Host cells and methods for sweet tea catechin production

Abstract

The present invention relates to host cells and methods for catalytically converting steviol to rubusosides. The host cells of the present invention express (1) a glycosyltransferase that glycosylates the hydroxyl group at the C13 position of steviol, (2) a glycosyltransferase that glycosylates the carboxyl group at the C4 position of steviol, and (3) at least one sucrose synthase; and / or contain (a) a coding sequence for a glycosyltransferase that glycosylates the hydroxyl group at the C13 position of steviol, (b) a coding sequence for a glycosyltransferase that glycosylates the carboxyl group at the C4 position of steviol, and (c) a coding sequence for at least one sucrose synthase; and / or contain an expression vector for expressing (1) a glycosyltransferase that glycosylates the hydroxyl group at the C13 position of steviol, (2) a glycosyltransferase that glycosylates the carboxyl group at the C4 position of steviol, and (3) at least one sucrose synthase.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and pharmaceutical technology. Specifically, this invention relates to host cells and methods for the production of stevia. Background Technology

[0002] Sweet tea, also known as sweet-leaved raspberry, is a plant belonging to the genus Rubus in the Rosaceae family. It grows in the southwestern mountainous areas of Guangxi Province, my country, and is a unique, non-toxic, high-sugar, low-calorie natural plant native to Guangxi. Due to its sweet taste and unique flavor, as well as its certain health benefits, the leaves of sweet tea are traditionally used as tea leaves in Guangxi. According to the Guangxi Traditional Chinese Medicine Standards, sweet tea has the effects of clearing heat and reducing inflammation, moistening the lungs and promoting fluid production, relieving cough and eliminating phlegm. It contains catechins, flavonoids, tea polyphenols, protein, amino acids, vitamins, and minerals such as iron, zinc, and calcium. Its main component is the diterpenoid glycoside compound catechins.

[0003] Diterpenoids are an important class of plant-derived secondary metabolites with a wide range of physiological and medicinal activities. Although diterpenoids are widely distributed, their glycosylation modification is relatively rare; only a very few plants in nature, such as stevia, sweet tea, and ashita, can produce glycosylated diterpenoids. These diterpenoid glycosides have enormous development and application potential in the food industry and drug development. Steviatin is a rare glycosylated kauriene-type tetracyclic diterpenoid molecule, formed by the substitution of one molecule of steviol and two molecules of glucose at the C13 and C19 positions of steviol, respectively. Its sweetness is approximately 300 times that of sucrose, while its calories are only 1 / 10 that of sucrose, making it an ideal natural sweetener that can be used as a substitute for saccharin and sucrose in the food and pharmaceutical industries. Because steviatin has a low calorie value, it does not increase cholesterol, does not cause tooth decay, and is suitable for patients with cardiovascular disease, obesity, and diabetes. Stelothin has been widely used in pastries, beverages, canned goods, pharmaceuticals, tobacco, toothpaste, beer, and sauces. Stelothin has effects such as lowering blood pressure and blood sugar, promoting metabolism, and treating hyperacidity. Recent reports indicate that stelothin is the first discovered small molecule compound that can simultaneously inhibit human fructose transporter GLUT5 and glucose transporter GLUT1, exhibiting unique pharmacological activity.

[0004] Like most natural products, stevia is currently mainly obtained through plant extraction, with no reported chemical synthesis methods. The slow growth of plants and the non-renewable nature of plant resources are bottlenecks in natural plant extraction. Furthermore, plant extraction consumes large amounts of organic solvents, and subsequent separation processes are cumbersome, with high industrial-scale equipment costs. Currently, with the development of synthetic biology, using microorganisms as chassis cells to directionally synthesize target products through the introduction of exogenous genes and microbial reactor fermentation is becoming increasingly common. Microorganisms have advantages such as simple genetic manipulation and rapid growth. Compared to traditional plant extraction methods, microbial fermentation offers advantages such as speed, less susceptibility to weather and climate, and easier access to some intermediate products; the yield of some compounds synthesized by microorganisms is far higher than that of plant extraction, making it an important means of obtaining natural products.

[0005] To date, there have been no reports on the efficient synthesis of catechins in Saccharomyces cerevisiae. Therefore, effective exploration is urgently needed in this field to find efficient synthetic routes for such compounds. Summary of the Invention

[0006] The purpose of this invention is to provide a host cell and method for catalytically converting steviol to stevia.

[0007] Specifically, the first aspect of the present invention provides a genetically engineered host cell, wherein the host cell:

[0008] Expression: (1) a glycosyltransferase that glycosylates the C13 hydroxyl group of steviol, (2) a glycosyltransferase that glycosylates the C4 carboxyl group of steviol, and (3) at least one sucrose synthase; and / or

[0009] Contains: (a) a glycosyltransferase encoding a hydroxyl group at the C13 position of steviol, (b) a glycosyltransferase encoding a carboxyl group at the C4 position of steviol, and (c) a glycosyltransferase encoding at least one sucrose synthase; and / or

[0010] Containing an expression vector for expressing: (1) a glycosyltransferase with a C13 hydroxyl group of steviol glycosylated, (2) a glycosyltransferase with a C4 carboxyl group of steviol glycosylated, and (3) at least one sucrose synthase.

[0011] In one or more embodiments, the glycosyltransferase that carboxylates steviol at the C4 position is selected from: (i) glycosyltransferase AkUGT75L21, (ii) glycosyltransferase SrUGT74G1, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 or SrUGT74G1 and which have the biological function of catalyzing the production of stevioside from steviol monosaccharide; preferably, the glycosyltransferase having at least 85% sequence identity with glycosyltransferase SrUGT74G1... Glycosyltransferases that share the same biological function of catalyzing the production of steviosides from steviosides include glycosyltransferase SrUGT74G1 mutants with substitution mutations at one or more of positions 83, 84, 87, 88, 190, and 192, preferably at position 84 and / or 87; preferably, the substitution mutation is the substitution of a wild-type amino acid with one or more of glycine, alanine, leucine, isoleucine, and valine, preferably with alanine.

[0012] In one or more embodiments, the glycosyltransferase that glycosylates the C13 hydroxyl group of steviol is selected from: (i) glycosyltransferase RsUGT85A57, (ii) glycosyltransferase SrUGT85C2, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase RsUGT85A57 or SrUGT85C2 and which have the biological function of catalyzing the production of stevioside 19-O-β-D-glucoside from stevioside.

[0013] In one or more embodiments, the at least one sucrose synthase is selected from: (1) sucrose synthase AtSUS3, (2) sucrose synthase SoSUS2, and (3) a sucrose synthase whose amino acid sequence has at least 85% sequence identity with sucrose synthase AtSUS3 or SoSUS2 while retaining the sucrose synthase function of AtSUS3 or SoSUS2.

[0014] In one or more embodiments, the host cell expresses at least one glycosyltransferase that catalyzes the production of steviol 19-O-β-D-glucoside from steviol, a glycosyltransferase that catalyzes the production of stevioside from steviol 19-O-β-D-glucoside, and at least one sucrose synthase, and optionally also expresses a glycosyltransferase that catalyzes the production of steviol monosaccharide from steviol and / or a glycosyltransferase that catalyzes the production of stevioside monosaccharide to stevioside.

[0015] In one or more embodiments, the host cell contains at least the coding sequence or expression vector of a glycosyltransferase for catalyzing the production of steviol 19-O-β-D-glucoside from steviol, the coding sequence or expression vector of a glycosyltransferase for catalyzing the production of stevioside from steviol 19-O-β-D-glucoside from stevioside, and the coding sequence or expression vector of the at least one sucrose synthase, and optionally further contains the coding sequence or expression vector of a glycosyltransferase for catalyzing the production of steviol monosaccharides from steviol and / or the coding sequence or expression vector of a glycosyltransferase for catalyzing the production of stevioside monosaccharides from stevioside.

[0016] In one or more embodiments, the glycosyltransferases catalyzing the production of steviol 19-O-β-D-glucoside from steviol and catalyzing the production of stevioside monosaccharides from steviol are selected from: (i) glycosyltransferase AkUGT75L21, (ii) glycosyltransferase SrUGT74G1, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 or SrUGT74G1 and which have the biological function of catalyzing the production of steviol 19-O-β-D-glucoside from steviol; preferably, the glycosyltransferases catalyzing the production of steviol 19-O-β-D-glucoside from steviol are selected from: (i) glycosyltransferase AkUGT75L21, (ii) glycosyltransferase SrUGT74G1, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 or SrUGT74G1, and which have the biological function of catalyzing the production of steviol 19-O-β-D-glucoside from steviol; The glycosyltransferase SrUGT74G1 having at least 85% sequence identity and the biological function of catalyzing the production of stevioside from steviosides into stevia is included in glycosyltransferase SrUGT74G1 mutants with substitution mutations at one or more positions selected from positions 83, 84, 87, 88, 190, and 192, preferably at position 84 and / or 87; preferably, the substitution mutation is the substitution of a wild-type amino acid with one or more of glycine, alanine, leucine, isoleucine, and valine, preferably with alanine.

[0017] In one or more embodiments, the glycosyltransferase that catalyzes the production of stevioside 19-O-β-D-glucoside to stevioside is selected from: (i) glycosyltransferase RsUGT85A57, (ii) glycosyltransferase SrUGT85C2, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase RsUGT85A57 or SrUGT85C2 and which have the biological function of catalyzing the production of stevioside 19-O-β-D-glucoside to stevioside.

[0018] In one or more embodiments, the glycosyltransferase that catalyzes the production of steviol monosaccharides is selected from: (i) glycosyltransferase SrUGT85C2, and (ii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase SrUGT85C2 and which have the biological function of catalyzing the production of steviol monosaccharides.

[0019] In one or more embodiments, the at least one sucrose synthase is selected from: (1) sucrose synthase AtSUS3, (2) sucrose synthase SoSUS2, and (3) a sucrose synthase whose amino acid sequence has at least 85% sequence identity with sucrose synthase AtSUS3 or SoSUS2 while retaining the sucrose synthase function of AtSUS3 or SoSUS2.

[0020] In one or more embodiments, the host cell:

[0021] (1) Expressing glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, and sucrose synthase AtSUS3 or SoSUS2; and / or containing the coding sequence or expression vector of glycosyltransferase AkUGT75L21, the coding sequence or expression vector of glycosyltransferase RsUGT85A57, and the coding sequence or expression vector of sucrose synthase AtSUS3 or SoSUS2;

[0022] (2) Expression of glycosyltransferases AkUGT75L21, RsUGT85A57, and SrUGT85C2, and sucrose synthases AtSUS3 or SoSUS2; and / or containing the coding sequence or expression vector of glycosyltransferase AkUGT75L21, the coding sequence or expression vector of glycosyltransferase RsUGT85A57, the coding sequence or expression vector of glycosyltransferase SrUGT85C2, and the coding sequence or expression vector of sucrose synthase AtSUS3 or SoSUS2; or

[0023] (3) Expressing glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, glycosyltransferase SrUGT85C2, glycosyltransferase SrUGT74G1 or its mutants, and sucrose synthase AtSUS3 or SoSUS2; and / or containing the coding sequence or expression vector of glycosyltransferase AkUGT75L21, the coding sequence or expression vector of glycosyltransferase RsUGT85A57, the coding sequence or expression vector of glycosyltransferase SrUGT85C2, the coding sequence or expression vector of glycosyltransferase SrUGT74G1 or its mutants, and the coding sequence or expression vector of sucrose synthase AtSUS3 or SoSUS2;

[0024] Preferably, the mutant of glycosyltransferase SrUGT74G1 includes a glycosyltransferase SrUGT74G1 mutant with a substitution mutation at one or more positions selected from positions 83, 84, 87, 88, 190, and 192 of glycosyltransferase SrUGT74G1, preferably at position 84 and / or 87; preferably, the substitution mutation is the replacement of a wild-type amino acid with one or more of glycine, alanine, leucine, isoleucine, and valine, preferably with alanine.

[0025] In one or more embodiments, the host cell is selected from Escherichia coli and yeast; preferably, the yeast is Saccharomyces cerevisiae.

[0026] A second aspect of the present invention provides a method for producing stevia, the method comprising culturing a host cell as described in any embodiment herein under conditions suitable for the host cell to synthesize stevia, and isolating stevia.

[0027] In one or more embodiments, the culture includes a cell-catalyzed reaction that catalyzes the production of stevia from cells, wherein the catalytic reaction is carried out in the presence of steviol, sucrose, and metal ions, wherein the pH of the catalytic reaction system is 7.2–8.2, and the catalytic reaction is carried out at 25–35°C.

[0028] In one or more embodiments, the metal ion does not include Mn ions and Mg ions; preferably, the metal ion is Co. 2+ Li + and / or Zn 2+ Preferably, the concentration of metal ions in the catalytic reaction system is 0.05–0.20 mM.

[0029] In one or more embodiments, the catalytic reaction system further contains a surfactant, preferably CTAB; preferably, the concentration of the surfactant is 5 to 15 g / L.

[0030] In one or more embodiments, the concentration of steviol in the catalytic reaction system is 1–2 g / L.

[0031] In one or more embodiments, the concentration of sucrose in the catalytic reaction system may be 10–40 g / 100 mL.

[0032] In one or more embodiments, no exogenous UDPG is added to the catalytic reaction system.

[0033] A third aspect of the present invention provides a mutant of the glycosyltransferase SrUGT74G1, wherein the mutant, compared with SEQ ID NO:8, has a substitution mutation at one or more of positions 83, 84, 87, 88, 190 and 192, preferably at position 84 and / or 87.

[0034] In one or more embodiments, the substitution mutation is that the wild-type amino acid residue at the said position is replaced by one or more selected from glycine, alanine, leucine, isoleucine and valine, preferably mutated to alanine.

[0035] In one or more embodiments, the mutant is a single mutant, having an E83A, S84A, E87A, T88A, P190A, or S192A mutation at positions 83, 84, 87, 88, 190, or 192 compared to SEQ ID NO:8; or the mutant is a double mutant, having an S84A and E87A substitution mutation compared to SEQ ID NO:8.

[0036] A fourth aspect of the present invention provides a kit for constructing host cells for producing stevia, the kit comprising an expression vector for expressing: (1) a glycosyltransferase with a C13 hydroxyl group glycosylated by steviol, (2) a glycosyltransferase with a C4 carboxyl group glycosylated by steviol, and (3) at least one sucrose synthase. Preferably, the glycosyltransferase and sucrose synthase are as described in any embodiment herein.

[0037] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0038] Figure 1 Schematic diagram of the stevioside glycosylation pathway.

[0039] Figure 2 Schematic diagram of p85 and pS3, the carriers used in the whole-cell catalytic synthesis of stevia in yeast.

[0040] Figure 3 Schematic diagram of the carriers p5025, pS2, and p8574 used in the whole-cell catalytic synthesis of stevia in yeast.

