Application of rice osstp28 gene

Abstract

The application discloses application of a rice Osstp28 gene in breeding of Minghui 63, Wu Yunjian No. 7 and model rice Nipponbare. The application provides application of a green friendly gene Osstp28 of rice in regulation of growth periods of the Minghui 63, the Wu Yunjian No. 7 and the Nipponbare, yield increase and nitrogen utilization efficiency improvement. It is found that knocking out the rice Osstp28 gene can fine-tune the growth periods of the Minghui 63, the Wu Yunjian No. 7 and the Nipponbare, so as to achieve the effect of high yield and high nitrogen fertilizer utilization efficiency of the rice.

Description

Technical Field

[0001] This invention belongs to the field of biology and relates to the application of the rice OsSTP28 gene. Background Technology

[0002] Nitrogen (N) is the main macronutrient element applied in rice cultivation and is the most limiting nutrient in the soil. At the same time, nitrogen is an essential element for the formation of living organisms. The synthesis of essential substances such as proteins, nucleic acids, and chloroplasts all require nitrogen; therefore, nitrogen plays a crucial role in plant growth and development. Nitrogen deficiency leads to undesirable traits such as stunted growth and low seed setting rate, and in severe cases, even death. High yields and quality of modern crops heavily rely on the application of nitrogen fertilizer. Excessive application of nitrogen fertilizer causes ecological and environmental problems such as energy waste, increased production costs, soil acidification and toxicity, eutrophication of water bodies, and increased greenhouse gas emissions, seriously restricting the sustainable development of agricultural production. Furthermore, excessive application of nitrogen fertilizer not only affects yield and reduces nitrogen use efficiency (NUE), but also leads to a series of problems such as excessive growth leading to lodging, increased pests and diseases, delayed maturity, and decreased quality.

[0003] Nitrogen use efficiency (NUE) in rice measures the efficiency with which rice obtains nitrogen from the environment and uses it for its own growth and grain production. It is a highly complex quantitative trait influenced by soil fertility and the natural environment. Generally, the main factor affecting crop nitrogen fertilizer use efficiency is nitrogen uptake efficiency (NUpE). NUpE is primarily determined by the nitrogen uptake capacity of the crop's root system. Furthermore, both conventional NUE and agronomic NUE are used to comprehensively assess field NUE in rice.

[0004] The key gene pathways for nitrogen fertilizer absorption and utilization in rice are now relatively well understood. The interaction between OsNAR2.1-OsNIT1 / OsNIT2 regulates root responses to nitrate and ammonium (Song et al., 2020); OsAMT1.1 and others are responsible for root ammonium uptake and ammonia translocation from roots to shoots (Li et al., 2016); OsNAR2.1-OsNRT2.1 / 2.2, OsNPF2.4, and OsNRT1.1B are responsible for root nitrate uptake (Xia et al., 2014; Hu et al., 2015); OsNRT2.3a, OsNRT2.3b, and OsNPF2.4 are responsible for intracellular nitrate translocation (Xia et al., 2014; Fan et al., 2016); OsGS1.2 is responsible for ammonium assimilation in the cytoplasm (Ohashi et al., 2017); OsFd-GOGAT It is responsible for the assimilation and reuse of ammonia in the aboveground parts and affects the carbon-nitrogen balance (Zeng et al., 2017); OsLHT1 is responsible for the absorption of amino acids in the roots and the distribution of amino acids in the body (Guo et al., 2020).

