A recombinant antigen complex, its preparation and use

Abstract

This invention relates to the field of biotechnology, and more particularly to a recombinant antigen complex, its preparation method, and its applications. This recombinant antigen complex is a heterodimeric protein similar to its native state, formed from CFP-10 and ESAT-6 proteins. It overcomes the shortcomings of low expression levels or weak reactivity in traditional specific T-cell stimulation antigen preparation processes, simplifies the preparation process, and is suitable for cellular immune detection of tuberculosis infection.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a recombinant antigen complex, its preparation method, and its application. Background Technology

[0002] Diagnostic methods for Mycobacterium tuberculosis infection mainly include imaging, serology, bacterial culture, nucleic acid detection, and T-cell immune detection. The sensitivity and specificity of imaging and serological detection need to be improved. Bacterial culture is the gold standard for tuberculosis diagnosis, but the culture cycle is long and the positive rate is low.

[0003] T-cell immunoassay is a common method for detecting Mycobacterium tuberculosis. Its main principle is based on the fact that after primary infection, T lymphocytes mainly differentiate into effector T cells and memory T cells. When memory T cells are stimulated again by the same antigen presented by antigen-presenting cells (APCs), they can rapidly proliferate and secrete cytokines. Detection of these cytokines can indirectly determine whether an infection has occurred. Currently, there are two types of kits on the market: one, represented by T-SPOT, detects peripheral blood mononuclear cells (PBMCs); the other, produced by most manufacturers (Quanti-FERON Gold, Wantai, Antu Bio, etc.), detects whole blood cells. The core of T-cell immunoassay is the specific stimulating antigen. Currently, the main antigens used by various manufacturers are the tuberculosis-specific antigens Early Secretory Antigen Target-6 (ESAT-6) and Culture Filtrate Protein-10 (CFP-10), encoded by the RD1 region of the Mycobacterium tuberculosis genome. These two antigens are specific to Mycobacterium tuberculosis. T-spot and QFT use peptides as stimulating antigens, while domestic manufacturers such as Wantai and Antu use recombinant antigens. Recombinant stimulatory antibodies have significant advantages in tuberculosis-specific T lymphocyte immunoassay due to their low cost and comprehensive epitope coverage.

[0004] Factors affecting the sensitivity and specificity of stimulating antigens include protein purity, endotoxin content, and epitope exposure. Typically, the preparation method for specific stimulating antigens involves expressing, purifying, and removing endotoxins from ESAT-6 and CFP-10 separately. The purification cycle for a single antigen is close to two weeks. In addition, due to their small molecular weight, the expression levels of ESAT-6 and CFP-10 are also low, which brings considerable difficulty and cost to antigen preparation. Adding a fusion tag can significantly increase the expression level, but it also introduces non-specific factors. After antigen preparation, it is necessary to add the tag according to the specified ratio, making the operation more complex and batch-to-batch differences difficult to control. Some researchers have used chimeric antigens (fusion proteins) for preparation (Philip C. Hill, et al., 2005, CN103122033). However, chimeric antigens significantly alter the structure of the antigen, leading to low detection values ​​or missed detections in some cases. When Philip C. Hill compared the stimulatory effects of the CFP10-ESAT6 fusion protein and the peptide, out of 188 positive cases, 20 cases (10.6%) were detected by the peptide alone, and 27 cases (14.4%) were detected by the fusion protein alone. In our previous experiments, we also verified that the CFP10-ESAT6 fusion protein is difficult to achieve the reaction level of two separate antigens. This may be due to the loss of some detection epitopes caused by the fusion protein. In patent CN 103122033, in addition to ESAT6 and CFP10, the TB7.7 antigen was added as a supplement to the fusion protein, and no comparison verification with the separate antigens was performed. Furthermore, the main T cell epitopes at the N-terminus of the protein were altered.

