Rice osnramp5 mutant and screening method and application thereof

Abstract

This invention relates to the field of rice breeding technology, specifically to a type of rice. OsNramp5 mutants, rice OsNramp5 Mutant screening methods and applications. The code described... OsNramp5 The mutant gene includes the nucleotide sequence shown in SEQ ID NO. 1. The rice described in this invention... OsNramp5 The mutant can be well applied to the breeding of low-cadmium-accumulating rice varieties, enriching the variety of low-cadmium-accumulating rice. This invention, through a unique indel molecular marker combined with electrophoresis detection and first-generation sequencing verification, achieves the ability to induce cadmium accumulation in the M1 generation of rice through mutagenesis. OsNramp5 The mutants were accurately identified and screened, a highly efficient, precise, and simple process that significantly reduced costs. The low-cadmium-accumulation rice products cultivated showed significantly lower cadmium content in their roots, stems, leaves, and mature seeds compared to wild rice of the same variety after planting.

Description

Technical Field

[0001] This invention relates to the field of rice mutation breeding technology, specifically to a rice OsNramp5 mutant and its screening method and application. Background Technology

[0002] Rice is my country's largest grain crop, with a large planting area in the Yangtze River basin and areas south of it. With rapid economic development, the large-scale emission of industrial pollutants and the excessive use of agricultural inputs have led to an increase in the area of ​​polluted arable land in China. Rice has a tendency to accumulate the heavy metal cadmium, making it the major cereal crop with the strongest cadmium absorption capacity. This has resulted in serious cadmium pollution in rice, and excessive cadmium content in rice has become a major problem affecting human health. Controlling the cadmium content in rice grains is key to improving rice quality and safety, and is also an important direction for rice quality and safety research. Breeding and promoting low-cadmium-accumulation rice varieties is the most economical and effective measure to solve the "cadmium rice" problem.

[0003] Radiation-induced mutation breeding is a breeding method that uses physical or chemical means to obtain stably inherited mutant germplasm without the aid of transgenic technology. Compared with natural mutation, mutation breeding can increase the mutation rate and obtain superior mutation types in a short period of time. However, this mutation is random, and how to efficiently and accurately identify the mutations of the target gene related to cadmium accumulation is currently a challenge in mutation breeding. Chinese patent application number 202111412187.2 discloses the rice OsNramp5 mutant, its screening method, and its uses. It uses radiation-induced mutation to accelerate the plant genome mutation rate, and high-throughput molecular screening technology is used to detect the variation of the OsNramp5 allele in the M2 generation seedlings of the induced plants. Chinese patent application number 201911222439.8 discloses a rice OsNramp5-18 mutant gene, its identification method, KASP typing primers, and their applications. The OsNramp5-18 mutant gene has an 18 bp deletion [CCTACGTGGCAATTCACA / -] at positions 8875646-8875663 (RAP_Locus). While deep targeted sequencing is used to screen mutants with high accuracy, it is costly. Nevertheless, mutation breeding remains a feasible and irreplaceable breeding method. This invention provides a novel rice OsNramp5 mutant, its screening method, and its applications, enriching the genes and related mutants associated with low cadmium accumulation, thereby better guiding the breeding of low cadmium-accumulating rice varieties, which is of great significance. Summary of the Invention

[0004] The technical problem solved by this invention is to provide a rice OsNramp5 mutant to better guide the breeding of low cadmium accumulation rice varieties.

[0005] The technical problem solved by this invention is to provide a method for screening rice OsNramp5 mutants that is accurate, efficient, easy to operate, and low in cost.

[0006] The technical problem solved by this invention also lies in the application of the screened rice OsNramp5 mutant in rice breeding, thereby obtaining a richer variety of low-cadmium-accumulating rice varieties.

[0007] The technical problem solved by this invention is achieved by the following technical solution:

[0008] A rice OsNramp5 mutant, whose nucleotide sequence encoding the OsNramp5 mutant contains the following base deletion segment compared with the OsNramp5 gene sequence of Nipponbare rice: a deletion of 12 bases [TCCTTGCCCATG / -] at positions 8878413-8878424 on chromosome 7 (RAP_Locus).

[0009] Furthermore, the gene encoding the OsNramp5 mutant includes a nucleotide sequence as shown in SEQ ID NO.1, or includes a specific sequence encoding a protein with more than 95% homology to the nucleotide sequence as shown in SEQ ID NO.1.