[0005] Compared to the progress in the genetic basis of nitrogen efficiency, the genetic improvement of nitrogen efficiency in rice has progressed slowly. Researchers have conducted extensive screening and identification of nitrogen-efficient germplasm resources. Wei Haiyan et al. (2008) screened six nitrogen-efficient materials, namely 9 You 418, Wuyujing 3, Yangjing 9538, 86 You 8, Wujing 15, and Siyou 422, based on the highest grain yield and nitrogen use efficiency. Yu Youling et al. (2015) screened six nitrogen-efficient materials, namely II You 602, Huiliangyou 6, Liangyou 6326, Fengliangyou 9, Guangliangyou 9918, and Y Liangyou 2, based on yield and yield increase. Although a large number of key regulatory genes for nitrogen fertilizer use efficiency have been cloned, their superior allelic variations are mostly derived from indica and wild rice, which has brought certain difficulties to the genetic improvement of japonica rice, which has relatively low nitrogen use efficiency. Therefore, we selected the main cultivated varieties in production, japonica rice Wu Yun Jing 7 (WYJ7) and indica rice Ming Hui 63 (MH63), as well as the model rice Nipponbare (NIP), to study the effects of the superior allele stp28 (Sugar Transporter Protein 28, STP28) on growth period, yield, and nitrogen use efficiency. This provides excellent genetic loci and superior germplasm resources for agricultural production applications.

[0006] Fan X, Tang Z, Tan Y, et al. Overexpression of a pH-sensitive nitratetransporter in rice increases crop yields. Proceedings of the NationalAcademy of Sciences USA, 2016, 113:7118-7123.

[0007] Guo N, Hu J, Yan M, et al. Oryza sativa Lysine-Histidine-typeTransporter 1 functions in root uptake and root-to-shoot allocation of aminoacids in rice. The Plant Journal, 2020. https: / / doi.org / 10.1111 / tpj.14742.

[0008] Hu B, Wang W, Ou S, et al. Variation in NRT1.1B contributes tonitrate-use divergence between rice subspecies. Nature Genetics, 2015, 47(7): 834-838.

[0009] Li C, Tang Z, Wei J, et al. The OsAMT1.1 gene functions in ammoniumuptake and ammonium-potassium homeostasis over low and high ammoniumconcentration ranges. Journal of Genetics and Genomics, 2016, 43:639-649.

[0010] Ohashi M, Ishiyama K, Kojima S, et al. Lack of Cytosolic GlutamineSynthetase1;2 Activity Reduces Nitrogen-Dependent Biosynthesis of CytokininRequired for Axillary Bud Outgrowth in Rice Seedlings. Plant and CellPhysiology, 2017, 58:679-690.

[0011] Song M, Fan X, Chen J, et al. Characterization of OsNAR2.1interaction with OsNIT1 and OsNIT2 in rice uncovers their different criticalroles in mediating root growth response to nitrate and ammonium. PlantPhysiology, 2020.

[0012] Xia X, Fan

[0013] Zeng D, Qin R, Li M, et al. The ferredoxin-dependent glutamatesynthase (OsFd-GOGAT) participates in leaf senescence and the nitrogenremobilization in rice. Molecular Genetics and Genomics, 2017, 292(2):385-395.

[0014] Wei Haiyan. A study on genotypic differences and physiological mechanisms of nitrogen utilization in rice. Yangzhou: Yangzhou University, 2008.

[0015] Yu Youling, Wu Wenge, Chen Gang, et al. Preliminary screening of nitrogen-efficient rice varieties. Chinese Rice, 2015, 21: 99-102. Summary of the Invention

[0016] The purpose of this invention is to address the shortcomings of the prior art by providing an application of the rice OsSTP28 gene.

[0017] The objective of this invention can be achieved through the following technical solutions:

[0018] The rice OsSTP28 gene, whose genomic sequence in the Nipponbare background is shown in SEQ ID NO.1, with the CDS located at 1522-2005bp and 2112-3198bp in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0019] The genomic sequence of the rice OsSTP28 gene in the Minghui 63 background is shown in SEQ ID NO.3, with CDS located at 587-1069bp and 1176-2264bp in SEQ ID NO.3.

[0020] The rice OsSTP28 gene, whose genomic sequence in the background of Wuyunjing 7 is shown in SEQ ID NO.4, with CDS located at 590-1073bp and 1180-2266bp in SEQ ID NO.4.

[0021] The application of the rice OsSTP28 gene in fine-tuning the growth period of Minghui 63, Wuyunjing 7 and Nipponbare rice varieties, improving rice yield and nitrogen fertilizer use efficiency.