[0041] Figure 4 sRub1 was used to convert steviol into stevia and its intermediates. (A) HPLC analysis of the sRub1 reaction mixture at a 40% sucrose concentration. (B) Product accumulation of sRub1 at different sucrose concentrations.

[0042] Figure 5 Schematic diagram of two glycosylation pathways of stevioside.

[0043] Figure 6 A comparative schematic diagram of the synthesis of stevia and its intermediates from different engineered strains of stevia.

[0044] Figure 7 : Introducing SrUGT74G1 to enhance the glycosylation of intermediates. (A) Two pathways of steviol glycosylation with the introduction of SrUGT74G1, (B) Product accumulation of sRub6 at different sucrose concentrations.

[0045] Figure 8 The results of the optimization of the optimal reaction conditions for whole-cell catalysis by Saccharomyces cerevisiae. (A) Reaction temperature, (B) Reaction pH, (C) Reaction time, (D) Metal ions.

[0046] Figure 9 (A) Multiple sequence alignment and (B) homology modeling of SrUGT74G1.

[0047] Figure 10 Activity detection of SrUGT74G1 mutant. (A) Product accumulation of yeast strains sRub7 to sRub13 containing different SrUGT74G1 mutants. (B) HPLC analysis of the reaction product of sRub13. Detailed Implementation

[0048] This invention focuses on the research of whole-cell catalytic conversion of steviol to stevia in a microbial chassis of *Saccharomyces cerevisiae*. By introducing genes encoding key glycosyltransferases in the glycosylation pathway of stevia into *Saccharomyces cerevisiae*, these genes are overexpressed in the yeast, along with sucrose synthase. In situ regeneration of uridine diphosphate glucose (UDPG) in a microbial chassis is achieved by coupling sucrose synthase with glycosyltransferase. Furthermore, by constructing recombinant engineered bacteria, a whole-cell catalytic process is established to achieve highly efficient biocatalytic conversion of stevia without the addition of exogenous UDPG.

[0049] the term

[0050] As used herein, a “gene expression cassette” refers to a gene expression system containing all the necessary elements required to express a target polypeptide (an enzyme in this invention), typically including the following elements: a promoter, a gene sequence encoding the polypeptide, and a terminator; additionally, it may optionally include a signal peptide encoding sequence, etc.; these elements are operatively linked.

[0051] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or sequences. For example, a promoter region is placed at a specific position relative to the nucleic acid sequence of a target gene, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby “operationally linked” to the nucleic acid sequence.

[0052] As used herein, an "expression construct" refers to a recombinant DNA molecule containing the intended nucleic acid coding sequence, which may contain one or more gene expression cassettes. These "constructs" are typically contained within an expression vector.

[0053] As used herein, "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, revealing the relationship between proteins (nucleic acids) from different sources and host cells. For example, if the combination of a nucleic acid and a host cell is not typically natural, then the nucleic acid is heterologous to that host cell. A specific sequence is "heterologous" to the cell or organism into which it is inserted.

[0054] host cells

[0055] This invention provides a host cell for the production of stevia. The host cell of this invention is genetically engineered to exogenously introduce glycosyltransferase and sucrose synthase, enabling highly efficient biocatalytic conversion of stevia without the addition of exogenous UDPG.

[0056] Specifically, the present invention provides a genetically engineered host cell, wherein the host cell:

[0057] Expression: (1) a glycosyltransferase that glycosylates the C13 hydroxyl group of steviol, (2) a glycosyltransferase that glycosylates the C4 carboxyl group of steviol, and (3) at least one sucrose synthase; and / or

[0058] Contains: (a) a glycosyltransferase encoding a hydroxyl group at the C13 position of steviol, (b) a glycosyltransferase encoding a carboxyl group at the C4 position of steviol, and (c) a glycosyltransferase encoding at least one sucrose synthase; and / or

[0059] Containing an expression vector for expressing: (1) a glycosyltransferase with a C13 hydroxyl group of steviol glycosylated, (2) a glycosyltransferase with a C4 carboxyl group of steviol glycosylated, and (3) at least one sucrose synthase.

[0060] Preferably, the glycosyltransferase that glycosylates the C13 hydroxyl group of steviol is selected from: (i) glycosyltransferase AkUGT75L21, (ii) glycosyltransferase SrUGT74G1, and (iii) a glycosyltransferase whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 or SrUGT74G1 and which has the biological function of catalyzing the production of stevioside from steviol monosaccharides. Preferably, the amino acid sequence of glycosyltransferase AkUGT75L21 is shown in SEQ ID NO:2; and the amino acid sequence of glycosyltransferase SrUGT74G1 is shown in SEQ ID NO:8. In one or more embodiments, the glycosyltransferase whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 and which has the biological function of catalyzing the production of stevioside from steviol monosaccharides is derived from Angelica keiskei. In one or more embodiments, the glycosyltransferase having at least 85% sequence identity with the glycosyltransferase SrUGT74G1 and having the biological function of catalyzing the production of stevia monosaccharides from stevia rebaudiana is derived from stevia.

[0061] In this document, the glycosyltransferase having at least 85% sequence identity with glycosyltransferase SrUGT74G1 and possessing the biological function of catalyzing the production of stevioside from steviosides to steviosides includes a glycosyltransferase SrUGT74G1 mutant with a substitution mutation at one or more positions selected from positions 83, 84, 87, 88, 190, and 192 of glycosyltransferase SrUGT74G1; preferably, the glycosyltransferase having at least 85% sequence identity with glycosyltransferase SrUGT74G1 and possessing the biological function of catalyzing the production of steviosides to steviosides includes a glycosyltransferase SrUGT74G1 mutant with a substitution mutation at any one or all positions selected from positions 84 and 87 of glycosyltransferase SrUGT74G1. Preferably, the substitution mutation involves replacing a wild-type amino acid with one or more of glycine, alanine, leucine, isoleucine, and valine, preferably with alanine. In some embodiments, the mutant of SrUGT74G1 is a single mutant, with an E83A, S84A, E87A, T88A, P190A, or S192A mutation occurring at positions 83, 84, 87, 88, 190, or 192. In some embodiments, the mutant of SrUGT74G1 is a double mutant, with substitution mutations occurring at any two positions selected from positions 83, 84, 87, 88, 190, and 192; preferably, the amino acid residues at any two positions are mutated to alanine; more preferably, the double mutant is a mutant with substitution mutations at positions 84 and 87, and even more preferably a double mutant with S84A and E87A substitution mutations.

[0062] Preferably, the glycosyltransferase that glycosylates the C4 carboxyl group of steviol is selected from: (i) glycosyltransferase RsUGT85A57, (ii) glycosyltransferase SrUGT85C2, and (iii) glycosyltransferases whose amino acid sequences have at least 85% sequence identity with glycosyltransferase RsUGT85A57 or SrUGT85C2, and which have the biological function of catalyzing the production of stevioside from 19-O-β-D-glucoside. Preferably, the amino acid sequence of glycosyltransferase RsUGT85A57 is shown in SEQ ID NO:4; and the amino acid sequence of glycosyltransferase SrUGT85C2 is shown in SEQ ID NO:6. In one or more embodiments, the glycosyltransferase having at least 85% sequence identity with the glycosyltransferase RsUGT85A57 and possessing the biological function of catalyzing the production of stevioside 19-O-β-D-glucoside to stevioside is derived from the Rubus chingii var. suavissimus. In one or more embodiments, the glycosyltransferase having at least 85% sequence identity with the glycosyltransferase SrUGT85C2 and possessing the biological function of catalyzing the production of stevioside 19-O-β-D-glucoside to stevioside is derived from Stevia rebaudiana.

[0063] Preferably, the at least one sucrose synthase is selected from: (1) sucrose synthase AtSUS3, (2) sucrose synthase SoSUS2, and (3) a sucrose synthase whose amino acid sequence has at least 85% sequence identity with sucrose synthase AtSUS3 or SoSUS2, while retaining the sucrose synthase function of AtSUS3 or SoSUS2. Preferably, the amino acid sequence of sucrose synthase SoSUS2 is shown in SEQ ID NO:10; the amino acid sequence of sucrose synthase AtSUS3 is shown in SEQ ID NO:12. In one or more embodiments, the sucrose synthase whose amino acid sequence has at least 85% sequence identity with sucrose synthase AtSUS3, while retaining the sucrose synthase function of AtSUS3, is derived from Arabidopsis thaliana. In one or more embodiments, the sucrose synthase, which has at least 85% sequence identity with the sucrose synthase SoSUS2 and retains the sucrose synthase function of SoSUS2, is derived from sugarcane (Saccharum hybrid cultivar F36-819).

[0064] In this document, the glycosyltransferase AkUGT75L21 refers to a glycosyltransferase derived from *Angelica keiskei*, preferably the glycosyltransferase with GenBank accession number MG592710.1 (coding sequence as shown in SEQ ID NO:1, amino acid sequence as shown in SEQ ID NO:2). The glycosyltransferase RsUGT85A57 refers to a glycosyltransferase derived from *Rubuschingii var. suavissimus*, preferably the glycosyltransferase with GenBank accession number MG592709.1 (coding sequence as shown in SEQ ID NO:3, amino acid sequence as shown in SEQ ID NO:4). The glycosyltransferase SrUGT85C2 refers to a glycosyltransferase derived from *Stevia rebaudiana*, preferably with the amino acid sequence shown in GenBank accession number AAR06916.1 (amino acid sequence as shown in SEQ ID NO:6). In some preferred embodiments, the present invention uses a non-wild-type SrUGT85C2 glycosyltransferase optimized with E. coli codons (coding sequence as shown in SEQ ID NO:5, amino acid sequence as shown in SEQ ID NO:6). The glycosyltransferase SrUGT74G1 refers to a glycosyltransferase derived from Stevia rebaudiana, preferably with the amino acid sequence shown in GenBank accession number AAR06920.1 (amino acid sequence as shown in SEQ ID NO:8). In some preferred embodiments, the present invention uses a non-wild-type SrUGT74G1 glycosyltransferase optimized with E. coli codons (coding sequence as shown in SEQ ID NO:7, amino acid sequence as shown in SEQ ID NO:8). The sucrose synthase SoSUS2 refers to a sucrose synthase derived from sugarcane (Saccharum hybrid cultivar F36-819), preferably the sucrose synthase with GenBank accession number AF263384 (coding sequence as shown in SEQ ID NO:9, amino acid sequence as shown in SEQ ID NO:10). The sucrose synthase AtSUS3 refers to a sucrose synthase derived from Arabidopsis thaliana, preferably the sucrose synthase with GenBank accession number NM_116461 (the coding sequence is shown in SEQ ID NO:11, and the amino acid sequence is shown in SEQ ID NO:12).

[0065] This document also includes the bioactive fragments of the enzyme and variants of the enzyme or its bioactive fragments. The term "bioactive fragment" means a polypeptide that retains all or part of the function of the full-length enzyme or protein. Typically, the bioactive fragment retains at least 50% of the activity of the full-length enzyme or protein. Under more preferred conditions, the active fragment can retain 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% of the activity of the full-length enzyme or protein.

[0066] In this document, mutants of the enzyme or its biologically active fragments refer to amino acid sequences formed by the substitution, deletion, or addition of one or more amino acid residues. Appropriate amino acid substitutions are techniques well-known in the art, readily implemented, and ensure that the biological activity of the resulting molecule is not altered. These techniques have led those skilled in the art to recognize that, generally, altering a single amino acid in a non-essential region of a polypeptide does not substantially change its biological activity (see Watson et al., Molecular Biology of The Gene, 4th ed., 1987, The Benjamin / Cummings Pub. Co., p. 224). In a particularly preferred embodiment, the invention comprises a protein or enzyme whose amino acid sequence has at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity with the enzyme, while retaining the enzyme's biological activity. Preferably, the variants originate from the same source (e.g., the same plant), such as the glycosyltransferase RsUGT85A57 derived from a Rubus variety, and therefore its variants preferably also originate from a Rubus variety. An exemplary mutant of SrUGT74G1 is described above.

[0067] This invention may also employ modified or improved enzymes or proteins, for example, enzymes or proteins modified or improved to enhance their half-life, effectiveness, metabolism, and / or protein potency. The modified or improved enzyme or protein may be a conjugate, or may contain substituted or artificial amino acids. The modified or improved enzyme or protein may share minor similarities with naturally occurring enzymes or proteins, but still perform the same or substantially the same functions as the wild type without introducing other adverse effects. In other words, any variation that does not affect the biological activity of the enzyme or protein can be used in this invention.

[0068] In this invention, "host cells" include prokaryotic cells and eukaryotic cells. Commonly used prokaryotic host cells include *Escherichia coli* and *Bacillus subtilis*; commonly used eukaryotic host cells include yeast cells, insect cells, and mammalian cells. As a preferred embodiment of this invention, the cells are selected from (but not limited to) *Escherichia coli* and yeast cells. More preferably, the yeast cells are *Saccharomyces cerevisiae*. More preferably, the *Escherichia coli* is selected from DH10; more preferably, the *Saccharomyces cerevisiae* is selected from WAT11.

[0069] In one or more embodiments, the host cell:

[0070] Expression: (1) at least three of the following four glycosyltransferases: a glycosyltransferase that catalyzes the production of steviol 19-O-β-D-glucoside from steviol, a glycosyltransferase that catalyzes the production of stevioside from steviol 19-O-β-D-glucoside, a glycosyltransferase that catalyzes the production of stevioside monosaccharide from steviol, and a glycosyltransferase that catalyzes the production of stevioside monosaccharide from steviol; and (2) at least one sucrose synthase; and / or

[0071] Contains: (a) coding sequences of at least two, preferably at least three, of the following four glycosyltransferases or their expression vectors: a glycosyltransferase that catalyzes the production of steviol 19-O-β-D-glucoside from steviol, a glycosyltransferase that catalyzes the production of stevioside from steviol 19-O-β-D-glucoside, a glycosyltransferase that catalyzes the production of stevioside monosaccharide from steviol, and a glycosyltransferase that catalyzes the production of stevioside monosaccharide to stevioside; and (2) coding sequence of at least one sucrose synthase or its expression vector.

[0072] In one or more embodiments, the glycosyltransferase that catalyzes the production of steviol 19-O-β-D-glucoside is selected from: (i) glycosyltransferase AkUGT75L21, (ii) glycosyltransferase SrUGT74G1, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 or SrUGT74G1 and which have the biological function of catalyzing the production of steviol 19-O-β-D-glucoside.

[0073] In one or more embodiments, the glycosyltransferase that catalyzes the production of stevioside 19-O-β-D-glucoside to stevioside is selected from: (i) glycosyltransferase RsUGT85A57, (ii) glycosyltransferase SrUGT85C2, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase RsUGT85A57 or SrUGT85C2 and which have the biological function of catalyzing the production of stevioside 19-O-β-D-glucoside to stevioside.