[0010] The screening method for rice OsNramp5 mutants includes indel molecular marker detection of the exon regions of the rice OsNramp5 gene. The indel molecular markers include forward and reverse primers corresponding to the following 14 sites:

[0011] Indel01 site: The forward primer OsNramp5-1F and the reverse primer OsNramp5-1R are shown in SEQ ID NO.2 and SEQ ID NO.3 of the sequence listing, respectively;

[0012] Indel02 site: the forward primer OsNramp5-2F and the reverse primer OsNramp5-2R are shown in SEQ ID NO.4 and SEQ ID NO.5 of the sequence listing, respectively;

[0013] Indel03 site: the forward primer OsNramp5-3F and the reverse primer OsNramp5-3R are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively;

[0014] Indel04 site: The forward primer OsNramp5-4F and the reverse primer OsNramp5-4R are shown in SEQ ID NO.8 and SEQ ID NO.9 of the sequence listing, respectively;

[0015] Indel05 site: the forward primer OsNramp5-5F and the reverse primer OsNramp5-5R are shown in SEQ ID NO.10 and SEQ ID NO.11, respectively;

[0016] Indel06 site: the forward primer OsNramp5-6F and the reverse primer OsNramp5-6R are shown in SEQ ID NO.12 and SEQ ID NO.13, respectively;

[0017] Indel07 site: the forward primer OsNramp5-7F and the reverse primer OsNramp5-7R are shown in SEQ ID NO.14 and SEQ ID NO.15, respectively;

[0018] Indel08 site: the forward primer OsNramp5-8F and the reverse primer OsNramp5-8R are shown in SEQ ID NO.16 and SEQ ID NO.17, respectively;

[0019] Indel09 site: the forward primer OsNramp5-9F and the reverse primer OsNramp5-9R are shown in SEQ ID NO.18 and SEQ ID NO.19, respectively;

[0020] Indel10 site: the forward primer OsNramp5-10F and the reverse primer OsNramp5-10R are shown in SEQ ID NO.20 and SEQ ID NO.21, respectively;

[0021] Indel11 site: the forward primer OsNramp5-11F and the reverse primer OsNramp5-11R are shown in SEQ ID NO.22 and SEQ ID NO.23, respectively;

[0022] Indel12 site: the forward primer OsNramp5-12F and the reverse primer OsNramp5-12R are shown in SEQ ID NO.24 and SEQ ID NO.25, respectively;

[0023] Indel13 site: the forward primer OsNramp5-13F and the reverse primer OsNramp5-13R are shown in SEQ ID NO.26 and SEQ ID NO.27, respectively;

[0024] Indel14 site: The forward primer OsNramp5-14F and the reverse primer OsNramp5-15R are shown in SEQ ID NO.28 and SEQ ID NO.29, respectively.

[0025] Furthermore, the screening method for rice OsNramp5 mutants includes the following steps:

[0026] 1) After mutagenesis of rice seeds, M1 generation rice materials were obtained. The M1 generation rice materials were planted individually, and leaves from multiple individual rice plants were taken and mixed to obtain multiple mixed samples. Mixed pool DNA was extracted from each mixed sample.

[0027] 2) PCR amplification of DNA from each pool was performed using indel molecular markers, and the PCR amplification products were detected by electrophoresis to screen pool samples that differed from wild-type rice OsNramp5 gene detection.

[0028] 3) Extract DNA from individual rice plants corresponding to the mixed pool samples with differences. Further, PCR amplification of the extracted DNA from individual plants was performed by detecting the indel molecular markers corresponding to the differences. The obtained PCR amplification products were detected by electrophoresis. Individual plants with differences from the OsNramp5 gene of wild-type rice were screened out and verified by first-generation sequencing.

[0029] Furthermore, in step 1), the rice variety is Huahui 8612.

[0030] Preferably, in step 1), mutagenesis is induced by physicochemical methods, including gamma-ray mutagenesis, heavy ion mutagenesis, or EMS (ethyl methanesulfonate) mutagenesis.

[0031] Further, in step 1), the leaves from every 6 to 10 individual rice plants are grouped and mixed to obtain a mixed sample.

[0032] Furthermore, the 10 μl PCR reaction system includes 0.3 μl each of 10 mM primers F and R, 0.8 μl of dNTP, and 50–100 ng of DNA. The PCR reaction conditions are: 94 °C pre-denaturation for 5 min, 94 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 40 s, for a total of 30 cycles, and incubation at 12 °C.

[0033] This invention also protects the use of the rice OsNramp5 mutant in the breeding and / or preparation of low-cadmium-accumulation rice products.

