Primers and probes, compositions and methods for screening and identifying irf4 rearrangement-associated fusion genes by fluorescent pcr

Abstract

The present application relates to primers and probes, compositions and methods for screening and identifying IRF4 rearrangement related fusion genes by fluorescent PCR technology, and the related fusion genes screened and identified include 18 fusion modes such as DUSP22-IRF4E2. The primers, probes, detection combination modes and detection methods are convenient, economical, fast, specific, high in sensitivity, large in throughput, suitable for clinical comprehensive evaluation of the occurrence and development of diseases in combination with bone marrow examination, chromosome karyotype analysis, immunotyping and the like of a large number of samples; meanwhile, MRD monitoring is carried out in a targeted manner, and the risk of recurrence is predicted.

Description

Technical Field

[0001] This invention belongs to the fields of life sciences and biotechnology, and specifically relates to primers, probes, compositions, and methods for screening IRF4 rearrangement-related fusion genes using multiplex fluorescent PCR technology. Technical Background

[0002] IRF4 is a member of the interferon regulatory factor (IRF) family. Because it was first discovered in multiple myeloma, it is also known as multiple myeloma oncogene 1 (MUM1). The IRF family has 10 members and consists of downstream regulators of interferon signaling. Unlike other IRF proteins, IRF4 expression is not affected by interferon but is mediated by stimuli related to lymphocyte activation. IRF4 participates in immune regulation and mediates the development and differentiation of immune-related cells such as lymphocytes, myeloid cells, and dendritic cells through a series of signal transduction mechanisms that activate or inhibit the expression of specific genes.

[0003] IRF4 is primarily expressed in lymphocytes and exhibits certain species- and stage-specific characteristics. Numerous studies have identified and refined the details of IRF4 dependence during B cell and T cell differentiation and development. In B cell lines, IRF4 is expressed at varying levels throughout B cell development, with higher expression rates in a small subset of GCB cells, post-germinal center B cells, and plasma cells; that is, IRF4 expression peaks at the terminal stage of GCB cell differentiation into plasma cells. In T cell lines, both normal T cells and abnormally activated T cells express IRF4. IRF4 is a transcription factor that plays a crucial role in regulating immune responses, immune cell development and differentiation, cell growth regulation, and metabolism, and is essential for plasma cell differentiation.

[0004] IRF4 activation in tumor tissues, leading to overexpression or translocation and resulting in abnormal regulation, is a significant cause of tumorigenesis. Abnormal IRF4 gene expression contributes to lymphoproliferative disorders and is associated with the prognosis of lymphomas. Diffuse large B-cell lymphoma (DLBCL) is the most common malignant lymphoma, accounting for 30-40% of NHL cases. It exhibits strong heterogeneity, with significant differences in clinical manifestations and prognosis. Studies have shown that IRF4 / MUM1 expression in DLBCL is associated with activated DLBCL and some DLBCL cases with poor prognosis.

[0005] Large B-cell lymphoma (LBCL) with IRF4 rearrangement is a rare subtype of LBCL newly introduced in the 2017 revised WHO classification of tumors of the lymphohematopoietic system. Histologically, it exhibits characteristics of both follicular lymphoma (FL) and / or diffuse large B-cell lymphoma (DLBCL). In IRF4 rearranged LBCL, overexpression of MUM1 is often due to IgH / IRF4 fusion, and less frequently IgL / IRF4 or IgK / IRF4 fusion. This tumor commonly occurs in children and young adults, with most cases confined to the head and neck region, accompanied by IRF4 gene rearrangement, and generally having a relatively good prognosis. Early detection of IRF4 rearrangement is crucial for the diagnosis and treatment of LBCL and related rare tumors.