[0074] In one or more embodiments, the glycosyltransferase that catalyzes the production of steviol monosaccharides is selected from: (i) glycosyltransferase SrUGT85C2, and (ii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase SrUGT85C2 and which have the biological function of catalyzing the production of steviol monosaccharides.

[0075] In one or more embodiments, the glycosyltransferase that catalyzes the production of stevioside from stevioside is selected from: (i) glycosyltransferase AkUGT75L21, (ii) glycosyltransferase SrUGT74G1, and (iii) glycosyltransferases whose amino acid sequence has at least 85% sequence identity with glycosyltransferase AkUGT75L21 or SrUGT74G1 and which have the biological function of catalyzing the production of stevioside from stevioside.

[0076] In one or more embodiments, the host cell expresses at least the glycosyltransferase that catalyzes the production of steviol 19-O-β-D-glucoside from steviol and the glycosyltransferase that catalyzes the production of stevioside 19-O-β-D-glucoside from stevioside. Preferably, the at least two glycosyltransferases include at least glycosyltransferase AkUGT75L21 and glycosyltransferase RsUGT85A57.

[0077] In one or more embodiments, the host expresses at least one glycosyltransferase that catalyzes the production of steviol 19-O-β-D-glucoside from steviol, one glycosyltransferase that catalyzes the production of stevioside from steviol 19-O-β-D-glucoside, and one glycosyltransferase that catalyzes the production of steviol monosaccharide from steviol. Preferably, the at least two glycosyltransferases include at least glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, and glycosyltransferase SrUGT85C2.

[0078] In one or more embodiments, the host expresses all four glycosyltransferases. Preferably, the at least two glycosyltransferases include glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, glycosyltransferase SrUGT85C2, and glycosyltransferase SrUGT74G1, or mutants thereof.

[0079] In one or more embodiments, the host cell is selected from Escherichia coli and yeast. Preferably, the yeast is Saccharomyces cerevisiae.

[0080] In one or more embodiments, the host cell is *Saccharomyces cerevisiae*, which expresses: (1) glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, and sucrose synthase AtSUS3 or SoSUS2; or (2) glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, glycosyltransferase SrUGT85C2, and sucrose synthase AtSUS3 or SoSUS2; or (3) glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, glycosyltransferase SrUGT85C2, glycosyltransferase SrUGT74G1 or a mutant thereof, and sucrose synthase AtSUS3 or SoSUS2.

[0081] Reagent test kit

[0082] In another aspect, the present invention provides a kit. The kit contains an expression vector for expressing: (1) a glycosyltransferase with a C13 hydroxyl group glycosylated from steviol, (2) a glycosyltransferase with a C4 carboxyl group glycosylated from steviol, and (3) at least one sucrose synthase. Preferably, the glycosyltransferase and sucrose synthase are as described in any of the foregoing embodiments.

[0083] The kit may also contain reagents required to transfer the expression vector into host cells.

[0084] In this invention, the expression vector can be any vector (such as a plasmid or virus) that can be readily subjected to recombinant DNA methods and can result in the expression of the nucleotide sequence of interest. The choice of vector generally depends on the compatibility of the vector with the host cell in which it is introduced. The vector can be a linear or closed circular plasmid.

[0085] The vector can be a self-replicating vector, that is, a vector that exists as an extrachromosomal entity and whose replication does not depend on chromosome replication, such as plasmids, extrachromosomal elements, mini-chromosomes, or artificial chromosomes. The vector can incorporate any means to ensure self-replication. Preferably, the vector of the present invention, after being introduced into a host cell, can integrate into the genome. More preferably, the vector of the present invention, after being introduced into a host cell, can integrate into the genome through homologous recombination with the genome.

[0086] Expression vectors typically contain nucleic acid molecules encoding the enzyme described herein, its biologically active fragments, or variants thereof, and expression regulatory sequences operatively linked to the sequence of the nucleic acid molecule to facilitate protein expression. The design of these expression regulatory sequences is well-known in the art. Depending on the specific needs, inducible or constitutive promoters can be used in the expression regulatory sequences. Inducible promoters enable more controllable protein expression and compound production, which is beneficial for industrial applications.

[0087] The creation of expression vectors is a technique familiar to those skilled in the art. Therefore, once the desired enzyme or protein is known, it is easy for those skilled in the art to create the expression construct. The gene sequence encoding the enzyme or protein can be inserted into different expression constructs (such as expression vectors) or into the same expression construct, as long as the enzyme or protein can be effectively expressed after being transformed into cells.

[0088] In a preferred embodiment, the present invention uses a vector selected from pESC-HIS, pESC-URA and pESC-LEU as a backbone to construct the recombinant expression vector of the present invention.

[0089] Method for catalytic conversion of steviol to stevia

[0090] In another aspect, this invention discloses a method for the whole-cell catalytic conversion of steviol to stevia using a brewer's yeast chassis. By coupling the glycosyltransferase encoding gene in the stevia glycosylation pathway with a sucrose synthase from Arabidopsis thaliana or sugarcane, in-situ regeneration of uridine diphosphate glucose (UDPG) is achieved in a microbial chassis. Furthermore, by constructing recombinant engineered bacteria and establishing a whole-cell catalytic process, highly efficient biocatalytic conversion of stevia is achieved without the addition of exogenous UDPG.

[0091] The stevioside glycosylation conversion pathway of this invention is described in [reference needed]. Figure 7 Stevioside, a universal precursor for stevioside synthesis, is obtained via the action of AkUGT75L21 glycosyltransferase and SrUGT74G1 glycosyltransferase. This precursor is then further processed by SrUGT85C2 glycosyltransferase and RsUGT85A57 glycosyltransferase to form stevioside. Alternatively, a second stevioside glycosylation pathway can be used, where stevioside is used as a precursor via the action of SrUGT85C2 glycosyltransferase to obtain steviol monosaccharide, a universal precursor for stevioside synthesis. This precursor is then further processed by AkUGT75L21 glycosyltransferase and SrUGT74G1 glycosyltransferase or their mutants to form stevioside.

[0092] In some embodiments, the present invention provides a method for producing stevia, the method comprising culturing the host cells described in any embodiment of the invention under conditions suitable for the synthesis of stevia by the host cells, and isolating stevia. Preferably, the culture includes a cell-catalyzed reaction catalyzing the production of stevia by the cells, wherein the catalytic reaction is carried out in the presence of steviol, sucrose, and metal ions, wherein the pH of the catalytic reaction system is 7.2–8.2, and the catalytic reaction is carried out at 25–35°C. Preferably, the metal ions do not include Mn ions and Mg ions; preferably, the metal ions are Co. 2+ Li +and / or Zn 2+ Preferably, the concentration of metal ions in the catalytic reaction system is 0.05–0.20 mM.

[0093] Preferably, the catalytic reaction system further contains a surfactant, preferably CTAB; preferably, the concentration of the surfactant is 5–15 g / L; the concentration of steviol in the catalytic reaction system is 1–2 g / L; and the concentration of sucrose in the catalytic reaction system can be 10–40 g / 100 mL. Preferably, no exogenous UDPG is added to the catalytic reaction system.

[0094] mutant of glycosyltransferase SrUGT74G1

[0095] In one embodiment of the invention, a mutant of the SrUGT74G1 glycosyltransferase is also provided. Specifically, the mutant has a substitution mutation at one or more of positions 83, 84, 87, 88, 190, and 192 compared to the wild-type sequence of the glycosyltransferase SrUGT74G1 (GenBank accession number AAR06920). Preferably, the mutant has a substitution mutation at any one or all of positions 84 and 87 compared to the wild-type sequence.

[0096] Preferably, the substitution mutation is that the wild-type amino acid residue at the said position is replaced by one or more selected from glycine, alanine, leucine, isoleucine and valine, and preferably mutated to alanine.

[0097] Preferably, the mutant of SrUGT74G1 is a single mutant, which, compared with wild-type SrUGT74G1, has an E83A, S84A, E87A, T88A, P190A or S192A mutation at positions 83, 84, 87, 88, 190 or 192.

[0098] Preferably, the mutant of SrUGT74G1 is a double mutant, which, compared with wild-type SrUGT74G1, has substitution mutations at any two positions selected from positions 83, 84, 87, 88, 190, and 192; preferably, the amino acid residues at any two positions are mutated to alanine; more preferably, the double mutant is a mutant with substitution mutations at positions 84 and 87, and even more preferably a double mutant with S84A and E87A substitution mutations.

[0099] The present invention also includes the use of mutants of the glycosyltransferase SrUGT74G1 in the preparation of stevia, including the use in constructing expression vectors for transforming host cells such as Escherichia coli or yeast to produce stevia, and the use in preparing host cells such as Escherichia coli or yeast capable of producing stevia.

[0100] Beneficial effects of the present invention

[0101] The method of this invention increases the proportion of the key final product, catechin, to 74.9%, achieving a yield of 1.92 g / L (3.00 mM). This method can replace plant extraction methods to obtain catechin, which has significant market value, and has broad application prospects and development potential.

[0102] The method of this invention overcomes the shortcomings of traditional plant extraction methods, such as being cumbersome, highly susceptible to environmental impact, and damaging natural resources. It has the advantages of low cost, small footprint, and controllable product quality.

[0103] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as embodiments) can be combined with each other to form preferred technical solutions.

[0104] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Manual* (3rd edition, Science Press, 2002), edited by J. Sambrook et al., or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0105] Materials and methods

[0106] Sugarcane was cultured in the artificial climate chamber of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, using a constant temperature of 20℃.

[0107] Oligonucleotide primers were purchased from Sangon Biotech (Shanghai) Co., Ltd. Codon optimization sequences were synthesized by General Biosystems (Anhui) Co., Ltd.

[0108] The AxyPrep Total RNA Mini-Preparation Kit, Polymerase Chain Reaction (PCR) Gel Extraction Kit, and Plasmid Extraction Kit are all products of Axygen (USA); the PrimeScript RT Reagent Kit with gDNA Eraser (Perfect Real Time) Polymerase Kit and the PrimeSTAR Max DNA Polymerase high-fidelity polymerase are products of Takara Bio Inc. (Japan). Seamless cloning is supported. II One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.). All restriction endonucleases are NEB products.

[0109] Escherichia coli DH10B strain, Saccharomyces cerevisiae WAT11 strain, and pESC-HIS, pESC-URA, and pESC-LEU vectors were used for gene cloning and protein expression.

[0110] The standard compounds steviol and steviol monoside were purchased from Shanghai Yuanye Biotechnology Co., Ltd.; rubusoside was purchased from Nanjing Guangrun Biological Products Co., Ltd.; steviol 19-O-β-D-glucose ester (S19G) was prepared in the laboratory and its structure was confirmed by NMR and MS analysis. Other reagents were domestically produced analytical grade or chromatographic grade reagents, purchased from Sinopharm Chemical Reagent Co., Ltd.

[0111] PCR was performed using an Arktik Thermal Cycler (Thermo Fisher Scientific). High-performance liquid chromatography (HPLC) was performed using a Dionex UltiMate 3000 HPLC system (Thermo Fisher Scientific). High-resolution mass spectrometry (HDMS) was performed using a Thermo Fisher Scientific electrostatic field orbital trap combined mass spectrometer Q Exactive.

[0112] Example 1: Whole-cell catalytic conversion of Saccharomyces cerevisiae to produce catechins

[0113] In this embodiment, the glycosylation pathway of steviol, a stevia aglycone, is as follows: Figure 1 Steviol is catalyzed by glycosyltransferase AkUGT75L21 to produce steviol 19-O-β-D-glucoside, which is then catalyzed by RsUGT85A57 to produce stevia.

[0114] 1. Construction of plasmid p5025 for glycosylation transformation of stevia

[0115] Using the cloning vector RsUGT85A57 (GenBank accession number: MG592709.1) as a template, the RsUGT85A57 fragment was amplified using primer pairs UGT25-F-BamHI / UGT25-R-SalI (Table 1). This fragment was then inserted between SalI and BamHI at multiple cloning site 1 of the pESC-LEU vector using a seamless cloning method. Using the cloning vector AkUGT75L21 (GenBank accession number: MG592710.1) as a template, the AkUGT75L21 fragment was amplified using primer pairs UGT50-F-SpeI / UGT50-R-NotI (Table 1) and then inserted between SpeI and NotI sites at multiple cloning site 2 of the pESC-LEU vector, forming plasmid p5025. Figure 3 The plasmid was transformed into Escherichia coli DH10B, plated on LB solid medium plates containing ampicillin (100 μg / mL), and incubated overnight at 37°C. Transformants were then picked and sequenced for verification.

[0116] Table 1. Primers used to construct the glycosylation transformation plasmid p5025 for catechin.

[0117]

[0118] 2. Construction of stevia-producing strains and establishment of whole-cell yeast catalytic system

[0119] The sequence-verified plasmid p5025 was transformed into competent cells of Saccharomyces cerevisiae WAT11 to obtain an engineered strain, named sRub1.

[0120] Incubate overnight at 30°C in amino acid-deficient SD-LEU medium (with 2% glucose added). Pick a single sRub1 clone and add it to 5 mL of SD-LEU medium, incubate at 30°C and 200 rpm for 24 hours until OD500 is reached. 600The bacterial culture was transferred to a fresh 50 mL SD-LEU medium and incubated at 30°C and 200 rpm for 24 hours. The cells were then collected by centrifugation and transferred to a fresh 50 mL YPL (2% peptone, 1% yeast extract, 2% galactose) medium and incubated at 30°C and 200 rpm for 12 hours. After incubation, the cells were collected by centrifugation, resuspended twice in 100 mM pH 7.6 sodium phosphate buffer, and used for cell catalytic reactions. The catalytic system was 500 μL, prepared with 100 mM pH 7.6 sodium phosphate buffer, containing 0.2 g wet cells, 60 mM trisodium citrate, 1.27 g / L (4 mM) steviol, 10 g / L CTAB, 0.1 mM ZnCl2, and sucrose at a concentration of 0–40 g / 100 mL. The catalytic reaction conditions were 30°C and 24 hours. After the fermentation reaction was completed, 40 μL of the fermentation broth was taken and 160 μL of methanol was added to the reaction solution to precipitate the precipitate. After high-speed centrifugation, 100 μL of the precipitate was taken for HPLC analysis.

[0121] The results are as follows Figure 4 As shown, when sucrose concentration = 40g / 100mL is added to the system ( Figure 4 The conversion system contained 0.11 mM stevia (final product), 0.22 mM steviol 19-O-β-D-glucoside (intermediate), and 3.67 mM steviol (residual substrate). The stevia yield was approximately 68 mg / L, with a conversion rate of 2.66%. No glycosylation products were detected at a sucrose concentration of 0%. As the sucrose concentration increased, stevia, steviol 19-O-β-D-glucoside, and a large amount of unconverted steviol were detected in the reaction solution. Figure 4 (B). This result indicates that yeast itself possesses a certain glycosylation catalytic ability without the addition of exogenous uridine diphosphate glucose (UDPG), but it failed to achieve sufficient glycosylation of the substrate, suggesting that further efforts are needed to improve glycosylation efficiency by increasing the supply of UDPG and improving glycosyltransferases.