[0005] ESAT-6 and CFP-10 can form a 1:1 tight complex (Brodin P. et al., 2005), which is related to T cell immune responses and virulence. Traditional stimulating antigen preparation processes often involve expressing, purifying, and using two antigens separately. In addition to the disadvantage of low expression levels, this process cannot form proteins with native conformations. Furthermore, due to the strong hydrophobicity of ESAT6, the protein is extremely unstable. Although fusion proteins can overcome the disadvantages of low expression levels and protein instability, they affect the display of some epitopes and the sensitivity cannot reach the level of single antigen combinations. Summary of the Invention

[0006] In view of this, the present invention provides a recombinant antigen complex, its preparation method, and its application. This antigen complex overcomes the shortcomings of low expression levels or weak reactivity in the preparation process of traditional specific T cell-stimulated antigens, and the preparation method is simple and suitable for cellular immune detection of tuberculosis infection.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] A recombinant antigen complex comprising CFP-10 protein or a heterodimer formed by CFP-10 protein and ESAT-6 protein; wherein the ESAT-6 protein is full-length or a truncated fragment thereof; and the CFP-10 protein is full-length or a truncated fragment thereof.

[0009] In some embodiments, the ESAT-6 protein is the full-length ESAT-6 protein, and its specific sequence is shown in SEQ ID NO:1. The CFP-10 protein is the full-length protein, and its amino acid sequence is shown in SEQ ID NO:2.

[0010] In this invention, the molar ratio of CFP-10 protein to ESAT-6 protein is 1:1. In some specific embodiments, the molar ratio of CFP-10 protein to ESAT-6 protein is 1:1.

[0011] The antibody composition of the present invention is obtained by prokaryotic expression and enzyme digestion of the precursor recombinant protein ESAT-6-CFP-10;

[0012] The precursor recombinant protein ESAT-6-CFP-10 comprises, from N-terminus to C-terminus, ESAT-6 protein and CFP-10 protein, which are linked by a cleavable linker peptide.

[0013] The amino acid sequence of the ESAT-6 protein is shown in SEQ ID NO:1; the amino acid sequence of the CFP-10 protein is shown in SEQ ID NO:2.

[0014] In this invention, the precursor recombinant protein ESAT-6-CFP-10 has no tag or amino acid at its N-terminus, but a purification tag is added to its C-terminus. The specific sequence of the precursor recombinant protein ESAT-6-CFP-10 is: ESAT-6 protein (SEQ ID NO:1) - linker peptide - CFP-10 protein (SEQ ID NO:2) - purification tag.

[0015] In some embodiments, the amino acid sequence of the linker peptide is as shown in SEQ ID NO:3: GLVPRGS.

[0016] This invention does not specifically limit the purification tag at the C-terminus of the precursor recombinant protein ESAT-6-CFP-10; any commonly used tag in the art is acceptable. In a specific embodiment of this invention, the purification tag is a 6×His tag located at the C-terminus of the CFP-10 protein.

[0017] The present invention also provides a nucleic acid encoding the precursor recombinant protein CFP-10-ESAT-6, the nucleotide sequence of which is shown in SEQ ID NO:4.

[0018] The present invention also provides a recombinant vector comprising the said nucleic acid.

[0019] This invention provides a method for preparing the antigen complex, comprising:

[0020] The recombinant expression vector was transformed into host cells to induce protein expression.

[0021] After lysing and purifying the cells, the cells were digested with a protease. The digested product was then incubated at 4°C for 12 hours to obtain the antigen complex.

[0022] In some implementations, after incubation, there are further purification steps to remove proteases and other impurities, and to remove endotoxins.

[0023] The present invention also provides the application of the antigen complex, the nucleic acid, the recombinant vector, or the antigen complex prepared by the method described herein in the preparation of products for detecting Mycobacterium binding or in the preparation of diagnostic products for diseases related to Mycobacterium tuberculosis infection.