[0006] There is a strong clinical need for the discovery, detection, and monitoring of fusion genes as targets for minimal residual disease. Regardless of whether the molecular marker is associated with prognosis, fusion genes are a good monitoring target. Chromosomal karyotype analysis is not 100% accurate in detecting various chromosomal translocations and inversions; this method is affected by cell culture, the number of mitotic figures, the degree of structural change, the clarity of banding, and the observer's judgment. FISH is costly and less sensitive than PCR; while PCR combined with electrophoresis is time-consuming, cumbersome, prone to contamination, and the interpretation of results is subjective. Furthermore, the more PCR reaction systems there are, the higher the cost, making it unsuitable for high-throughput sample screening. Summary of the Invention

[0007] Given that current methodologies for screening IRF4 rearrangement-related fusion genes cannot simultaneously meet the requirements of cost-effectiveness, accuracy, and applicability to MRD monitoring, this invention designs a set of primers and probes for detecting common IRF4 rearrangement fusion genes using multiplex fluorescent PCR technology, and devises a screening and type identification scheme that is highly sensitive, specific, has high throughput, and is rapid and accurate.

[0008] A method for screening and identifying DUSP22-IRF4 E2, SH3GL1-IRF4E2, DOT1L-IRF4E2, EFNA2-IRF4 E2, AP3D1-IRF4 E2, LTBR-IRF4 E2, DUSP22-IRF4 E5, SH3GL1-IRF4 E5, DOT1L-IRF4 E5, EFNA2-IRF4 E5, AP3D1-IRF4 E5, LTBR-IRF4 E5, DUSP22-IRF4 E7, SH3GL1-IRF4 E7, DOT1L-IRF4 E7, EFNA2-IRF4 E7, AP3D1-IRF4 E7, and LTBR-IRF4 using fluorescent PCR. The primers and probes for these 18 relatively common IRF4 rearrangement-related fusion genes (E7) are characterized by employing multiplex fluorescent PCR technology. The upstream primers and their corresponding probes present in the IRF4 gene are divided into two groups, which are then paired with multiple downstream primers for different downstream genes. Their nucleotide sequences are as follows:

[0009]

[0010]

[0011] The primers and probes used to screen the above fusion genes also include primers and probes for amplifying the housekeeping gene ABL, which serves as an internal control. Their nucleotide sequences are as follows:

[0012] ABL-F: 5'-GATACGAAGGGAGGGTGTACCA-3'

[0013] ABL-R: 5'-CTCGGCCAGGGTGTTGAA-3'

[0014] ABL-P: 5'-HEX-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA-3'

[0015] The innovation of this invention lies in:

[0016] 1. When the IRF4 gene undergoes rearrangement, the breakpoints are mainly concentrated in introns 2, 5, and 7, leading to fusion of IRF4 exons 2, 5, and 7 with other genes. The most common fusion gene breakpoint is in intron 5 of IRF4, while the least common is intron 7. To encompass as many fusion genes as possible generated by various IRF4 rearrangements while minimizing interference in the PCR reaction, and to ensure that the primers and probes in a single PCR tube are as singular as possible, this invention designs one primer and its corresponding probe for each of the 2nd, 5th, and 7th exons of IRF4, serving as shared primers and probes for screening IRF4 rearrangement-related fusion genes. Simultaneously, the length of the PCR amplification product is controlled to be within 150 bp to meet the detection range requirements of fluorescent PCR technology. The IRF4 primer and probe design scheme is described below. Figure 1 The IRF4 demonstration diagram shows the arrows indicating the directions of the primers and probes.

[0017] 2. The IRF4 gene has as many as 10 breakpoints, and more than 10 chaperone genes that fuse with it have been reported. To minimize the number of detection reactions, increase throughput, and save costs, the upstream primer design in this invention must ensure that various fusion methods can be detected, while avoiding an excessive number of primers in a single PCR reaction system to prevent interference. The upstream primer position design scheme is described below. Figure 1 The diagram illustrates LTBR, ​​AP3D1, SH3GL1, DUSP22, DOT1L, and EFNA2, where the arrows indicate the direction of the primers.

[0018] 3. Regarding the combination and primer design scheme for IRF4 rearrangement-related fusion gene screening, in order to minimize the number of reaction tubes, we used different luminescent groups in the probe design. This allows different probes to be reacted in one tube, and signal acquisition can be achieved in different channels of the instrument, achieving the goal of rapid and convenient detection. Specifically, the first group of reactions includes probes IRF4 E2-P and ABL-P, with luminescent groups FAM and HEX respectively. This allows them to be reacted in one tube without affecting signal collection.