[0122] Example 2: Production of stevia in a whole-cell yeast catalytic system using sucrose synthase coupled with glycosyltransferase.

[0123] The glycosylation pathway in this embodiment further introduces the glycosyltransferase SrUGT85C2 based on Example 1. SrUGT85C2 can glycosylate the intermediate steviol 19-O-β-D-glucoside, reducing the accumulation of this intermediate. Figure 5Simultaneously, SrUGT85C2 can glycosylate the aglycone steviol to produce the intermediate steviolmonoside, which can be converted into stevioside via AkUGT75L21 catalysis, thus forming a two-pathway glycosylation system. Figure 5 In this embodiment, the introduction of sucrose synthases from different sources is also considered to enable the cyclic regeneration of UDPG and improve the endogenous supply of UDPG.

[0124] 1. Construction of glycosylation transformation plasmid p85

[0125] Using the cloning vector of SrUGT85C2 (encoding protein GenBank accession number: AAR06916, nucleic acid sequence optimized by codons) as a template, the SrUGT85C2 fragment was amplified using primer pairs 85C2-F-BamHI / 85C2-R-SalI (Table 2). This fragment was then inserted between SalI and BamHI at the multiple cloning site 1 of the pESC-URA vector using a seamless cloning method to form plasmid p85( Figure 2 The plasmid was transformed into Escherichia coli DH10B, plated on LB solid medium plates containing ampicillin (100 μg / mL), and incubated overnight at 37°C. Transformants were then picked and sequenced for verification.

[0126] Table 2. Primers used for constructing glycosylation transformation plasmid p85, sucrose synthase expression vectors pS2 and pS3

[0127]

[0128] 2. Construction of sucrose synthase expression vectors pS2 and pS3

[0129] Using the cloning vector AtSUS3 (GenBank accession number: NM_116461) as a template, the AtSUS3 fragment was amplified using primer pairs SUS3-F-BamHI / SUS3-R-SalI (Table 2). This fragment was then inserted between SalI and BamHI at the multiple cloning site 1 of the pESC-HIS vector using a seamless cloning method to obtain the plasmid pS3( Figure 2 Using sugarcane cDNA as a template, the SoSUS2 fragment was amplified using SUS1-F-BamHI / SUS1-R-SalI (Table 2) primer pairs. The cloned SoSUS2 fragment showed 99.63% sequence similarity in both nucleic acid and protein to sucrose synthase-1 (GenBank accession number: AF263384) from cultivated sugarcane (Saccharum spp. hybrids). This fragment was then inserted between SalI and BamHI at the multiple cloning site 1 of the pESC-HIS vector using a seamless cloning method to obtain the plasmid pS2. Figure 3 The plasmid was transformed into Escherichia coli DH10B, plated on LB solid medium plates containing ampicillin (100 μg / mL), and incubated overnight at 37°C. Transformants were then picked and sequenced for verification.

[0130] 3. Optimization of whole-cell catalytic strains

[0131] The engineered strain sRub2 was obtained by co-transforming plasmids p5025 and pS3 into competent cells of *Saccharomyces cerevisiae* WAT11. The engineered strain sRub3 was obtained by co-transforming plasmids p5025, p85, and pS3 into competent cells of *Saccharomyces cerevisiae* WAT11. The engineered strain sRub4 was obtained by co-transforming plasmids p5025, p85, and pS2 into competent cells of *Saccharomyces cerevisiae* WAT11. The engineered strain sRub5 was obtained by co-transforming plasmids p5025, p85, and pS2 into competent cells of *Saccharomyces cerevisiae* WAT11.

[0132] Incubate overnight at 30°C using suitable amino acid-deficient SD medium (sRub2 uses SD-LEU-HIS, sRub3 uses SD-LEU-HIS, sRub4 uses SD-LEU-HIS-URA, and sRub5 uses SD-LEU-HIS-URA). Pick a single clone and add it to 5 mL of amino acid-deficient SD medium, incubate at 30°C and 200 rpm for 24 hours until OD500. 600 The bacterial culture was transferred to a fresh 50 mL amino acid-deficient SD medium and incubated at 30°C and 200 rpm for 24 hours. The cells were then collected by centrifugation and transferred to a fresh 50 mL YPL (2% peptone, 1% yeast extract, 2% galactose) medium and incubated at 30°C and 200 rpm for 12 hours. After incubation, the cells were collected by centrifugation, resuspended twice in 100 mM pH 7.6 sodium phosphate buffer, and used for cell catalysis. The catalytic system was 500 μL, prepared with 100 mM pH 7.6 sodium phosphate buffer, containing 0.2 g wet cells, 60 mM trisodium citrate, 1.27 g / L (4 mM) steviol, 10 g / L CTAB, 0.1 mM ZnCl2, and 40 g / 100 mL sucrose per mL. The catalytic reaction conditions were 30°C and 24 hours. After the fermentation reaction was completed, 40 μL of the fermentation broth was taken and 160 μL of methanol was added to the reaction solution to precipitate the precipitate. After high-speed centrifugation, 100 μL of the precipitate was taken for HPLC analysis.

[0133] The results are as follows Figure 6As shown, compared with the control strain sRub1, the sRub2 strain with the introduction of Arabidopsis-derived sucrose synthase AtSUS3 exhibited significantly improved glycosylation efficiency. In the reaction system, stevia accounted for 26.6%, the intermediate steviol 19-O-β-D-glucoside for 25.0%, and unreacted substrate steviol for 48.4%, with a stevia yield of 683 mg / L (1.06 mM). Similarly, the sRub3 strain with the introduction of sugarcane-derived sucrose synthase SoSUS2 also showed significantly improved glycosylation efficiency. In the reaction system, stevia accounted for 41.8%, the intermediate steviol 19-O-β-D-glucoside for 23.1%, and unreacted substrate steviol for 35.1%, with a stevia yield of 1.07 g / L (1.67 mM). This result indicates that the sugarcane-derived SoSUS2 has a superior UDPG recycling capacity compared to the Arabidopsis-derived AtSUS3.

[0134] Because the products of sRub2 and sRub3 contain a significant amount of steviol 19-O-β-D-glucoside, we further introduced SrUGT85C2 to transform this intermediate. Figure 6 As shown, in engineered bacteria sRub4 and sRub5, the proportion of steviol 19-O-β-D-glucoside was significantly reduced or even disappeared, and the residue of the substrate steviol was also significantly reduced, mainly because SrUGT85C2 converted steviol into steviol monosaccharide ( Figure 5 The stevia yield of strain sRub4 was 1.04 g / L (1.62 mM), and that of strain sRub5 was 1.34 g / L (2.09 mM). The transformation product of strain sRub5 contained 52.4% stevia, 1.2% intermediate steviol 19-O-β-D-glucoside, 35.7% intermediate steviol monosaccharide, and 10.7% unreacted substrate steviol.

[0135] Example 3: Optimization of conditions for the whole-cell catalytic system for the production of stevia by tetraglycosyltransferase coupled with sucrose synthase.

[0136] Since some intermediates, steviol monosaccharide and aglycone steviol, remained unconverted in strains sRub4 and sRub5 in Example 2, it was considered to introduce SrUGT74G1 from stevia to convert the remaining substrate. The dual-pathway glycosylation system in this example is as follows: Figure 7 SrUGT74G1 catalyzes the 19-O-glycosylation of the aglycone steviol and the intermediate steviol monosaccharide, respectively.

[0137] 1. Construction of glycosylation transformation plasmid p8574

[0138] Using the cloning vector of SrUGT74G1 (encoding protein GenBank accession number: AAR06920, nucleic acid sequence optimized by codons) as a template, after amplification with primer pair 74G1-F-SpeI / 74G1-R-NotI (Table 3), it was inserted between the SpeI and NotI sites of the multiple cloning site 2 of the constructed vector p85 to form plasmid p8574. Figure 3 The plasmid was transformed into Escherichia coli DH10B, plated on LB solid medium plates containing ampicillin (100 μg / mL), and incubated overnight at 37°C. Transformants were then picked and sequenced for verification.

[0139] Table 3. Primers used to construct glycosylation transformation plasmid p8574

[0140]

[0141]

[0142] 3. Establishment of whole-cell catalytic strains and optimization of reaction conditions

[0143] Plasmids p5025, p8574, and pS2 were co-transformed into competent cells of Saccharomyces cerevisiae WAT11 to obtain the engineered strain sRub6.

[0144] Incubate overnight at 30°C in suitable amino acid-deficient SD-LEU-HIS-URA medium (with 2% glucose added). Pick a single clone and transfer it to 5 mL of amino acid-deficient SD medium, incubate at 30°C and 200 rpm for 24 hours until OD500. 600 The bacterial culture was transferred to a fresh 50 mL amino acid-deficient SD medium and incubated at 30°C and 200 rpm for 24 hours. The cells were then collected by centrifugation and transferred to a fresh 50 mL YPL (2% peptone, 1% yeast extract, 2% galactose) medium and incubated at 30°C and 200 rpm for 12 hours. After incubation, the cells were collected by centrifugation, resuspended twice in 100 mM pH 7.6 sodium phosphate buffer, and used for cell catalysis. The catalytic system was 500 μL, prepared with 100 mM pH 7.6 sodium phosphate buffer, containing 0.2 g wet cells, 60 mM trisodium citrate, 1.27 g / L (4 mM) steviol, 10 g / L CTAB, 0.1 mM ZnCl2, and sucrose at a concentration of 0–40 g / 100 mL by mass percentage. The catalytic reaction conditions were: reaction temperature 30°C, reaction time 24 hours. After the fermentation reaction was completed, 40 μL of the fermentation broth was taken and 160 μL of methanol was added to the reaction solution to precipitate the precipitate. After high-speed centrifugation, 100 μL of the precipitate was taken for HPLC analysis.

[0145] Analysis results as follows Figure 7As shown in (B), with the addition of 40% sucrose, the proportion of the final product stevia in the reaction mixture of sRub6 increased to 61.0%, with a yield of 1.57 g / L (2.44 mM), while the accumulation of the substrate steviol decreased to 7.2%. The proportion of glycosylated products gradually increased with increasing sucrose concentration. Without the addition of sucrose, the reaction mixture contained 14.1% stevia, 45.4% steviol monosaccharide, 5.7% steviol 19-O-β-D-glucoside, and 34.8% unreacted substrate steviol.

[0146] Based on the engineered strain sRub6, multiple factors that may affect the catalytic activity of glycosylation were investigated through single-factor experiments, including (1) reaction temperature, (2) reaction pH, (3) reaction time, and (4) metal ions. Figure 8 We found that the optimal reaction temperature for the reaction system was 30℃, and the optimal pH was 7.4 (not significantly different from the initial control pH 7.6). While extending the reaction time could increase the yield of catechins to some extent, the yield per unit time was not advantageous; therefore, the appropriate reaction time should be selected within 12–24 hours. Among metal cations, Mn... 2+ and Mg 2+ It has a negative impact on the glycosylation efficiency of whole-cell catalytic systems, therefore Co 2+ and Li + Compared with control Zn 2+ There was no significant difference compared to the initial conditions, therefore the Zn used in the initial conditions is still adopted. 2+ That would be the best.

[0147] Example 4: Production of stevia by SrUGT74G1 mutant tetraglycosyltransferase coupled with sucrose synthase.

[0148] Since some intermediate steviol monosaccharide and aglycone steviol remained untransformed in strain sRub6 in Example 3, it was considered to continue mutagenesis of SrUGT74G1 to transform the remaining substrate. Multiple sequence alignment was performed to compare the sequence of SrUGT74G1 with that of other UGT74 family glycosyltransferases (including SgUGT74AC1 from *Siraitia grosvenorii*, AtUGT74F2 from *Arabidopsis thaliana*, and Os79 from rice). Figure 9We used SgUGT74AC1 (PDB ID: 6L8Z) as a template to construct a structural model of SrUGT74G1 based on homology modeling. According to the model, we believe that mutations in six adjacent residues on the α3 and α7 helices (Glu83, Ser84, Glu87, Thr88, Pro190, and Ser192) may affect the orientation of key residues Y85 / L86 and W191, thereby influencing the catalytic activity and substrate specificity of SrUGT74G1. Figure 9 (B). We performed an alanine scan on the above 6 residues and double-mutated Ser84 and Glu87, which showed improved activity.

[0149] 1. Construction of the glycosylation transformation plasmid p8574- mutant

[0150] Using the cloning vector SrUGT74G1 (encoding protein GenBank accession number: AAR06920, nucleic acid sequence optimized by codons) as a template, after amplification using the primers in Table 4, it was inserted between the SpeI and NotI sites of the multiple cloning site 2 of the constructed vector p85 to form the plasmid p8574-mutant(74G1). E83A 74G1 S84A 74G1 E87A 74G1 T88A 74G1 P190A 74G1 S192A 74G1 S84A / E87A The mutant plasmid was transformed into Escherichia coli DH10B, plated on LB agar plates containing ampicillin (100 μg / mL), and incubated overnight at 37°C. Transformants were then picked and sequenced for verification.

[0151] Table 4. Primers used to construct the glycosylation transformation plasmid p8574-mutant

[0152]

[0153] 3. Establishment of whole-cell catalytic strains

[0154] Plasmids p5025, pS2, and p8574-mutant(74G1) were added. E83A 74G1 S84A 74G1 E87A 74G1 T88A 74G1 P190A 74G1 S192A 74G1 S84A / E87AThey were transformed together into competent cells of Saccharomyces cerevisiae WAT11 to obtain engineered strains sRub7, sRub8, sRub9, sRub10, sRub11, sRub12, and sRub13, respectively.

[0155] Incubate overnight at 30°C in suitable amino acid-deficient SD-LEU-HIS-URA medium (with 2% glucose added). Pick a single clone and transfer it to 5 mL of amino acid-deficient SD medium, incubate at 30°C and 200 rpm for 24 hours until OD500. 600 The bacterial culture was transferred to a fresh 50 mL amino acid-deficient SD medium and incubated at 30°C and 200 rpm for 24 hours. The cells were then collected by centrifugation and transferred to a fresh 50 mL YPL (2% peptone, 1% yeast extract, 2% galactose) medium and incubated at 30°C and 200 rpm for 12 hours. After incubation, the cells were collected by centrifugation, resuspended twice in 100 mM pH 7.6 sodium phosphate buffer, and used for cell catalysis. The catalytic system was 500 μL, prepared with 100 mM pH 7.6 sodium phosphate buffer, containing 0.2 g wet cells, 60 mM trisodium citrate, 1.27 g / L (4 mM) steviol, 10 g / L CTAB, 0.1 mM ZnCl2, and 40 g / 100 mL sucrose per mL. The catalytic reaction conditions were 30°C and 24 hours. After the fermentation reaction was completed, 40 μL of the fermentation broth was taken and 160 μL of methanol was added to the reaction solution to precipitate the precipitate. After high-speed centrifugation, 100 μL of the precipitate was taken for HPLC analysis.