[0022] As a preferred embodiment of the present invention, the application of inhibiting or knocking out the rice OsSTP28 gene in delaying rice heading, increasing rice yield and nitrogen fertilizer use efficiency.

[0023] Application of substances that knock out or inhibit the rice OsSTP28 gene in delaying rice growth period, increasing rice yield, and improving nitrogen fertilizer use efficiency.

[0024] As a preferred embodiment of the present invention, the substance used to knock out or inhibit the rice OsSTP28 gene is a CRISPR / Cas9 gene editing system targeting the rice OsSTP28 gene.

[0025] A method for creating rice materials with delayed growth period, improved yield and nitrogen fertilizer use efficiency, by knocking out or inhibiting the expression of the rice OsSTP28 gene through genetic engineering.

[0026] As a preferred embodiment of the present invention, the rice OsSTP28 gene is knocked out using CRISPR / Cas9 gene editing technology to create rice materials with delayed growth period, improved yield, and increased nitrogen fertilizer use efficiency.

[0027] Beneficial effects:

[0028] This invention provides an application of the rice green-friendly gene OsSTP28 in regulating rice growth period, increasing yield, and improving nitrogen use efficiency. This invention discovers that knocking out the rice OsSTP28 gene can fine-tune the rice growth period, thereby achieving high yield and efficient nitrogen fertilizer use. Attached Figure Description

[0029] Figure 1 Phenotypes of rice stp28 mutant materials and corresponding wild-type rice materials Detailed Implementation

[0030] Example 1: Construction of rice STP28 mutant material

[0031] STP28 mutants were constructed using a CRISPR / Cas9 vector multi-target site system. Following existing CRISPR / Cas9 vector systems and operational methods (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015). A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and DicotPlants. Mol Plant, 8:1274-1284.), two mutant target sites, 5`-CAGGCTCCTCGCGTCGTGGGTCA-3` and 5`-CAGCGCTGCCGTCAACGTGTCCA-3`, were selected for reverse complementary double-strand synthesis. The reaction system for double-strand synthesis was as follows: 10 μM of sense strand and 10 μL of antisense strand, mixed and centrifuged. One cycle of the PCR reaction was as follows: 95℃ for 2 min, 72℃ for 2 min, 55℃ for 2 min, 37℃ for 2 min, 25℃ for 2 min, 15℃ for 2 min, and finally held at 15℃.

[0032] Using the method of cutting and connecting simultaneously, the reaction is as follows:

[0033] 0.5 μl (~20 ng) pYLgRNA-OsU3(Ma 8:1274-1284.);

[0034] 0.5 μl adapter (final concentration 0.05 μM)

[0035] ~5 U BsaI

[0036] 1x Bsa I-endonuclease Buffef

[0037] 1 μl 10x T4 DNA ligase buffer;

[0038] Add ddH2O to 10 μl

[0039] Finally, add approximately 20-35 U (0.05-0.1 μl) of T4 DNA ligase. Cycle the reaction for 5 cycles using a variable temperature cycler (or PCR instrument): 37°C for 5 min, 20°C for 5 min.

[0040] Amplification of gRNA expression cassettes (using a two-step method)

[0041] (a) First round of amplification (2 PCR reactions per gRNA expression cassette, 15 μl each):

[0042] Take 1 μl of the ligation product as a template and use 0.2 μM of each of the following primers: UF (5`-CTCCGTTTTACCTGTGGAATCG-3`) / adapter reverse primers (5`-aaacTGACCCACGACGCGAGGAGCCTG-3` and 5`-aaacTGGACACGTT GACGGCAGCG CTG-3`) (reaction 1), and adapter forward primers (5`-gccgCAGGCTCCTCGCGTCGTGGGTCA-3` and 5`-gccgCAGCGCTGCCGTCAACGTGTCCA-3`) / gRNA-R (5`-CGGAGGAAAATTCCATCCAC-3`) (reaction 2), along with an appropriate amount of high-fidelity PCR enzyme.