[0019] 4. Regarding the combined screening scheme for IRF4 rearrangement-related fusion genes, this invention takes into account interference factors such as primer dimers and hairpin structures, as well as the consistency of IRF4 gene breakage and fusion positions, and divides the screening into three groups:

[0020] Group 1: Includes primers and probes for screening DUSP22-IRF4 E2, SH3GL1-IRF4 E2, DOT1L-IRF4 E2, EFNA2-IRF4E2, AP3D1-IRF4 E2, LTBR-IRF4 E2 fusion genes and ABL. The nucleotide sequences of the primers and probes are: IRF4 E2-R, IRF4 E2-P; DUSP22 E6-F, SH3GL1 E4-F, DOT1L E5-F, EFNA2 E2-F, AP3D1 E6-F, LTBR E3-F, ABL-F, ABL-R, ABL-P.

[0021] The second group includes primers and probes for screening the fusion genes DUSP22-IRF4 E5, SH3GL1-IRF4 E5, DOT1L-IRF4E5, EFNA2-IRF4E5, AP3D1-IRF4 E5, and LTBR-IRF4 E5. The nucleotide sequences of the primers and probes are: IRF4 E5-R, IRF4 E5-P; DUSP22 E6-F, SH3GL1 E4-F, DOT1L E5-F, EFNA2 E2-F, AP3D1 E6-F, and LTBR E3-F.

[0022] The third group includes primers and probes for screening the fusion genes DUSP22-IRF4 E7, SH3GL1-IRF4 E7, DOT1L-IRF4E7, EFNA2-IRF4E7, AP3D1-IRF4 E7, and LTBR-IRF4 E7. The nucleotide sequences of the primers and probes are: IRF4 E7-R, IRF4 E7-P; DUSP22 E6-F, SH3GL1 E4-F, DOT1L E5-F, EFNA2 E2-F, AP3D1 E6-F, and LTBR E3-F.

[0023] This invention also provides a kit for screening and identifying 18 IRF4 rearrangement-related fusion genes, namely DUSP22-IRF4 E2, SH3GL1-IRF4 E2, DOT1L-IRF4 E2, EFNA2-IRF4 E2, AP3D1-IRF4 E2, LTBR-IRF4 E2, DUSP22-IRF4 E5, SH3GL1-IRF4 E5, DOT1L-IRF4 E5, EFNA2-IRF4 E5, AP3D1-IRF4 E5, LTBR-IRF4 E5, DUSP22-IRF4 E7, SH3GL1-IRF4 E7, DOT1L-IRF4 E7, EFNA2-IRF4 E7, AP3D1-IRF4 E7, and LTBR-IRF4 E7, using multiplex fluorescent PCR technology. The kit includes primers and probes, whose nucleotide sequences include: IRF4E2-R, IRF4E2-P, and IRF4E2-R. E5-R, IRF4 E5-P; IRF4 E7-R, IRF4 E7-P; DUSP22E6-F, SH3GL1 E4-F, DOT1L E5-F, EFNA2 E2-F, AP3D1 E6-F, LTBR E3-F.

[0024] It also includes primers and probes for amplifying the housekeeping gene ABL as an internal control, with the following nucleotide sequence: ABL-F: 5'-GATACGAAGGGAGGGTGTACCA-3'

[0025] ABL-R: 5'-CTCGGCCAGGGTGTTGAA-3'

[0026] ABL-P: 5'-HEX-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA-3'

[0027] This invention also provides a method for screening and identifying 18 IRF4 rearrangement-related fusion genes, namely DUSP22-IRF4 E2, SH3GL1-IRF4 E2, DOT1L-IRF4 E2, EFNA2-IRF4 E2, AP3D1-IRF4 E2, LTBR-IRF4 E2, DUSP22-IRF4 E5, SH3GL1-IRF4 E5, DOT1L-IRF4 E5, EFNA2-IRF4 E5, AP3D1-IRF4 E5, LTBR-IRF4 E5, DUSP22-IRF4 E7, SH3GL1-IRF4 E7, DOT1L-IRF4 E7, EFNA2-IRF4 E7, AP3D1-IRF4 E7, and LTBR-IRF4 E7, using the aforementioned primers and probes. The method includes the following steps:

[0028] (1) Nucleated cells were extracted from whole blood samples by lysing erythrocytes using erythrocyte lysis buffer. The 10× erythrocyte lysis buffer formula was: 82g NH4Cl, 8.4g NaHCO3, 3.72g EDTA-Na2, and ddH2O was added to bring the volume to 1000ml.