[0024] This invention provides an antigen complex that combines the advantages of high expression of fusion proteins and high reactivity of individual antigens with the conformational characteristics of ESAT6 and CFP10 in their natural state. By specifically designing and preparing ESAT6 and CFP10 proteins, the preparation processes of the two antigens are integrated, combining protease digestion, incubation, and purification processes. Incubation induces a heterodimer structure between ESAT6 and CFP10, identical to their natural state. A single purification process yields a 1:1 antigen complex of ESAT6 and CFP10. Unlike previous tuberculosis stimulating antigen preparation processes, the antigen complex obtained in this invention is neither a chimeric antigen nor a simple mixture of two antigens, but rather exists as a 1:1 complex resembling a heterodimer in its natural state. This invention, through a special process, prepares a heterodimer antigen complex resembling its natural state, solving the sensitivity and specificity issues caused by incorrect ESAT6 and CFP10 fusion antigen structures, as well as the stability problems of single antigen mixtures. The stimulating antigen preparation method obtained in this invention significantly improves the efficiency and ease of application without reducing the effectiveness of the antigen. Attached Figure Description

[0025] Figure 1 The results of SDS-PAGE analysis of the prokaryotic recombinant chimeric antigen are shown.

[0026] Figure 2 The results are shown by SDS-PAGE analysis of the secondary purification after Ni column purification and enzyme digestion.

[0027] Figure 3 The results of SDS-PAGE analysis after passing through Ni, DEAE, and endotoxin affinity columns show that the purity reaches 100%.

[0028] Figure 4 The final HPLC analysis results show that the mixed antigen is a single peak between 17-45 kDa, which is an antigen in the form of a 1:1 complex. Detailed Implementation

[0029] This invention provides a recombinant antigen complex, its preparation method, and its application. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments; those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0030] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0031] The present invention will be further illustrated below with reference to the embodiments:

[0032] Example 1: Construction and Expression of Precursor Protein

[0033] a. Amplification of the target gene fragment

[0034] Using the ESAT-6 (SEQ ID NO:1) and CFP-10 (SEQ ID NO:2) genes of the Mycobacterium tuberculosis standard strain H37Rv as modules, the synthesized sequences and primers were synthesized by Shanghai Sangon Biotech.

[0035] Fragment 1, amplified from TB1-NF and TB12-r1, and fragment 2, amplified from TB12-f1 and TB2-RY, were recovered from the gel and used as templates to amplify the fusion gene of TB1-NF and TB2-RY. The resulting fragments were then digested with Nde I and Not I and loaded into the PET30a vector.

[0036] The primer sequences are as follows:

[0037] TB12-r1: TCGAACATCCCAGTGACG (SEQ ID NO: 5);

[0038] TB12-f1: CGTCACTGGGATGTTCGCAGGCCTGGTGCCGCGGCAGCATGGCAGAGATGAAGACCG (SEQ ID NO: 6);

[0039] TB1-NF:CGCCATATGACAGAGCAGCAGTGGAA (SEQ ID NO:7);

[0040] TB2-RY: TAAAGCGGCCGCTCAATGATGATGATGATGATGGTGGAAGCCCATTTGCGAGGAC (SEQ ID NO: 8).

[0041] b. Expression and preparation of recombinant proteins

[0042] The constructed TB12-PET30a plasmid was transformed into competent BL21 *E. coli* cells and cultured statically at 37°C until single colonies formed. Single colonies were picked and transferred to liquid LB medium (containing 100 μg / ml kanamycin) and cultured overnight at 37°C with shaking at 180 rpm. The bacterial culture was then transferred 1:100 to culture flasks containing liquid LB medium (containing 100 μg / ml kanamycin) and cultured at 37°C with shaking at 180 rpm. When the OD600 of the bacterial culture reached 0.6-0.8, IPTG was added to a final concentration of 0.2 mM / L, and the culture was further induced overnight at 16°C with shaking at 180 rpm. The culture was then centrifuged at 8000 rpm for 10 min to collect the bacterial cells.

[0043] Example 2 Preparation of antigen complex

[0044] a. Resuspend the collected bacterial cells in PBS buffer at pH 7.4 (20 mL / g of bacterial cells). After resuspending, place the cells in an ice bath and sonicate to disrupt them. Centrifuge at 10,000 rpm for 10 min to collect the supernatant and filter it through a 0.45 μm filter.