[0043] Cycle 25-28: 95℃ for 10s, 60℃ for 15s, 68℃ for 20s

[0044] (b) Second round of PCR:

[0045] Position-specific primer pairs were mixed to form a 10x working solution at a concentration of 1.5 μM, with the primer pair being B1'+ BL (PT1).

[0046] Uctcg-B1': 5-TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG-3

[0047] gRcggt-BL: 5-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3

[0048] Take 1 μl of the products from the first round of PCR reactions 1 and 2, dilute 10-fold with H2O, and mix 1 μl of each as template. Add 1 / 10 of the working solution for each primer combination (final concentration 0.15 μM) to a 50 μl PCR reaction mixture. Use an appropriate amount of KOD-Plus or other high-fidelity PCR enzyme. Amplify for 20 cycles: 95 ℃ for 10 s, 55 ℃ for 15 s, and 68 ℃ for 20 s. Take 2-3 μl for electrophoresis to check if the product length is consistent and estimate the approximate concentration of the sample. Extract the PCR products with phenol, precipitate with ethanol, or purify using a PCR product purification kit.

[0049] The final step involves cutting and connecting simultaneously:

[0050] Take 30 ng of the purified product and add 60 ng of undigested pYLCRISPR / Cas9-MH (B) plasmid (pre-diluted to approximately 100 ng / μl and frozen). Digest with 10 U BsaI at 37 °C for ~10 min in 15 μl of reaction (1x BsaI-endonuclease buffer). Add ~0.5 μl of 10x NEB T4 DNA ligase buffer (or 1.5 μl of 10x Takara T4 DNA ligase buffer) and 35 U ligase. Perform approximately 10-15 cycles of variable-temperature cycling digestion and ligation: 37 °C for 2 min; 10 °C for 3 min; 20 °C for 5 min; and finally 37 °C for 2 min.

[0051] The vector was transformed into Escherichia coli. After plasmid extraction, it was transformed into Agrobacterium and used to infect callus tissues of Nipponbare, Minghui 63 and Wuyunjing 7 rice varieties, respectively, to obtain rice STP28 mutant materials.

[0052] Example 2: Identification of rice stp28 mutant

[0053] Genomic DNA was extracted from the stp28 mutant rice obtained in Example 1. Primers were designed to identify the mutant material, with the sense and antisense primers located approximately 500 bp upstream and downstream of the target site, respectively. The primer sequences are as follows:

[0054] F: CGAGTCAATCTGAGCCACA

[0055] R: TGTCACGGTCTTTGCCTT

[0056] Amplification was performed using Novizan high-fidelity enzyme, resulting in fragments approximately 1500 bp in length, with an annealing temperature of 58℃. The PCR products were sequenced, and the sequences were then aligned. First, three stable genetic materials, named stp28, were obtained against a Nipponbare (NIP) background. NIP -1, stp28 NIP -2 and stp28 NIP -3.

[0057] stp28 NIP -1 is missing 202 bp, and the deleted sequence is as follows: ACGACATCAGCATCGCCGGCGGCGTGTCGTCCATGGAGCCGTTCCTGAGGGACTTCTTCCCGGGCGTGCTCCGGCGGATGGCGGGAGGCGGCGGCGGCGCCGACGGTGGCGCGCCGCCGTCAGCAACTACTGCAAGTTCGACAGTCAGCTGCTGACGCTCTTCACCTCATCGCTCTACATCTCCGGCCTGCTCACCGCCGT.

[0058] stp28 NIP -2 is missing for 58bp, and the missing sequence is as follows: CGGATGGCGGGAGGCGGCGGCGGCGCCGACGGTGGCGCGCCGCGTCAGCAACTACT.

[0059] stp28 NIP -3 is missing 82bp, and the missing sequence is as follows: GGCCAGCCGCGGCCGCCGCGCGTCCATGATCCTCGGCGGCTTCGCCTACATCGCCGGCGCGGCGGTCAGCGGCGCTGCCGTC.