[0156] Analysis results as follows Figure 10 As shown, with the addition of 40% sucrose, the proportion of the final product stevioside in the reaction mixture of sRub13 increased to 74.9%, the yield reached 1.92 ± 0.17 g / L (3.00 mM), the content of stevioside monosaccharide decreased to 23.3%, there was no accumulation of steviol 19-O-β-D-glucoside, and the accumulation of substrate steviol decreased to 1.8%.

[0157] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Host cells and methods for the production of betaine <130> 215418 <160> 38 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1434 <212> DNA <213> Angelica keiskei <400> 1 atggcaaacc aacgtcacat cctcctcata acattcccgg cacaaggcca cataaatccc 60 agcctccaat tttccaagaa acttacaagg atgggggttg aagttacatt tgcaaccagt 120 ttgtcagccc acagccgcat ggccaacact ctagcagcta caaaaggcct taatatcgct 180 cccttctccg atggctatga tgatggcttc aagcttactg atgatgctaa gcatttcatg 240 tcctccatac gtaaccacgg atccgagagt gtcaaacaaa tattacgttc tagtgctgag 300 caaggccgcc ctgttagttg tgttgtgtac acacttcttc tcccatgggt ggcagaggtg 360 gcccgtgaat ttcacgtgcc gtctgccctc ctttggattc aacctgcttc tgttttggat 420 atttactact actatttcaa tgggtatggt gaggccatga acgattgttt agatgacccc 480 tcttggtcaa tacaattacc tggtttgcca ctcctccatg cacgtgacct tccttcgttt 540 atacttccta catgccacga aatgtacagt tttgctctcc catcattcaa agagcagctc 600 gatgcactga atgcggatga aaggcctatg gtgcttgtaa attcttttga tgcactggaa 660 tcggaggctc tcaaagcaat caaaaagctc gagttgattg caatcggtcc ggtccttcca 720 tcagctttct tggatggcaa ggatccttcg gacacttcag ttggaggtga cctattccaa 780 aaatcaagaa actacagaga ttggttggat gccaagcctc ccaaatccgt gatttatata 840 tcattcggaa gtatattaac attgtcaaag cctcagatga acgagattgg aaaaggcttg 900 ctaaaaagtg gaatgccatt tttgtgggtg ataaggaaaa aagaaggcga atcaagcggg 960 caacaagtag aggaagagga attaagtggc agggaggaat tggaaaaaca aggaatgata 1020 gtgccatggt gtagtcaact agaagtactg tcacaccctg cactaggatg tttcgtgacg 1080 cattgcggtt ggaattcgac attggagagt ttggtttcga gggttccggt ggtggcattt 1140 ccgcattgga cggatcagac gacaaatgcg aagttgatag aagatgtgtg gaagacggga 1200 gtgagagtga gagtaaatgg taatgaagga atggttgatg gtgatgaagt tgataggtgc 1260 atagaaatgg tgatgggaaa tgaagaattg agaagcaatg caaagaaatg gggtgatttg 1320 gctagggaag caataagtga aggtggatct tcggataaga atctaaaggc ttttgtggaa 1380 catgttgatc accaagtcac acccacggga tgtctcgaga gcagtggcgc ttaa 1434 <210> 2 <211> 477 <212> PRT <213> Angelica keiskei <400> 2 Met Ala Asn Gln Arg His Ile Leu Leu Ile Thr Phe Pro Ala Gln Gly 1 5 10 15 His Ile Asn Pro Ser Leu Gln Phe Ser Lys Lys Leu Thr Arg Met Gly 20 25 30 Val Glu Val Thr Phe Ala Thr Ser Leu Ser Ala His Ser Arg Met Ala 35 40 45 Asn Thr Leu Ala Ala Thr Lys Gly Leu Asn Ile Ala Pro Phe Ser Asp 50 55 60 Gly Tyr Asp Asp Gly Phe Lys Leu Thr Asp Asp Ala Lys His Phe Met 65 70 75 80 Ser Ser Ile Arg Asn His Gly Ser Glu Ser Val Lys Gln Ile Leu Arg 85 90 95 Ser Ser Ala Glu Gln Gly Arg Pro Val Ser Cys Val Val Tyr Thr Leu 100 105 110 Leu Leu Pro Trp Val Ala Glu Val Ala Arg Glu Phe His Val Pro Ser 115 120 125 Ala Leu Leu Trp Ile Gln Pro Ala Ser Val Leu Asp Ile Tyr Tyr Tyr 130 135 140 Tyr Phe Asn Gly Tyr Gly Glu Ala Met Asn Asp Cys Leu Asp Asp Pro 145 150 155 160 Ser Trp Ser Ile Gln Leu Pro Gly Leu Pro Leu Leu His Ala Arg Asp 165 170 175 Leu Pro Ser Phe Ile Leu Pro Thr Cys His Glu Met Tyr Ser Phe Ala 180 185 190 Leu Pro Ser Phe Lys Glu Gln Leu Asp Ala Leu Asn Ala Asp Glu Arg 195 200 205 Pro Met Val Leu Val Asn Ser Phe Asp Ala Leu Glu Ser Glu Ala Leu 210 215 220 Lys Ala Ile Lys Lys Leu Glu Leu Ile Ala Ile Gly Pro Val Leu Pro 225 230 235 240 Ser Ala Phe Leu Asp Gly Lys Asp Pro Ser Asp Thr Ser Val Gly Gly 245 250 255 Asp Leu Phe Gln Lys Ser Arg Asn Tyr Arg Asp Trp Leu Asp Ala Lys 260 265 270 Pro Pro Lys Ser Val Ile Tyr Ile Ser Phe Gly Ser Ile Leu Thr Leu 275 280 285 Ser Lys Pro Gln Met Asn Glu Ile Gly Lys Gly Leu Leu Lys Ser Gly 290 295 300 Met Pro Phe Leu Trp Val Ile Arg Lys Lys Glu Gly Glu Ser Ser Gly 305 310 315 320 Gln Gln Val Glu Glu Glu Glu Leu Ser Gly Arg Glu Glu Leu Glu Lys 325 330 335 Gln Gly Met Ile Val Pro Trp Cys Ser Gln Leu Glu Val Leu Ser His 340 345 350 Pro Ala Leu Gly Cys Phe Val Thr His Cys Gly Trp Asn Ser Thr Leu 355 360 365 Glu Ser Leu Val Ser Arg Val Pro Val Val Ala Phe Pro His Trp Thr 370 375 380 Asp Gln Thr Thr Asn Ala Lys Leu Ile Glu Asp Val Trp Lys Thr Gly 385 390 395 400 Val Arg Val Arg Val Asn Gly Asn Glu Gly Met Val Asp Gly Asp Glu 405 410 415 Val Asp Arg Cys Ile Glu Met Val Met Gly Asn Glu Glu Leu Arg Ser 420 425 430 Asn Ala Lys Lys Trp Gly Asp Leu Ala Arg Glu Ala Ile Ser Glu Gly 435 440 445 Gly Ser Ser Asp Lys Asn Leu Lys Ala Phe Val Glu His Val Asp His 450 455 460 Gln Val Thr Pro Thr Gly Cys Leu Glu Ser Ser Gly Ala 465 470 475 <210> 3 <211> 1446 <212> DNA <213> Rubus chingii var. suavissimus <400> 3 atggcttctg gttataatca taagcctcat gctgtttgta ttccagctcc tgctcaaagc 60 cacattaagg ctatgcttaa attagccaaa atcctccatc acagaggctt tcacattacc 120 tttgtcaaca cagaattcaa ccacaaacga tttcttgagt caagaggtcc taactccctc 180 gatggcttac ctgattttca ctttgaagcc atccctgatg gatttccaga atcaggtgaa 240 gatccaacgc aagatatcac tgtgcttatt gaatccgtca gaatccatct tttggctcca 300 tttcgggacc tcctgataaa actcaacagt actagttctc cagtgacttg cattttttca 360 gatggttca tgtccgcttt taccaccaga gctgccgagg aacttggaat tcctattgca 420 ttgatctaca ctatttctgc ttgcagcttc atgggattaa ggaaattccg cactttgctt 480 gagaaaggac ttgcaccact caaagatgag agctgtatga caaatgggtt tctggacaaa 540 gttatagaat ggattccgag aaagaaagat atccgattat gggatctacc aagcttttgc 600 cgaactacaa atcctgatga catcatgttc cactacacca tggaagctgc tgaagaagca 660 aataaagctt cagccgttgt tcttctcaca tatgatgctt tggaaaaaga tgttttggaa 720 gttctctcct catctatttc tccaccagtt tatactattg gtcctctcca attgcttcta 780 gatcaaatag cagaagacccc tttgaagcct atgggataca gtctttggaa ggaggaaaca 840 gactgtctcc aatggctaca gtctaaggca caaactcaa ttgtttatgt caatttttggc 900 agcatcgcgg tttgacacc tgaacagctg gttgagtttg gttggggact ggctaatacc 960 aagcttccct tcttctgggt cattaggcct gatttggttg ttggaaattc ggcgatttg 1020 ccaccggagt tcgaaactga aaccaaagac agaggtctaa tagccagttg gtgcccccaa 1080 gaacaagtcc taaaccatcc atcagttgga ggatttctca cacacagtgg ttggaattca 1140 atcattgaga gtgtaacagc tggagtgccg atgctgtgtt ggccattctt tgcagaccag 1200 caaacaaaca gttactacac ttgcaatgaa tggggtattg gcatggagat caatagtaac 1260 gtaaagagag acaatgtgga gaagcttgta agggagttaa tggacggaga gaagggtaag 1320 aagatgaaaa acaaggtctt ggagtggaag agacttgctg aagaagccac agctccacat 1380 ggttcttcat caacaaactt ggacaattta gtgaatcaag tcctattaag gaagcgcacg 1440 tactag 1446 <210> 4 <211> 481 <212> PRT <213> Rubus chingii var. suavissimus <400> 4 Met Ala Ser Gly Tyr Asn His Lys Pro His Ala Val Cys Ile Pro Ala 1 5 10 15 Pro Ala Gln Ser His Ile Lys Ala Met Leu Lys Leu Ala Lys Ile Leu 20 25 30 His His Arg Gly Phe His Ile Thr Phe Val Asn Thr Glu Phe Asn His 35 40 45 Lys Arg Phe Leu Glu Ser Arg Gly Pro Asn Ser Leu Asp Gly Leu Pro 50 55 60 Asp Phe His Phe Glu Ala Ile Pro Asp Gly Phe Pro Glu Ser Gly Glu 65 70 75 80 Asp Pro Thr Gln Asp Ile Thr Val Leu Ile Glu Ser Val Arg Ile His 85 90 95 Leu Leu Ala Pro Phe Arg Asp Leu Leu Ile Lys Leu Asn Ser Thr Ser 100 105 110 Ser Pro Val Thr Cys Ile Phe Ser Asp Gly Phe Met Ser Ala Phe Thr 115 120 125 Thr Arg Ala Ala Glu Glu Leu Gly Ile Pro Ile Ala Leu Ile Tyr Thr 130 135 140 Ile Ser Ala Cys Ser Phe Met Gly Leu Arg Lys Phe Arg Thr Leu Leu 145 150 155 160 Glu Lys Gly Leu Ala Pro Leu Lys Asp Glu Ser Cys Met Thr Asn Gly 165 170 175 Phe Leu Asp Lys Val Ile Glu Trp Ile Pro Arg Lys Lys Asp Ile Arg 180 185 190 Leu Trp Asp Leu Pro Ser Phe Cys Arg Thr Thr Asn Pro Asp Asp Ile 195 200 205 Met Phe His Tyr Thr Met Glu Ala Ala Glu Glu Ala Asn Lys Ala Ser 210 215 220 Ala Val Val Leu Leu Thr Tyr Asp Ala Leu Glu Lys Asp Val Leu Glu 225 230 235 240 Val Leu Ser Ser Ser Ile Ser Pro Pro Val Tyr Thr Ile Gly Pro Leu 245 250 255 Gln Leu Leu Leu Asp Gln Ile Ala Glu Asp Pro Leu Lys Pro Met Gly 260 265 270 Tyr Ser Leu Trp Lys Glu Glu Thr Asp Cys Leu Gln Trp Leu Gln Ser 275 280 285 Lys Ala Pro Asn Ser Ile Val Tyr Val Asn Phe Gly Ser Ile Ala Val 290 295 300 Leu Thr Pro Glu Gln Leu Val Glu Phe Gly Trp Gly Leu Ala Asn Thr 305 310 315 320 Lys Leu Pro Phe Phe Trp Val Ile Arg Pro Asp Leu Val Val Gly Asn 325 330 335 Ser Ala Ile Leu Pro Pro Glu Phe Glu Thr Glu Thr Lys Asp Arg Gly 340 345 350 Leu Ile Ala Ser Trp Cys Pro Gln Glu Gln Val Leu Asn His Pro Ser 355 360 365 Val Gly Gly Phe Leu Thr His Ser Gly Trp Asn Ser Ile Ile Glu Ser 370 375 380 Val Thr Ala Gly Val Pro Met Leu Cys Trp Pro Phe Phe Ala Asp Gln 385 390 395 400 Gln Thr Asn Ser Tyr Tyr Thr Cys Asn Glu Trp Gly Ile Gly Met Glu 405 410 415 Ile Asn Ser Asn Val Lys Arg Asp Asn Val Glu Lys Leu Val Arg Glu 420 425 430 Leu Met Asp Gly Glu Lys Gly Lys Lys Met Lys Asn Lys Val Leu Glu 435 440 445 Trp Lys Arg Leu Ala Glu Glu Ala Thr Ala Pro His Gly Ser Ser Ser 450 455 460 Thr Asn Leu Asp Asn Leu Val Asn Gln Val Leu Leu Arg Lys Arg Thr 465 470 475 480 Tyr <210> 5 <211> 1446 <212> DNA <213> Artificial Sequence <400> 5 atggacgcga tggcgaccac cgaaaaaaaa ccgcacgtta tcttcatccc gttcccggcg 60 cagtctcaca tcaaagcgat gctgaaactg gcgcagctgc tgcaccacaa aggtctgcag 120 atcaccttcg ttaacaccga cttcatccac aaccagttcc tggaatcttc tggtccgcac 180 tgcctggacg gtgcgccggg tttccgtttc gaaaccatcc cggacggtgt ttctcactct 240 ccggaagcgt ctatcccgat ccgtgaatct ctgctgcgtt ctatcgaaac caacttcctg 300 gaccgtttca tcgacctggt taccaaactg ccggacccgc cgacctgcat catctctgac 360 ggtttcctgt ctgttttcac catcgacgcg gcgaaaaaac tgggtatccc ggttatgatg 420 tactggaccc tggcggcgtg cggtttcatg ggtttctacc acatccactc tctgatcgaa 480 aaaggtttcg cgccgctgaa agacgcgtct tacctgacca acggttacct ggacaccgtt 540 atcgactggg ttccgggtat ggaaggtatc cgtctgaaag acttcccgct ggactggtct 600 accgacctga acgacaaagt tctgatgttc accaccgaag cgccgcagcg ttctcacaaa 660 gtttctcacc acatcttcca caccttcgac gaactggaac cgtctatcat caaaaccctg 720 tctctgcgtt acaaccacat ctacaccatc ggtccgctgc agctgctgct ggaccagatc 780 ccggaagaaa aaaaacagac cggtatcacc tctctgcacg gttactctct ggttaaagaa 840 gaaccggaat gcttccagtg gctgcagtct aaagaaccga actctgttgt ttacgttaac 900 ttcggttcta ccaccgttat gtctctggaa gacatgaccg aattcggttg gggtctggcg 960 aactctaacc actacttcct gtggatcatc cgttctaacc tggttatcgg tgaaaacgcg 1020 gttctgccgc cggaactgga agaacacatc aaaaaacgtg gtttcatcgc gtcttggtgc 1080 tctcaggaaa aagttctgaa acacccgtct gttggtggtt tcctgaccca ctgcggttgg 1140 ggttctacca tcgaatctct gtctgcgggt gttccgatga tctgctggcc gtactcttgg 1200 gaccagctga ccaactgccg ttacatctgc aaagaatggg aagttggtct ggaaatgggt 1260 accaaagtta aacgtgacga agttaaacgt ctggttcagg aactgatggg tgaaggtggt 1320 cacaaaatgc gtaacaaagc gaaagactgg aaagaaaaag cgcgtatcgc gatcgcgccg 1380 aacggttctt cttctctgaa catcgacaaa atggttaaag aaatcaccgt tctggcgcgt 1440 aactaa 1446 <210> 6 <211> 481 <212> domestic worker <213> Stevia rebaudiana <400> 6 Met Asp Ala Met Ala Thr Thr Glu Lys Lys Pro His Val Ile Phe Ile 1 5 10 15 Pro Phe Pro Ala Gln Ser His Ile Lys Ala Met Leu Lys Leu Ala Gln 20 25 30 Leu Leu His His Lys Gly Leu Gln Ile Thr Phe Val Asn Thr Asp Phe 35 40 45 Ile His Asn Gln Phe Leu Glu Ser Ser Gly Pro His Cys Leu Asp Gly 50 55 60 Ala Pro Gly Phe Arg Phe Glu Thr Ile Pro Asp Gly Val Ser His Ser 65 70 75 80 Pro Glu Ala Ser Ile Pro Ile Arg Glu Ser Leu Leu Arg Ser Ile Glu 85 90 95 Thr Asn Phe Leu Asp Arg Phe Ile Asp Leu Val Thr Lys Leu Pro Asp 100 105 110 Pro Pro Thr Cys Ile Ile Ser Asp Gly Phe Leu Ser Val