[0029] (2) Total RNA was extracted from nucleated cells using the TRIzol RNA extraction method, and the RNA was reverse transcribed into cDNA.

[0030] (3) Using the cDNA from step 2 as a template, preliminary screening of IRF4 rearrangement-related fusion genes was performed. The screening was conducted in two systems: Group 1 and Group 2. The reaction conditions were: 95℃ pre-denaturation for 1 min; 95℃ for 10 s, 58℃ for 50 s, for a total of 40 cycles; fluorescence was collected at 58℃.

[0031] (4) Based on the test results in step 3, determine which group (first or second) is positive. If the internal reference ABL gene amplification is normal (CT value ≤ 32), a CT value < 36 for each fusion gene is considered positive. If the first group is positive, it is necessary to identify which of the following fusion genes is positive: DUSP22-IRF4 E2, SH3GL1-IRF4 E2, DOT1L-IRF4 E2, EFNA2-IRF4 E2, AP3D1-IRF4E2, or LTBR-IRF4 E2. If the second group is positive, it is necessary to identify which of the following fusion genes is positive: DUSP22-IRF4E5, SH3GL1-IRF4 E5, DOT1L-IRF4 E5, EFNA2-IRF4 E5, AP3D1-IRF4 E5, or LTBR-IRF4 E5. If the third group is positive, it is necessary to identify which of the following fusion genes is positive: DUSP22-IRF4 E7, SH3GL1-IRF4 E7, DOT1L-IRF4 E7, EFNA2-IRF4 E7, AP3D1-IRF4 E7, or LTBR-IRF4 E7.

[0032] Current reports indicate that the incidence of these 18 IRF4-related fusion genes in large B-cell lymphoma (LBCL) is less than 1%, and their correlation with clinical prognosis has not yet yielded statistically significant conclusions. However, they remain effective biomarkers for monitoring MRD. Conventional karyotype analysis may miss some recessive chromosomal changes, and its sensitivity is insufficient for clinical requirements. FISH testing of IRF4 separation probes cannot identify its partner genes, hindering follow-up and MRD monitoring. PCR combined with electrophoresis is subjective, and its sensitivity is insufficient for MRD monitoring. This invention utilizes three pairs of upstream primer probes covering all reported breakpoints in the IRF4 gene, corresponding to various partner gene breakpoint patterns. Screening followed by identification reduces the screening reaction system to three tubes, saving costs and increasing throughput, thus facilitating large-sample screening. This combination approach, along with fluorescent PCR technology, avoids the open-cap reaction required in conventional PCR, improving result accuracy and preventing contamination. It also enhances the interpretability of the results, making them more objective and easier to read. This method facilitates comprehensive clinical assessment of disease progression by integrating bone marrow examination, chromosome karyotype analysis, and immunophenotyping results, while also enabling targeted monitoring of MRD and prediction of relapse risk. Attached Figure Description

[0033] Figure 1 This is a schematic diagram of the primer and probe design region of this invention. The arrows represent the directions of the primers and probes. Since the reverse primers and probes are on the same exon and have the same design direction, they share the same arrow. E represents an exon, such as E2, which is exon 2. The number below the box represents the actual number of bases in this exon, i.e., its length. For example, the length of E2 in the IRF4 gene is 271 bp.

[0034] Figure 2 This is a fluorescence amplification curve of a sample of diffuse large B-cell lymphoma detected using the primers, probes, and methods of this invention.

[0035] Figure 3 This is a graph showing the results of screening a known DUSP22-IRF4 E2 positive quality control sample using the primers, probes, and methods of this invention.