[0034] Furthermore, the method for cultivating low-cadmium-accumulation rice products is as follows: using the rice OsNramp5 mutant as the donor and the hybrid rice backbone parent as the recipient, backcrossing is carried out, and conventional breeding combined with indel molecular markers is used to cultivate rice varieties with low cadmium accumulation of the OsNramp5 mutant.

[0035] Furthermore, the backcrossing improvement process involves 2 to 6 generations.

[0036] Beneficial effects: The rice OsNramp5 mutant described in this invention is a unique rice OsNramp5 mutant that has been screened for the first time, and it can be well applied to the breeding of low cadmium accumulation rice varieties.

[0037] This invention achieves precise screening of rice OsNramp5 mutants in the M1 generation of mutagenesis by combining unique indel molecular markers with electrophoresis detection and first-generation sequencing verification. The operation is efficient, accurate and simple, and significantly reduces costs.

[0038] The rice OsNramp5 mutant described in this invention has a simple breeding and preparation method when breeding and / or preparing low-cadmium-accumulation rice products, and does not require gene editing. The cadmium content in the roots, stems, leaves and mature seeds of the rice containing the OsNramp5 mutant of this invention is significantly lower than that of wild rice of the same variety after planting. Attached Figure Description

[0039] Figure 1 This is a polyacrylamide gel electrophoresis image of some individual plants in the radiation 8612 population detected by Indel molecular markers in Example 1. (M: DNA marker; W: Huahui 8612; 65-96 are the numbers of the mixed sample DNA);

[0040] Figure 2 Polyacrylamide gel electrophoresis was used to detect the differentially expressed individual strains in Example 1. (M: DNA marker; W: Huahui 8612)

[0041] Figure 3 Analysis of OsNramp5 sequencing results for the third single plant in Example 1;

[0042] Figure 4 This is a polyacrylamide gel electrophoresis image of some offspring plants from the third single plant in Example 1, showing the detection of Indel molecular markers (M: DNA marker; W: Huahui 8612; 1-32 are DNA numbers).

[0043] Figure 5 This is a comparison of the sequencing results of radiation 8612-12 in Example 1 with those of normal Huahui 8612.

[0044] Figure 6Cadmium content was determined for both *Huahui 8612-12* and normal *Huahui 8612*. (A: Cadmium content in leaves of *Huahui 8612* and *Fu 8612-12*; B: Cadmium content in stems of *Huahui 8612* and *Fu 8612-12*; C: Cadmium content in roots of *Huahui 8612* and *Fu 8612-12*; D: Cadmium content in mature seeds of *Huahui 8612* and *Fu 8612-12*.) Detailed Implementation

[0045] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below with reference to specific embodiments.

[0046] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the invention. Unless otherwise specified, all raw materials, reagents, instruments, and equipment used in this invention are commercially available or can be prepared by existing methods. The embodiments use Huahui 8612 as an example to illustrate the concept and achieved experimental results; practical applications are not limited to Huahui 8612.

[0047] Example 1

[0048] A rice OsNramp5 mutant, whose nucleotide sequence, compared to the OsNramp5 gene sequence of Nipponbare rice, contains the following base deletion: a 12-base deletion [TCCTTGCCCATG / -] at positions 8878413-8878424 on chromosome 7 (RAP_Locus). The nucleotide sequence of the gene encoding the OsNramp5 mutant is shown in SEQ ID NO.1.

[0049] The method for screening rice OsNramp5 mutants, taking Huahui 8612 as an example, includes the following steps:

[0050] 1) Soak 4.0 kg of Huahui 8612 seeds in a 10% sodium hypochlorite solution for 30 min, then rinse with tap water and soak for 24 h; after soaking for 24 h, drain the water from the Huahui 8612 seeds and treat the drained Huahui 8612 seeds with gamma rays at a dose of 350 Gy to obtain the M1 generation of irradiated Huahui 8612.

[0051] After raising seedlings from the radiated Huahui 8612M1 generation, individual seedlings were planted. 768 seedlings were planted per group, with 96 rows per group and 8 seedlings per row. 20 groups were planted, for a total of 15,360 seedlings. Each group was numbered from 1 to 20.

[0052] For each population, an equal amount of leaves were taken from each individual plant, and leaves from every 8 individual plants were pooled into one sample, resulting in 96 samples per population. The 96 samples were then loaded into 96-well plates for DNA extraction, and a total of 1920 pooled DNA samples were extracted from the 20 populations.