Phe Thr Ile 115 120 125 Asp Ala Ala Lys Lys Leu Gly Ile Pro Val Met Met Tyr Trp Thr Leu 130 135 140 Ala Ala Cys Gly Phe Met Gly Phe Tyr His Ile His Ser Leu Ile Glu 145 150 155 160 Lys Gly Phe Ala Pro Leu Lys Asp Ala Ser Tyr Leu Thr Asn Gly Tyr 165 170 175 Leu Asp Thr Val Ile Asp Trp Val Pro Gly Met Glu Gly Ile Arg Leu 180 185 190 Lys Asp Phe Pro Leu Asp Trp Ser Thr Asp Leu Asn Asp Lys Val Leu 195 200 205 Met Phe Thr Thr Glu Ala Pro Gln Arg Ser His Lys Val Ser His His 210 215 220 Ile Phe His Thr Phe Asp Glu Leu Glu Pro Ser Ile Ile Lys Thr Leu 225 230 235 240 Ser Leu Arg Tyr Asn His Ile Tyr Thr Ile Gly Pro Leu Gln Leu Leu 245 250 255 Leu Asp Gln Ile Pro Glu Glu Lys Lys Gln Thr Gly Ile Thr Ser Leu 260 265 270 His Gly Tyr Ser Leu Val Lys Glu Glu Pro Glu Cys Phe Gln Trp Leu 275 280 285 Gln Ser Lys Glu Pro Asn Ser Val Val Tyr Val Asn Phe Gly Ser Thr 290 295 300 Thr Val Met Ser Leu Glu Asp Met Thr Glu Phe Gly Trp Gly Leu Ala 305 310 315 320 Asn Ser Asn His Tyr Phe Leu Trp Ile Ile Arg Ser Asn Leu Val Ile 325 330 335 Gly Glu Asn Ala Val Leu Pro Pro Glu Leu Glu Glu His Ile Lys Lys 340 345 350 Arg Gly Phe Ile Ala Ser Trp Cys Ser Gln Glu Lys Val Leu Lys His 355 360 365 Pro Ser Val Gly Gly Phe Leu Thr His Cys Gly Trp Gly Ser Thr Ile 370 375 380 Glu Ser Leu Ser Ala Gly Val Pro Met Ile Cys Trp Pro Tyr Ser Trp 385 390 395 400 Asp Gln Leu Thr Asn Cys Arg Tyr Ile Cys Lys Glu Trp Glu Val Gly 405 410 415 Leu Glu Met Gly Thr Lys Val Lys Arg Asp Glu Val Lys Arg Leu Val 420 425 430 Gln Glu Leu Met Gly Glu Gly Gly His Lys Met Arg Asn Lys Ala Lys 435 440 445 Asp Trp Lys Glu Lys Ala Arg Ile Ala Ile Ala Pro Asn Gly Ser Ser 450 455 460 Ser Leu Asn Ile Asp Lys Met Val Lys Glu Ile Thr Val Leu Ala Arg 465 470 475 480 Asn <210> 7 <211> 1383 <212> DNA Artificial Sequence <400> 7 cgctttgatc agttcagaaa cgaattcaac gatgtcgttg tcagaagaac caccttcgtg 60 aaccgcaact ttcgccaggt ctttccattt aaccgcgttt ttacggatga taacaccacg 120 ttcttcttcc atgatcattt tgatgcaaga cgccaggtta ccacgacgaa cgataccgtt 180 ttcgtccgct ttaacacgaa caccaacacc caggatttcg tccagcagtt tcgcgttggt 240 ggtctggtca gagaactgcg gcatcgcaac aaccggaaca cccagagaga tcgcttccag 300 ggtagagttg aaaccgcagt gggtaacgaa gcaaccaaca gattcgtgcg ccagaacgtc 360 cagctgtttg caccacgcaa cgatcagacc tttaccggtt ttgataactt cagacaggtt 420 ttccggcagt ttaccttctt ctttgtgttt gataacccac aggaagttaa cgtcagagtc 480 gatcagcgca cgggtgattt cttcaacctg ttccggaccg tgtttaacca gagaaccgaa 540 cgcaacgtaa acaacagatt ctttcggttt gtcgtccagc cagttcatgc attcgtggtg 600 gttcgctttg tacaggttga aaccgttgtc tttgtcgtcg tccagacgtt tgtccaggta 660 catagacggc agggtcggac cgataacttt caggttccag attttacggg tccattcgat 720 aacttcttct tccagtttgt agaaagagtt ggtgaaaacc caacgcgcct ggtcgatgtt 780 cgcgaactga ccgaacagca tctgagacca cggagactgg atctgttcgt ggttctgcag 840 gatcagcggg gtttcccaac gctgcagaac cgggaaaccc ggaacagaaa cggtttcacc 900 cagcggcaga gagatcagac ctttgtgaac gtggtagtac agagagttaa caacgcacgc 960 ctgggtgaag aaagaaccac cgtcgatacc gaattcgatc gcaacgtcca gaacccattc 1020 ggtcatagag tcgtagatga tcgcgtcgat ggtggtacct tcagactgca gttttttgat 1080 caggtccgcc agagatttag aaccaacctg tttgaaggtt tccaggtaag attcacccgc 1140 agacatgaaa ccaccttcgt cgcaaccgtc agagatcgcc tggatttcga tagaggtggt 1200 ggtggtgtta gagtggttca gggtagagtt cagggtgtgg atggtggtaa ccagggtggt 1260 tttaacacct ttagagatca gacgtttacc gaactggatg aacgggttga tgtgaccctg 1320 cagcgggaac gggatcagca gaacgtgcgg agattttttg attttctgct gttccgccat 1380 taa 1383 <210> 8 <211> 460 <212> PRT <213> Stevia rebaudiana <400> 8 Met Ala Glu Gln Gln Lys Ile Lys Lys Ser Pro His Val Leu Leu Ile 1 5 10 15 Pro Phe Pro Leu Gln Gly His Ile Asn Pro Phe Ile Gln Phe Gly Lys 20 25 30 Arg Leu Ile Ser Lys Gly Val Lys Thr Thr Leu Val Thr Thr Ile His 35 40 45 Thr Leu Asn Ser Thr Leu Asn His Ser Asn Thr Thr Thr Thr Ser Ile 50 55 60 Glu Ile Gln Ala Ile Ser Asp Gly Cys Asp Glu Gly Gly Phe Met Ser 65 70 75 80 Ala Gly Glu Ser Tyr Leu Glu Thr Phe Lys Gln Val Gly Ser Lys Ser 85 90 95 Leu Ala Asp Leu Ile Lys Lys Leu Gln Ser Glu Gly Thr Thr Ile Asp 100 105 110 Ala Ile Ile Tyr Asp Ser Met Thr Glu Trp Val Leu Asp Val Ala Ile 115 120 125 Glu Phe Gly Ile Asp Gly Gly Ser Phe Phe Thr Gln Ala Cys Val Val 130 135 140 Asn Ser Leu Tyr Tyr His Val His Lys Gly Leu Ile Ser Leu Pro Leu 145 150 155 160 Gly Glu Thr Val Ser Val Pro Gly Phe Pro Val Leu Gln Arg Trp Glu 165 170 175 Thr Pro Leu Ile Leu Gln Asn His Glu Gln Ile Gln Ser Pro Trp Ser 180 185 190 Gln Met Leu Phe Gly Gln Phe Ala Asn Ile Asp Gln Ala Arg Trp Val 195 200 205 Phe Thr Asn Ser Phe Tyr Lys Leu Glu Glu Glu Val Ile Glu Trp Thr 210 215 220 Arg Lys Ile Trp Asn Leu Lys Val Ile Gly Pro Thr Leu Pro Ser Met 225 230 235 240 Tyr Leu Asp Lys Arg Leu Asp Asp Asp Lys Asp Asn Gly Phe Asn Leu 245 250 255 Tyr Lys Ala Asn His His Glu Cys Met Asn Trp Leu Asp Asp Lys Pro 260 265 270 Lys Glu Ser Val Val Tyr Val Ala Phe Gly Ser Leu Val Lys His Gly 275 280 285 Pro Glu Gln Val Glu Glu Ile Thr Arg Ala Leu Ile Asp Ser Asp Val 290 295 300 Asn Phe Leu Trp Val Ile Lys His Lys Glu Glu Gly Lys Leu Pro Glu 305 310 315 320 Asn Leu Ser Glu Val Ile Lys Thr Gly Lys Gly Leu Ile Val Ala Trp 325 330 335 Cys Lys Gln Leu Asp Val Leu Ala His Glu Ser Val Gly Cys Phe Val 340 345 350 Thr His Cys Gly Phe Asn Ser Thr Leu Glu Ala Ile Ser Leu Gly Val 355 360 365 Pro Val Val Ala Met Pro Gln Phe Ser Asp Gln Thr Thr Asn Ala Lys 370 375 380 Leu Leu Asp Glu Ile Leu Gly Val Gly Val Arg Val Lys Ala Asp Glu 385 390 395 400 Asn Gly Ile Val Arg Arg Gly Asn Leu Ala Ser Cys Ile Lys Met Ile 405 410 415 Met Glu Glu Glu Arg Gly Val Ile Ile Arg Lys Asn Ala Val Lys Trp 420 425 430 Lys Asp Leu Ala Lys Val Ala Val His Glu Gly Gly Ser Ser Asp Asn 435 440 445 Asp Ile Val Glu Phe Val Ser Glu Leu Ile Lys Ala 450 455 460 <210> 9 <211> 2409 <212> DNA Saccharum hybrid cultivar F36-819 <400> 9 atggctgcca agttgactcg cctccacagt cttcgcgaac gccttggtgc caccttctcc 60 tctcatccca atgagctgat tgcactcttc tccaggtatg ttaaccaggg caagggaatg 120 cttcagcgcc atcaactgct tgctgagttt gatgccctgt ttgatagtga caaggagaag 180 tatgcgccct tcgaagactt tcttcgtgct gctcaggaag caattgtgct ccctccctgg 240 gtagcacttg ctatcaggcc aaggcctggt gtctgggatt acattcgagt gaatgtaagc 300 gagttggctg tggaggagct gagtgtttct gagtacttgg cattcaagga acagctggtg 360 gatggaaatt ccaacagcaa ctttgttctt gagcttgatt ttgagccctt caatgcctca 420 ttccctcgtc cttccatgtc aaagtccatt ggaaatggag tgcaattcct taaccgacac 480 ctgtcttcca agttgttcca ggacaaggag agcctgtacc cattgctgaa tttcctcaaa 540 gcccataact acaagggcac gacgatgatg ttgaatgaca gaattcagag cctccgtggg 600 ctccagtcat cccttagaaa ggcagaagag tatctactga gtgtccctca agacactccc 660 tactcagagt tcaaccatag gttccaagag cttggcttgg agaagggttg gggtgacact 720 gcaaagcgcg tacttgatac actccacttg cttcttgacc ttcttgaggc ccctgatcct 780 gccaacttgg agaagttcct tggaactata ccaatgatgt tcaatgttgt tatcctgtct 840 cctcatggct actttgccca atccaatgtg cttggatacc ctgacactgg tggtcaggtt 900 gtgtacattt tggatcaagt ccgtgctttg gagaatgaga tgcttcttag gattaagcag 960 caaggccttg acatcacccc gaagatcctc attgttacca ggctgttgcc tgatgctgtt 1020 gggactacgt gcggtcagcg tctggagaag gtcattggaa ccgagcacac agacattatt 1080 cgtattccat tcagaaatga gaatggtatt ctccgcaagt ggatctctcg ttttgatgtc 1140 tggccatacc tggagacata cactgaggat gttgccagtg aaataatgtt agaaatgcag 1200 gccaagcctg accttatcgt tggcaactac agtgatggca atctagtcgc cactctgctc 1260 gcgcacaagt tgggagttac tcagtgtacc attgcccacg ccttggagaa aaccaaatat 1320 cccaactcag acatatactt ggacaaattt gacagccaat accacttctc atgccagttc 1380 acagctgacc ttatgccat gaatcacact gatttcatca tcaccagtac attccaagaa 1440 atcgcgggaa gcaaggacac tgtggggcag tatgagtccc acattgcgtt cactcttcct 1500 ggactttacc gtgttgtcca tggcattgat gtttttgatc ccaaattcaa cattgtctct 1560 cctggagcag acatgagtgt ttactaccca tacactgaaa ctgacaagag actcactgcc 1620 ttccatcctg aaattgagga gctcatctac agtgatgttg agaacgatga gcacaagttt 1680 gtgttgaagg acaagaacaa gccgatcatc ttctcaatgg ctcgtcttga ccgtgtgaag 1740 aacatgacag gcttggttga gatgtatggt aagaatgcac gcctgaggga attggcaaac 1800 cttgtgattg ttgctggtga ccatggcaag gaatcgaagg acagggagga gcaggcagag 1860 ttcaagaaga tgtacagtct cattgatgag tacaacttga agggccatat ccggtggatc 1920 tcagctcaga tgaaccgtgt ccgcaacgct gagttgtacc gctacatttg tgacacgaag 1980 ggagcatttg tgcagcctgc attctatgaa gcattcggcc tgactgtcat tgagtccatg 2040 acgtgcggtt tgccaacaat tgcaacctgc catggtggcc ctgctgaaat aattgtggac 2100 ggggtgtctg gtttgcacat tgatccttac cacagtgaca aggctgcaga tattttggtc 2160 aacttctttg agaagtgcaa ggcagaccca agctactggg acaagatctc acagggtgga 2220 ctgcagagaa tttatgagaa gtacacctgg aagctctact ccgagaggct gatgaccctg 2280 actggtgtat acggattctg gaagtatgtg agcaatctgg agaggcgtga gactcgccgc 2340 taccttgaga tgttctatgc tctgaaatac cgtagcctgg caagtgcggt tccattgtcc 2400 ttcgattag 2409 <210> 10 <211> 802 <212> PRT <213> Sugarcane (Saccharum hybrid cultivar F36-819) <400> 10 Met Ala Ala Lys Leu Thr Arg Leu His Ser Leu Arg Glu Arg Leu Gly 1 5 10 15 Ala Thr Phe Ser Ser His Pro Asn Glu Leu Ile Ala Leu Phe Ser Arg 20 25 30 Tyr Val Asn Gln Gly Lys Gly Met Leu Gln Arg His Gln Leu Leu Ala 35 40 45 Glu Phe Asp Ala Leu Phe Asp Ser Asp Lys Glu Lys Tyr Ala Pro Phe 50 55 60 Glu Asp Phe Leu Arg Ala Ala Gln Glu Ala Ile Val Leu Pro Pro Trp 65 70 75 80 Val Ala Leu Ala Ile Arg Pro Arg Pro Gly Val Trp Asp Tyr Ile Arg 85 90 95 Val Asn Val Ser Glu Leu Ala Val Glu Glu Leu Ser Val Ser Glu Tyr 100 105 110 Leu Ala Phe Lys Glu Gln Leu Val Asp Gly Asn Ser Asn Ser Asn Phe 115 120 125 Val Leu Glu Leu Asp Phe Glu Pro Phe Asn Ala Ser Phe Pro Arg Pro 130 135 140 Ser Met Ser Lys Ser Ile Gly Asn Gly Val Gln Phe Leu Asn Arg His 145 150 155 160 Leu Ser Ser Lys Leu Phe Gln Asp Lys Glu Ser Leu Tyr Pro Leu Leu 165 170 175 Asn Phe Leu Lys Ala His Asn Tyr Lys Gly Thr Thr Met Met Leu Asn 180 185 190 Asp Arg Ile Gln Ser Leu Arg Gly Leu Gln Ser Ser Leu Arg Lys Ala 195 200 205 Glu Glu Tyr Leu Leu Ser Val Pro Gln Asp Thr Pro Tyr Ser Glu Phe 210 215 220 Asn His Arg Phe Gln Glu Leu Gly Leu Glu Lys Gly Trp Gly Asp Thr 225 230 235 240 Ala Lys Arg Val Leu Asp Thr Leu His Leu Leu Leu Asp Leu Leu Glu 245 250 255 Ala Pro Asp Pro Ala Asn Leu Glu Lys Phe Leu Gly Thr Ile Pro Met 260 265 270 Met Phe Asn Val Val Ile Leu Ser Pro His Gly Tyr Phe Ala Gln Ser 275 280 285 Asn Val Leu Gly Tyr Pro Asp Thr Gly Gly Gln Val Val Tyr Ile Leu 290 295 300 Asp Gln Val Arg Ala Leu Glu Asn Glu Met Leu Leu Arg Ile Lys Gln 305 310 315 320 Gln Gly Leu Asp Ile Thr Pro Lys Ile Leu Ile Val Thr Arg Leu Leu 325 330 335 Pro Asp Ala Val Gly Thr Thr Cys Gly Gln Arg Leu Glu Lys Val Ile 340 345 350 Gly Thr Glu His Thr Asp Ile Ile Arg Ile Pro Phe Arg Asn Glu Asn 355 360 365 Gly Ile Leu Arg Lys Trp Ile Ser Arg Phe Asp Val Trp Pro Tyr Leu 370 375 380 Glu Thr Tyr Thr Glu Asp Val Ala Ser Glu Ile Met Leu Glu Met Gln 385 390 395 400 Ala Lys Pro Asp Leu Ile Val Gly Asn Tyr Ser Asp Gly Asn Leu Val 405 410 415 Ala Thr Leu Leu Ala His Lys Leu Gly Val Thr Gln Cys Thr Ile Ala 420 425 430 His Ala Leu Glu Lys Thr Lys Tyr Pro Asn Ser Asp Ile Tyr Leu Asp 435 440 445 Lys Phe Asp Ser Gln Tyr His Phe Ser Cys Gln Phe Thr Ala Asp Leu 450 455 460 Ile Ala Met Asn His Thr Asp Phe Ile Ile Thr Ser Thr Phe Gln Glu 465 470 475 480 Ile Ala Gly Ser Lys Asp Thr Val Gly Gln Tyr Glu Ser His Ile Ala 485 490 495 Phe Thr Leu Pro Gly Leu Tyr Arg Val Val His Gly Ile Asp Val Phe 500 505 510 Asp Pro Lys Phe Asn Ile Val Ser Pro Gly Ala Asp Met Ser Val Tyr 515 520 525 Tyr Pro Tyr Thr Glu Thr Asp Lys Arg