[0036] Figure 4 Fluorescence amplification curves for specific fusion gene identification. Detailed Implementation

[0037] Example 1: A whole blood sample was taken from a patient clinically diagnosed with diffuse large B-cell lymphoma (DLBCL).

[0038] Whole blood RNA extraction: Add 1 ml of 1× erythrocyte lysis buffer to a 1.5 ml centrifuge tube, take 0.5 ml of the whole blood sample to be tested, and mix by inversion. Centrifuge at 4000 rpm for 3 min, discard the supernatant, wash once with erythrocyte lysis buffer to obtain the desired cells; add 1 ml of Total RNA Isolation Reagent, repeatedly pipette until no obvious cell clumps are visible, add 200 μl of chloroform, vortex for 30 s, and incubate on ice for 10 min. Centrifuge at 14,000 rpm, 4℃ for 10 min. Transfer 450 μl of the supernatant to another centrifuge tube, add an equal volume of pre-chilled isopropanol, mix by inversion, and incubate on ice for 10 min. Centrifuge at 14,000 rpm, 4℃ for 10 min. Then wash once with 75% ethanol and once with anhydrous ethanol. Dry at room temperature for 5 min, and dissolve in 50 μl of DEPC-H2O.

[0039] Example 2:

[0040] Reverse transcription: Take 4 μL of the RNA solution from Example 1 (approximately 200 ng / μL), add 1 μL of Primer mix (ReverTraAce qPCR RT Kit) and 3 μL of DEPC-H2O, mix well, and pre-denature at 70°C for 5 min. After quenching on ice for 1 min, add 4 μL of 5*RTbuffer (ReverTraAce qPCR RT Kit), 1 μL of Enzyme Mix (ReverTraAce qPCR RT Kit), and 7 μL of DEPC-H2O to a total volume of 20 μL. Incubate at 37°C for 60 min, then inactivate at 98°C for 5 min. The resulting cDNA is the sample to be tested.

[0041] Example 3:

[0042] Multiplex fluorescent PCR screening: The screening reagent was prepared according to the materials and dosages shown in Table 1 below. The screening reagent consisted of three reaction tubes: tubes one, two, and three were for the screening detection group; tube four was for the ABL internal reference gene detection group, used to determine whether the RNA extraction quality met the requirements. 2 μL of the cDNA obtained in Example 2 was added to each tube. The detection was performed according to the following procedure: 95℃ pre-denaturation for 60 s; 95℃ for 10 s, 58℃ for 50 s, for a total of 40 cycles; fluorescence was collected at 58℃. The results are as follows: Figure 2 As shown: The screening result was negative.

[0043] Table 1

[0044]

[0045]

[0046] Example 4:

[0047] According to Example 3, everything else was the same during the test except that 1 μL of the positive control material DUSP22-IRF4 E2 was added to the first group of samples. The screening was performed according to the procedure in Example 3, and the results were as follows. Figure 3 As shown: the first group showed a line break, the internal control ABL was normal, and the other two groups did not show a line break. Each fusion gene in the first group was identified separately. The reagent preparation is shown in Table 2, and 1 μL of DUSP22-IRF4 E2 positive control was added simultaneously with the cDNA. The detection procedure was the same as in Example 3. The results are as follows: Figure 4 As shown: the fusion gene was identified as DUSP22-IRF4 E2 positive.

[0048] Table 2

[0049]

[0050]

[0051]