[0045] b. Ni column purification: After filtration, the sample was purified using Ni column purification with 20mM PBS + 50mM imidazole (pH 7.4) as the equilibration buffer. The process involved sample loading, flow-through, and reequilibration, followed by dissociation of the sample with 20mM PBS + 250mM imidazole (pH 7.4). (See...) Figure 1 M: Mark; 1: Loading; 2: Flow-through; 3: Dissociation)

[0046] c. Enzyme digestion: Thrombin was added to the Ni column to dissociate the sample at a rate of 2 U / mg, and the reaction was carried out overnight at 4°C.

[0047] d. Ni column purification: After complete enzyme digestion, the sample was diluted 5-fold with 20mM PBS (pH 7.4), filtered through a 0.45μm filter, and then purified by Ni column using 20mM PBS + 50mM imidazole (pH 7.4) as the equilibration buffer. Following loading, flow-through, and reequilibration steps, the sample was dissociated using 20mM PBS + 250mM imidazole (pH 7.4). (See...) Figure 2 M: Mark; 1: Loading; 2: Flow-through; 3: Dissociation)

[0048] e: Ion exchange chromatography: After dialysis or hollow fiber filtration, the replacement buffer is 20 mM PB (pH 7.4). DEAE ion exchange chromatography is performed using 20 mM PB (pH 7.4) as the buffer. After sample loading, flow-through, and reequilibration, 20 mM PB + 100 mM NaCl (pH 7.4) is used as the washing buffer, and 20 mM PB + 200 mM NaCl (pH 7.4) is used to dissociate proteins.

[0049] f: Endotoxin affinity chromatography: After dissociation, the sample was filtered through a 0.22 μm pyrogen-free filter in a clean bench. Endotoxin removal was performed using endotoxin-free affinity chromatography medium. The flow-through was collected, filtered through a 0.22 μm pyrogen-free filter, and then appropriately aliquoted and stored. (See...) Figure 3 M: Mark; 1: Final product restored; 2: Final product not restored)

[0050] g: Compared to the preparation of single antigens, the antigen complex preparation process of this invention can increase the expression level by 3-5 times, save nearly half the preparation time, eliminate the need for mixing operations, and produce a 1:1 complex antigen with a molecular weight between 17-45 kDa. Results are shown in Table 1 and [see Table 2]. Figure 4 .

[0051] Table 1

[0052]

[0053] Implementation Case 3: Comparison of Mycobacterium tuberculosis-specific T-cell immunoassay

[0054] The Antu Bio Mycobacterium tuberculosis-specific cellular immunoreactivity assay kit was used. Fresh whole blood was collected and added to wells N, T1, and T2 in the same volume within a biosafety cabinet. 1 mL of fresh whole blood was added to each well, and the wells were incubated at 37°C for 16–24 h. After incubation, the supernatant was collected for INF-γ detection. The judgment criteria are shown in Table 2, and the results are shown in Table 3.

[0055] Table 2

[0056]

[0057]

[0058] Table 3

[0059]

[0060] The results show that the specificity and sensitivity of the antigen complex of the present invention can reach the same level as the control.

[0061] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing recombinant antigen complexes, characterized in that, include: A recombinant vector containing the precursor recombinant protein ESAT-6-CFP-10 encoding nucleic acid was constructed, transformed into host cells, and induced protein expression. After lysing and purifying the cells, the cells were digested with thrombin; the digested product was incubated at 4°C for 12 hours to obtain the antigen complex. The amino acid sequence of the ESAT-6 protein is shown in SEQ ID NO:1; The amino acid sequence of the CFP-10 protein is shown in SEQ ID NO:2; The sequence encoding the nucleic acid is shown in SEQ ID NO:4; The recombinant antigen complex is a heterodimer protein formed by ESAT-6 protein and CFP-10 protein in a 1:1 molar ratio.