[0053] 2) PCR amplification of mixed-pool DNA was performed using 14 pairs of indel molecular markers from the OsNramp5 exon region of rice. The PCR products were then detected by polyacrylamide gel electrophoresis to screen mixed-pool samples that differed from unirradiated Huahui 8612. The PCR reaction system (per 10 μl) consisted of: 1 μl 10×PCR buffer, 0.8 μl dNTPs, 0.3 μl each of 10 mM primers F and R, 0.1 μl DNA polymerase, 100 ng DNA, and ddH2O to a final volume of 10 μl. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 30 cycles, followed by incubation at 12℃.

[0054] The results are as follows Figure 1 As shown, in the detection results of the indel molecular markers OsNramp5-2F / OsNramp5-2R, the 70th sample in the 16th population showed a difference from Huahui 8612.

[0055] 3) DNA was extracted from individual rice plants corresponding to the 70 samples with differences. PCR amplification was performed using the indel molecular markers OsNramp5-2F / OsNramp5-2R, followed by polyacrylamide gel electrophoresis to screen for individual plants differing from Huahui 8612. Figure 2 As shown, among the detection results of 8 candidate single plants, single plant No. 3 differed from Huahui 8612. Using sequencing primers 26N5-1-CX-F:5'GTCACTACCACCATTCTCTTCTTCG3' and 26N5-1-CX-R:5'TTAGCTCAAAGTCAAAGATGGTGAC3', DNA from single plant No. 3 was amplified as a template. The PCR product was then sequenced for verification. Figure 3 As shown, the second exon of plantlet 3 shows a double peak, indicating that the OsNramp5 variant in plantlet 3 has undergone a mutation at the second exon.

[0056] The specific mutation type was further verified through the next generation: Plant No. 3 was harvested and seedled, then planted individually, totaling 203 plants. DNA was extracted from the leaves of each individual plant as a template, and amplified using the indel molecular markers OsNramp5-2F / OsNramp5-2R. Electrophoresis revealed the isolation of homozygous mutant plants from this family. Figure 4Samples 2, 6, 11, 12, 24, and 32 were sampled. Two samples showing homozygous deletion bands were randomly selected and sequenced using primers 26N5-1-CX-F / R. Sequencing revealed a 12-base deletion (TCCTTGCCCATG) at the second exon of OsNramp5. This sample was named Radiation 8612-12. (Details omitted for brevity.) Figure 5 As shown.

[0057] Example 2

[0058] The application of a rice OsNramp5 mutant in the breeding and / or preparation of low-cadmium-accumulation rice products is as follows: using the 8612-12 mutant obtained in Example 1 as the donor parent and hybrid rice backbone restorer lines or sterile lines as recipients, backcrossing is carried out; using a combination of conventional breeding and molecular marker-assisted selection, excellent new restorer lines or sterile lines with low cadmium accumulation characteristics are cultivated; the number of backcrossing generations depends on the performance of the offspring, and backcrossing can be stopped when the main agronomic traits of the backcross offspring reach the breeding target, generally requiring 2 to 6 backcrossing generations.

[0059] To verify the low cadmium accumulation phenotype of Radiant 8612-12, Radiant 8612-12 and normal Huahui 8612 were planted in soil with a cadmium content of 0.217 mg / kg. At the rice maturity stage, roots, stems, leaves, and mature seeds of Radiant 8612-12 and normal Huahui 8612 were collected for cadmium content determination. Figure 6 As shown, the cadmium content in the roots, stems, leaves, and mature seeds of Radiant 8612-12 was significantly lower than that of normal Huahui 8612, indicating that Radiant 8612-12 has the characteristic of low cadmium accumulation.

[0060] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A type of rice OsNramp5 Mutant, characterized by, The encoding OsNramp5 The mutant gene includes the nucleotide sequence shown in SEQ ID NO.

1.

2. The rice as described in claim 1 OsNramp5 The application of mutants in the breeding and / or preparation of low-cadmium-accumulation rice is characterized by, The method for cultivating low-cadmium-accumulation rice is as follows: Using the Huahui 8612 rice variety containing a homozygous OsNramp5 mutant in its genome as the donor, and hybrid rice backbone parents as recipients, backcrossing is performed for improvement; a combination of conventional breeding and indel molecular markers is used to cultivate rice varieties with the aforementioned characteristics. OsNramp5 Rice varieties with low cadmium accumulation due to mutants.

3. The application according to claim 2, characterized in that, The backcrossing improvement process involves 2 to 6 generations.

Images