Leu Thr Ala Phe His Pro Glu 530 535 540 Ile Glu Glu Leu Ile Tyr Ser Asp Val Glu Asn Asp Glu His Lys Phe 545 550 555 560 Val Leu Lys Asp Lys Asn Lys Pro Ile Ile Phe Ser Met Ala Arg Leu 565 570 575 Asp Arg Val Lys Asn Met Thr Gly Leu Val Glu Met Tyr Gly Lys Asn 580 585 590 Ala Arg Leu Arg Glu Leu Ala Asn Leu Val Ile Val Ala Gly Asp His 595 600 605 Gly Lys Glu Ser Lys Asp Arg Glu Glu Gln Ala Glu Phe Lys Lys Met 610 615 620 Tyr Ser Leu Ile Asp Glu Tyr Asn Leu Lys Gly His Ile Arg Trp Ile 625 630 635 640 Ser Ala Gln Met Asn Arg Val Arg Asn Ala Glu Leu Tyr Arg Tyr Ile 645 650 655 Cys Asp Thr Lys Gly Ala Phe Val Gln Pro Ala Phe Tyr Glu Ala Phe 660 665 670 Gly Leu Thr Val Ile Glu Ser Met Thr Cys Gly Leu Pro Thr Ile Ala 675 680 685 Thr Cys His Gly Gly Pro Ala Glu Ile Ile Val Asp Gly Val Ser Gly 690 695 700 Leu His Ile Asp Pro Tyr His Ser Asp Lys Ala Ala Asp Ile Leu Val 705 710 715 720 Asn Phe Phe Glu Lys Cys Lys Ala Asp Pro Ser Tyr Trp Asp Lys Ile 725 730 735 Ser Gln Gly Gly Leu Gln Arg Ile Tyr Glu Lys Tyr Thr Trp Lys Leu 740 745 750 Tyr Ser Glu Arg Leu Met Thr Leu Thr Gly Val Tyr Gly Phe Trp Lys 755 760 765 Tyr Val Ser Asn Leu Glu Arg Arg Glu Thr Arg Arg Tyr Leu Glu Met 770 775 780 Phe Tyr Ala Leu Lys Tyr Arg Ser Leu Ala Ser Ala Val Pro Leu Ser 785 790 795 800 Phe Asp <210> 11 <211> 2430 <212> DNA <213> Arabidopsis thaliana <400> 11 atggcaaacc ctaagctcac tagggttcta agcacaaggg atcgcgtgca agacacgctt 60 tccgctcacc gcaacgaact cgttgctctt ctctccaggt atgtggatca ggggaaaggg 120 attcttcaac cacataactt aattgacgaa ctcgaatctg ttatcggaga cgatgaaaca 180 aagaagagtc tctctgatgg tccttttgga gagatcctta aatcagcaat ggaagctata 240 gttgtaccac cttttgttgc gttagccgtt agaccaagac ctggtgtttg ggaatatgtt 300 cgtgttaatg tcttcgagct aagtgttgaa caattaacag tctctgagta tcttcgtttc 360 aaagaagaac tcgttgatgg acctaatagt gacccttttt gtcttgagct tgatttcgag 420 ccctttaacg caaacgtgcc acgtccttct cgttcgtctt cgattggtaa tggagttcag 480 tttctgaatc gtcacttgtc ttctgttatg ttccgtaaca aagattgctt ggagcctctg 540 cttgatttcc ttagagttca taagtacaaa ggtcatccgt tgatgttgaa tgatcggatt 600 caaagcatat ctaggcttca aatccagctt agtaaagcag aagatcatat ctctaagctt 660 tcacaagaaa ctccgttctc ggaattcgaa tacgcgttgc aaggaatggg tttgagaaa 720 ggatggggag ataccgcagg gagagttctt gaatgatgc atctctctc tgatattctt 780 caagctcctg atccttcgtc cttggagaag ttcttggga tggtaccaat ggtttcaac 840 gttgtgatct tatctccaca tggatatttc gggcaagcca atgttttagg cttacctgac 900 actggtggac aagttgtcta tattcttgac caagtccgtg cccttgagac tgaatgctg 960 ttgagataa agagacagggg gttggatata tcacctagta ttcttattgt aactaggttg 1020 ataccggatg ctaaaggaac tacgtgtaac cagcggttag aggagtcag cggacagag 1080 catactcata ttctccggtt tccttttagg tctgagaag gatcctccg tagtggatt 1140 tcaagattcg acgtatggcc ttatctgag aactatgctc aggatgcagc aagcgagatt 1200 gtcggtgaat tgcaggcgt accggactt atcatcggta actatagtga cggaaacctt 1260 gttgcatcgt taatggcaca tagaatgggt gttacacaat gtactattgc acatgctttg 1320 gagaaaacca agtatccaga ttcagacatt tactggaag acttcgacaa caagtatcat 1380 ttctcttgtc attcacagc tgatcttc gcaatgaca acgcagattt catcatcaca 1440 agcacttacc aagaaatcgc aggaacgaag aacaccgtcg gtcaatga aagccacggg 1500 gcttttacgc tcccgggact atatagagta gtacacggca tcgatgtt tgatccgag 1560 ttcacatag tctcgcccgg tgcagacatg accatatatt tcccgtattc cgaagaaact 1620 aggagactta cagctttaca tggttcaata gaggaaatgc tctatagccc tgaccagact 1680 gatgagcatg tcggtacact gagtgatcga tcaagccaa tactctctc tatggcgagg 1740 ctcgacaag tgagaacat ctccggttta gttgagatgt atagtagaa cacaagttg 1800 agggagctgg ttaatctggt tgtaatagct ggtaacattg atgtgaacha gtccaagat 1860 aggagaaaa tcgtagagat tgagaaaatg catacctta tgaagatta caagcttgat 1920 ggacagtttc gttggataac tgctcagact aaccgagctc gaatggtga gctttaccgc 1980 tacatcgcgg atacaagagg tgctttgct cagcctgcgt tcatcgaggc ttttggactt 2040 acggtagtgg aagcgatgac ttgcggctc ccgactttg ccacttgtca cggtggtcca 2100 gcagagatca tcgagcacgg gctctcgggt ttccacatcg atccatacca tcctgagcaa 2160 gcgggtaaca taatggctga tttctttgaa cgttgtaagg aagatccaaa ccattggaag 2220 aaagtatcag acgctggtct ccaaaggata tacgaaaggt acacatggaa gatatactcg 2280 gagagattga tgacactagc tggtgtgtat ggtttctgga aatacgtatc gaaattggag 2340 cgtcgtgaga ctcggcgata tcttgaaatg ttctacattc tcaaattccg cgacttggtg 2400 aaaactgttc cttcaaccgc cgatgactga 2430 <210> 12 <211> 809 <212> PRT <213> Arabidopsis thaliana <400> 12 Met Ala Asn Pro Lys Leu Thr Arg Val Leu Ser Thr Arg Asp Arg Val 1 5 10 15 Gln Asp Thr Leu Ser Ala His Arg Asn Glu Leu Val Ala Leu Leu Ser 20 25 30 Arg Tyr Val Asp Gln Gly Lys Gly Ile Leu Gln Pro His Asn Leu Ile 35 40 45 Asp Glu Leu Glu Ser Val Ile Gly Asp Asp Glu Thr Lys Lys Ser Leu 50 55 60 Ser Asp Gly Pro Phe Gly Glu Ile Leu Lys Ser Ala Met Glu Ala Ile 65 70 75 80 Val Val Pro Pro Phe Val Ala Leu Ala Val Arg Pro Arg Pro Gly Val 85 90 95 Trp Glu Tyr Val Arg Val Asn Val Phe Glu Leu Ser Val Glu Gln Leu 100 105 110 Thr Val Ser Glu Tyr Leu Arg Phe Lys Glu Glu Leu Val Asp Gly Pro 115 120 125 Asn Ser Asp Pro Phe Cys Leu Glu Leu Asp Phe Glu Pro Phe Asn Ala 130 135 140 Asn Val Pro Arg Pro Ser Arg Ser Ser Ser Ile Gly Asn Gly Val Gln 145 150 155 160 Phe Leu Asn Arg His Leu Ser Ser Val Met Phe Arg Asn Lys Asp Cys 165 170 175 Leu Glu Pro Leu Leu Asp Phe Leu Arg Val His Lys Tyr Lys Gly His 180 185 190 Pro Leu Met Leu Asn Asp Arg Ile Gln Ser Ile Ser Arg Leu Gln Ile 195 200 205 Gln Leu Ser Lys Ala Glu Asp His Ile Ser Lys Leu Ser Gln Glu Thr 210 215 220 Pro Phe Ser Glu Phe Glu Tyr Ala Leu Gln Gly Met Gly Phe Glu Lys 225 230 235 240 Gly Trp Gly Asp Thr Ala Gly Arg Val Leu Glu Met Met His Leu Leu 245 250 255 Ser Asp Ile Leu Gln Ala Pro Asp Pro Ser Ser Leu Glu Lys Phe Leu 260 265 270 Gly Met Val Pro Met Val Phe Asn Val Val Ile Leu Ser Pro His Gly 275 280 285 Tyr Phe Gly Gln Ala Asn Val Leu Gly Leu Pro Asp Thr Gly Gly Gln 290 295 300 Val Val Tyr Ile Leu Asp Gln Val Arg Ala Leu Glu Thr Glu Met Leu 305 310 315 320 Leu Arg Ile Lys Arg Gln Gly Leu Asp Ile Ser Pro Ser Ile Leu Ile 325 330 335 Val Thr Arg Leu Ile Pro Asp Ala Lys Gly Thr Thr Cys Asn Gln Arg 340 345 350 Leu Glu Arg Val Ser Gly Thr Glu His Thr His Ile Leu Arg Val Pro 355 360 365 Phe Arg Ser Glu Lys Gly Ile Leu Arg Lys Trp Ile Ser Arg Phe Asp 370 375 380 Val Trp Pro Tyr Leu Glu Asn Tyr Ala Gln Asp Ala Ala Ser Glu Ile 385 390 395 400 Val Gly Glu Leu Gln Gly Val Pro Asp Phe Ile Ile Gly Asn Tyr Ser 405 410 415 Asp Gly Asn Leu Val Ala Ser Leu Met Ala His Arg Met Gly Val Thr 420 425 430 Gln Cys Thr Ile Ala His Ala Leu Glu Lys Thr Lys Tyr Pro Asp Ser 435 440 445 Asp Ile Tyr Trp Lys Asp Phe Asp Asn Lys Tyr His Phe Ser Cys Gln 450 455 460 Phe Thr Ala Asp Leu Ile Ala Met Asn Asn Ala Asp Phe Ile Ile Thr 465 470 475 480 Ser Thr Tyr Gln Glu Ile Ala Gly Thr Lys Asn Thr Val Gly Gln Tyr 485 490 495 Glu Ser His Gly Ala Phe Thr Leu Pro Gly Leu Tyr Arg Val Val His 500 505 510 Gly Ile Asp Val Phe Asp Pro Lys Phe Asn Ile Val Ser Pro Gly Ala 515 520 525 Asp Met Thr Ile Tyr Phe Pro Tyr Ser Glu Glu Thr Arg Arg Leu Thr 530 535 540 Ala Leu His Gly Ser Ile Glu Glu Met Leu Tyr Ser Pro Asp Gln Thr 545 550 555 560 Asp Glu His Val Gly Thr Leu Ser Asp Arg Ser Lys Pro Ile Leu Phe 565 570 575 Ser Met Ala Arg Leu Asp Lys Val Lys Asn Ile Ser Gly Leu Val Glu 580 585 590 Met Tyr Ser Lys Asn Thr Lys Leu Arg Glu Leu Val Asn Leu Val Val 595 600 605 Ile Ala Gly Asn Ile Asp Val Asn Lys Ser Lys Asp Arg Glu Glu Ile 610 615 620 Val Glu Ile Glu Lys Met His Asn Leu Met Lys Asn Tyr Lys Leu Asp 625 630 635 640 Gly Gln Phe Arg Trp Ile Thr Ala Gln Thr Asn Arg Ala Arg Asn Gly 645 650 655 Glu Leu Tyr Arg Tyr Ile Ala Asp Thr Arg Gly Ala Phe Ala Gln Pro 660 665 670 Ala Phe Tyr Glu Ala Phe Gly Leu Thr Val Val Glu Ala Met Thr Cys 675 680 685 Gly Leu Pro Thr Phe Ala Thr Cys His Gly Gly Pro Ala Glu Ile Ile 690 695 700 Glu His Gly Leu Ser Gly Phe His Ile Asp Pro Tyr His Pro Glu Gln 705 710 715 720 Ala Gly Asn Ile Met Ala Asp Phe Phe Glu Arg Cys Lys Glu Asp Pro 725 730 735 Asn His Trp Lys Lys Val Ser Asp Ala Gly Leu Gln Arg Ile Tyr Glu 740 745 750 Arg Tyr Thr Trp Lys Ile Tyr Ser Glu Arg Leu Met Thr Leu Ala Gly 755 760 765 Val Tyr Gly Phe Trp Lys Tyr Val Ser Lys Leu Glu Arg Arg Glu Thr 770 775 780 Arg Arg Tyr Leu Glu Met Phe Tyr Ile Leu Lys Phe Arg Asp Leu Val 785 790 795 800 Lys Thr Val Pro Ser Thr Ala Asp Asp 805 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <400> 13 gtaatccatc gatactagta gcgccactgc tctcgagac 39 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <400> 14 cctcactaaa gggcggccgc atggcaaacc aacgtcaca 39 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <400> 15 ggagaaaaaa ccccggatcc atggcttctg gttataatc 39 <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <400> 16 caacttctgt tccatgtcga cgtacgtgcg cttccttaa 39 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <400> 17 gagaaaaaac cccggatcca tggacgcgat ggcgaccac 39 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <400> 19 caacttctgt tccatgtcga cgttacgcgc cagaacggtg 40 <210> 19 <211> 39 <212> DNA <213> Artificial Sequence <400> 19 ccctcactaa agggcggccg catggcaaac cctaagctc 39 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <400> 20 gtaatccatcgatactagtgtcatcggcggttgaaggaac 40 <210> twenty one <211> 39 <212> DNA <213> Artificial Sequence <400> twenty one gtaatccatc gatactagta tcgaaggaca atggaaccg 39 <210> twenty two <211> 39 <212> DNA <213> Artificial Sequence <400> twenty two ctcactaaag ggcggccgca tggctgccaa gttgactcg 39 <210> twenty three <211> 43 <212> DNA <213> Artificial Sequence <400> twenty three cttgtaatcc atcgatacta gtcgctttga tcagttcaga aac 43 <210> twenty four <211> 41 <212> DNA <213> Artificial Sequence <400> twenty four cctcactaaa gggcggccgc atggcggaac agcagaaaat c 41 <210> 25 <211> 45 <212> DNA <213> Artificial Sequence <400> 25 gtctgcgggt gcatcttacc tggaaacctt caaacaggtt ggttc 45 <210> 26 <211> 45 <212> DNA <213> Artificial Sequence <400> 26 gtttccaggt aagatgcacc cgcagacatg aaaccacctt cgtcg 45 <210> 27 <211> 45 <212> DNA <213> Artificial Sequence <400> 27 gtctgcgggt gaagcttacc tggaaacctt caaacaggtt ggttc 45 <210> 28 <211> 45 <212> DNA <213> Artificial Sequence <400> 28 gtttccaggt aagcttcacc cgcagacatg aaaccacctt cgtcg 45 <210> 29 <211> 45 <212> DNA <213> Artificial Sequence <400> 29 gtctgcgggt gaatcttacc tggcaacctt caaacaggtt ggttc 45 <210> 30 <211> 53 <212> DNA <213> Artificial Sequence <400> 30 gtttgaaggt tgccaggtaa gattcacccg cagacatgaa accaccttcg tcg 53 <210> 31 <211> 56 <212> DNA <213> Artificial Sequence <400> 31 gaatcttacc tggaagcatt caaacaggtt ggttctaaat ctctggcgga cctgat 56 <210> 32 <211> 56 <212> DNA <213> Artificial Sequence <400> 32 gtttgaatgc ttccaggtaa gattcacccg cagacatgaa accaccttcg tcgcaa 56 <210> 33 <211> 56 <212> DNA <213> Artificial Sequence <400> 33 ctgcagaacc acgaacagat ccagtctgcg tggtctcaga tgctgttcgg tcagtt 56 <210> 34 <211> 56 <212> DNA <213> Artificial Sequence <400> 34 gcatctgaga ccacgcagac tggatctgtt cgtggttctg caggatcagc ggggtt 56 <210> 35 <211> 56 <212> DNA <213> Artificial Sequence <400> 35 gaacagatcc agtctccgtg ggcgcagatg ctgttcggtc agttcgcgaa catcga 56 <210> 36 <211> 56 <212> DNA <213> Artificial Sequence <400> 36 ctgcgcccac ggagactgga tctgttcgtg gttctgcagg atcagcgggg tttccc 56 <210> 37 <211> 55 <212> DNA <213> Artificial Sequence <400> 37 gtctgcgggt gaagcgtacc tggcaacctt caaacaggtt ggttctaaat ctctg 55 <210> 38 <211> 54 <212> DNA <213> Artificial Sequence <400> 38 ggttgccagg tacgcttcac ccgcagacat gaaaccacct tcgtcgcaac cgtc 54

