7; and ii) The light chain variable region sequence of SEQ ID NO:

9.

3. The antibody or antigen-binding fragment thereof as described in any one of claims 1-2, wherein the antibody or antigen-binding fragment thereof is mouse, chimeric, or humanized.

4. The antibody or antigen-binding fragment thereof as claimed in claim 1, wherein the antibody or antigen-binding fragment thereof is a complete IgG isotype antibody.

5. The antibody or antigen-binding fragment thereof as claimed in claim 1, wherein the antigen-binding fragment is selected from Fv, Fab, F(ab')2), Fab', dsFv and scFv.

6. The antibody or antigen-binding fragment thereof as claimed in claim 1, wherein the antibody or antigen-binding fragment thereof inhibits ENPP1 activity.

7. A nucleic acid molecule, said nucleic acid molecule encoding a light chain variable region and a heavy chain variable region of an antibody as described in any one of claims 1-6.

8. The nucleic acid molecule of claim 7, wherein the sequence encoding the heavy chain variable region of the antibody is shown in SEQ ID NO:

8.

9. The nucleic acid molecule of claim 7, wherein the sequence encoding the light chain variable region of the antibody is shown in SEQ ID NO:

10.

10. A vector comprising a nucleic acid molecule as described in any one of claims 7-9.

11. A host cell, wherein the host cell: (a) Contains a nucleic acid molecule as described in any one of claims 7-9; (b) comprising the carrier as described in claim 10; and (c) Expressing the antibody or antigen-binding fragment thereof as described in any one of claims 1-6.

12. A method for generating an antibody or an antigen-binding fragment thereof, the method comprising the following steps: (i) Culturing the host cells as described in claim 11 to allow expression of the antibody or its antigen-binding fragment; (ii) Recover the expressed antibody or its antigen-binding fragment.

13. A pharmaceutical composition comprising an antibody or an antigen-binding fragment thereof as described in any one of claims 1-6.

14. Use of the antibody or antigen-binding fragment thereof as described in any one of claims 1-6 in the manufacture of a medicament for treating myocardial infarction.

Images