Claims

1. Primers and probes for screening and identifying 18 IRF4 rearrangement-related fusion genes (DUSP22-IRF4 E2, SH3GL1-IRF4 E2, DOT1L-IRF4 E2, EFNA2-IRF4 E2, AP3D1-IRF4 E2, LTBR-IRF4 E2, DUSP22-IRF4 E5, SH3GL1-IRF4 E5, DOT1L-IRF4 E5, EFNA2-IRF4 E5, AP3D1-IRF4 E5, LTBR-IRF4 E5, DUSP22-IRF4 E7, SH3GL1-IRF4 E7, DOT1L-IRF4 E7, EFNA2-IRF4 E7, AP3D1-IRF4 E7, LTBR-IRF4 E7) using multiplex fluorescent PCR, characterized in that... The nucleotide sequences of the primers and probes are as follows: 。 2. The primers and probes according to claim 1, characterized in that, The nucleotide sequences of the primers and probes used for detecting the DUSP22-IRF4 E2 fusion gene are: DUSP22 E6-F, IRF4E2-R, IRF4 E2-P; The nucleotide sequences of the primers and probes used for detecting the SH3GL1-IRF4 E2 fusion gene are: SH3GL1 E4-F, IRF4E2-R, IRF4 E2-P; The nucleotide sequences of the primers and probes used for detecting the DOT1L-IRF4 E2 fusion gene are: DOT1L E5-F, IRF4 E2-R, IRF4 E2-P; The nucleotide sequences of the primers and probes used for detecting the EFNA2-IRF4 E2 fusion gene are: EFNA2 E2-F, IRF4 E2-R, IRF4 E2-P; The nucleotide sequences of the primers and probes used for detecting the AP3D1-IRF4 E2 fusion gene are: AP3D1 E6-F, IRF4 E2-R, IRF4 E2-P; The nucleotide sequences of the primers and probes used for detecting the LTBR-IRF4 E2 fusion gene are: LTBR E3-F, IRF4 E2-R, IRF4 E2-P; The nucleotide sequences of the primers and probes used for detecting the DUSP22-IRF4 E5 fusion gene are: DUSP22 E6-F, IRF4E5-R, IRF4 E5-P; The nucleotide sequences of the primers and probes used for detecting the SH3GL1-IRF4 E5 fusion gene are: SH3GL1 E4-F, IRF4E5-R, IRF4 E5-P; The nucleotide sequences of the primers and probes used for detecting the DOT1L-IRF4 E5 fusion gene are: DOT1L E5-F, IRF4 E5-R, IRF4 E5-P; The nucleotide sequences of the primers and probes used for detecting the EFNA2-IRF4 E5 fusion gene are: EFNA2-F, IRF4 E5-R, IRF4 E5-P; The nucleotide sequences of the primers and probes used for detecting the AP3D1-IRF4 E5 fusion gene are: AP3D1 E6-F, IRF4 E5-R, IRF4 E5-P; The nucleotide sequences of the primers and probes used for detecting the LTBR-IRF4 E5 fusion gene are: LTBR E3-F, IRF4 E5-R, IRF4 E5-P; The nucleotide sequences of the primers and probes used for detecting the DUSP22-IRF4 E7 fusion gene are: DUSP22 E6-F, IRF4E7-R, IRF4 E7-P; The nucleotide sequences of the primers and probes used for detecting the SH3GL1-IRF4 E7 fusion gene are: SH3GL1 E4-F, IRF4E7-R, IRF4 E7-P; The nucleotide sequences of the primers and probes used for detecting the DOT1L-IRF4 E7 fusion gene are: DOT1L E5-F, IRF4 E7-R, IRF4 E7-P; The nucleotide sequences of the primers and probes used for detecting the EFNA2-IRF4 E7 fusion gene are: EFNA2-F, IRF4 E7-R, IRF4 E7-P; The nucleotide sequences of the primers and probes used for detecting the AP3D1-IRF4 E7 fusion gene are: AP3D1 E6-F, IRF4 E7-R, IRF4 E7-P; The nucleotide sequences of the primers and probes used for detecting the LTBR-IRF4 E7 fusion gene are: LTBR E3-F, IRF4 E7-R, IRF4 E7-P.

3. The primers and probes according to claim 1 or 2, characterized in that, It also includes primers and probes for amplifying the housekeeping gene ABL, which serves as an internal control. Their nucleotide sequences are as follows: ABL-F: 5'- GATACGAAGGGAGGGTGTACCA -3' ABL-R: 5'-CTCGGCCAGGGTGTTGAA-3' ABL-P:5'-HEX-TGCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA-3'.

4. The use of the primers and probes according to any one of claims 1-3 in the preparation of a kit for detecting 18 IRF4-related fusion genes.

Images