Claims

1. A genetically engineered host cell, wherein the host cell: Expression: (1) a glycosyltransferase that glycosylates the C13 hydroxyl group of steviol, (2) a glycosyltransferase that glycosylates the C4 carboxyl group of steviol, and (3) at least one sucrose synthase; and / or Contains: (a) a coding sequence for a glycosyltransferase that glycosylates the C13 hydroxyl group of steviol or an expression vector thereof, (b) a coding sequence for a glycosyltransferase that glycosylates the C4 carboxyl group of steviol or an expression vector thereof, and (c) a coding sequence for at least one sucrose synthase or an expression vector thereof. The glycosyltransferase that glycosylates the C4 carboxyl group of steviol is a mutant of glycosyltransferase SrUGT74G1; the mutant is a double mutant, which has undergone S84A and E87A substitution mutations compared with SEQ ID NO:

8.

2. The host cell as described in claim 1, characterized in that: The glycosyltransferase that glycosylates the C13 hydroxyl group of steviol is selected from: (i) glycosyltransferase RsUGT85A57, (ii) glycosyltransferase SrUGT85C2; and / or The at least one sucrose synthase is selected from: (1) sucrose synthase AtSUS3, (2) sucrose synthase SoSUS2.

3. The host cell as described in claim 1, characterized in that, The host cell: At least the expression of catalytic synthesis of steviol 19- O β-D-glucosidase, glycosyltransferase of stevioside 19- O β-d-glucosinolate catalyzing the production of stevia, and at least one sucrose synthase, optionally further expressing a glycosyltransferase catalyzing the production of steviol to steviol monosaccharide and / or a glycosyltransferase catalyzing the production of stevia monosaccharide to stevia; and / or It contains at least the catalyst that catalyzes the formation of steviol 19- O The coding sequence of β-d-glucosinolate glycosyltransferase or its expression vector, and the expression vector of stevioside 19- O The encoding sequence of a glycosyltransferase for the catalytic production of stevia from β-d-glucoside or its expression vector, and the encoding sequence of at least one sucrose synthase or its expression vector, optionally further comprising the encoding sequence of a glycosyltransferase for the catalytic production of steviol from steviol from steviol monosaccharides or its expression vector and / or the encoding sequence of a glycosyltransferase for the catalytic production of steviol monosaccharides from steviol from steviol from steviol or its expression vector.

4. The host cell as described in claim 3, characterized in that, The stevioside 19- O The glycosyltransferases that catalyze the production of β-d-glucosinolates from stevia are selected from: (i) glycosyltransferase RsUGT85A57, (ii) glycosyltransferase SrUGT85C2; and / or The glycosyltransferase that catalyzes the conversion of steviol to steviol monosaccharides is selected from: (i) glycosyltransferase SrUGT85C2; and / or The at least one sucrose synthase is selected from: (1) sucrose synthase AtSUS3, (2) sucrose synthase SoSUS2.

5. The host cell as described in claim 1, characterized in that, The host cell: Mutants expressing glycosyltransferase AkUGT75L21, glycosyltransferase RsUGT85A57, glycosyltransferase SrUGT85C2, glycosyltransferase SrUGT74G1, and sucrose synthase AtSUS3 or SoSUS2; and / or The coding sequence or expression vector of glycosyltransferase AkUGT75L21, the coding sequence or expression vector of glycosyltransferase RsUGT85A57, the coding sequence or expression vector of glycosyltransferase SrUGT85C2, the coding sequence or expression vector of mutant glycosyltransferase SrUGT74G1, and the coding sequence or expression vector of sucrose synthase AtSUS3 or SoSUS2.

6. The host cell according to any one of claims 1-5, characterized in that, The host cells are selected from Escherichia coli and yeast.

7. The host cell as described in claim 6, characterized in that, The yeast mentioned is brewer's yeast.

8. A method for producing sucralose, characterized in that, The method includes culturing the host cells under conditions suitable for host cell synthesis of stevia in any one of claims 1-7, and isolating stevia.

9. The method as described in claim 8, characterized in that, The culture includes a cell-catalyzed reaction that catalyzes the production of stevia by catalyzing cells, wherein the catalytic reaction is carried out in the presence of steviol, sucrose and metal ions, wherein the pH of the catalytic reaction system is 7.2–8.2, and the catalytic reaction is carried out at 25–35 °C.

10. The method as described in claim 9, characterized in that, The metal ions do not include Mn ions and Mg ions.

11. The method as described in claim 9, characterized in that, The metal ion is Co. 2+ Li + and / or Zn 2+ .

12. The method as described in claim 9, characterized in that, The concentration of metal ions in the catalytic reaction system is 0.05–0.20 mM.

13. The method as described in claim 9, characterized in that, The catalytic reaction system also contains surfactants.

14. The method as described in claim 13, characterized in that, The surfactant is CTAB.

15. The method as described in claim 13, characterized in that, The concentration of the surfactant is 5–15 g / L.

16. The method as described in claim 9, characterized in that, The concentration of steviol in the catalytic reaction system is 1–2 g / L.

17. The method as described in claim 9, characterized in that, The concentration of sucrose in the catalytic reaction system is 10–40 g / 100 mL.

18. The method as described in claim 9, characterized in that, No exogenous UDPG was added to the catalytic reaction system.

19. A mutant of glycosyltransferase SrUGT74G1, characterized in that, The mutant is a double mutant, which, compared with SEQ ID NO:8, has undergone S84A and E87A substitution mutations.

20. A kit for constructing host cells for producing stevia, the kit comprising an expression vector for expressing: (1) a glycosyltransferase with a C13 hydroxyl group of steviol glycosylated, (2) a glycosyltransferase with a C4 carboxyl group of steviol glycosylated, and (3) at least one sucrose synthase; wherein the glycosyltransferase and sucrose synthase are as described in any one of claims 1-7.

Images