[0060] Three stable genetic materials were obtained in the Ming Hui 63 (MH63) background and named stp28. MH63 -1, stp28 MH63 -2 and stp28 MH63 -3.

[0061] stp28 MH63 -1 is missing for 19bp, and the missing sequence is as follows: GGCGTGCTCCGGCGGATGG.

[0062] stp28 MH63-2 A single base mutation in the amino acid sequence terminates the coding sequence. Original sequence: GGC TAC GAC ATCAGC ATC. Mutated sequence: GGC TA G GAC ATC AGC ATC.

[0063] stp28 MH63-3 The sequence is missing 7bp, and the missing sequence is as follows: TCCATGG.

[0064] Three stable genetic materials were obtained from the Wu Yun Jing7 (WYJ7) background and named stp28. WYJ7 -1, stp28 WYJ7 -2 and stp28 WYJ7 -3.

[0065] stp28 WYJ7 -1 is missing for 34bp, and the missing sequence is as follows: CACGGCGGCGATGGGCGGCGCCATCTACGGCTAC.

[0066] stp28 WYJ7 -2 is missing for 17bp, and the missing sequence is as follows: GCGTGCTCCGGCGGATG.

[0067] stp28 WYJ7 -3 is missing 86bp, and the missing sequence is as follows: CCGTCAACGTGTCCATGGCCATCCTCGGCAGGGCGCTCCTCGGCGTCGGCCTCGGCTTCACCACCCAGgtcacagcactaaaaaat.

[0068] All mutant materials and their corresponding wild types were planted in the same plot, and field phenotypes were statistically analyzed starting from the second generation when the genetic stability was achieved.

[0069] Example 3: Field Trial and Application of Growth Period Effect of Rice stp28 Mutant

[0070] Rice was planted in Baima, Nanjing (119°10′4″E, 31°37′16″N) for three consecutive years in 2020, 2021, and 2022. The row spacing was 25cm, the plant spacing was 15cm, and one plant was planted per hill. Normal water, fertilizer, and pest and disease management were implemented in the field. The normal nitrogen application rate was 350kg / hm². 2 The nitrogen application rate for low-nitrogen fields is 150 kg / hm². 2 All rice materials were grown under identical conditions. Heading date was defined as the number of days from sowing to the appearance of the first inflorescence above the flag leaf; the heading date was observed and recorded daily. For each genetic background mutant, at least three lines were grown and counted, with five biological replicates per line. Mean and standard deviation were calculated using the R package. Under low nitrogen conditions, stp28... NIP The heading date of the mutant material was delayed by an average of 5 days compared to NIP, stp28 MH63 The heading period of the material was delayed by an average of 3 days compared to MH63, stp28 WYJ7 The heading period of the material was delayed by an average of 2 days compared to WYJ7; under normal nitrogen supply conditions, stp28 NIP The heading date of the mutant material was delayed by an average of 6 days compared to NIP, stp28 MH63 The heading date of the material was delayed by an average of 2 days compared to MH63, stp28 WYJ7 The heading period of the material was delayed by an average of 3 days compared to WYJ7.

[0071] Table 1: Heading date (days) of mutants and wild types under low nitrogen and normal nitrogen application conditions

[0072] LN 75 80 87 90 98 100 NN 78 84 86 90 99 102

[0073] Example 4: Application of the yield effect of rice stp28 mutant under low nitrogen and normal nitrogen application conditions

[0074] According to the yield traits recorded in Table 2, under low nitrogen conditions, stp28 NIP The mutant material has an average increase of 4 effective tillers compared to NIP, stp28 MH63 The effective tillering number of the material increases by an average of 3 compared to MH63, STP28 WYJ7 Compared to WYJ7, the material has an average increase of 1 particle; similarly, under low nitrogen conditions, for both the number of filled particles and the total number of particles, stp28... NIP The mutant material showed an average increase of 162 and 213 particles compared to NIP, respectively, at stp28. MH63 The material has an average increase of 194 and 224 particles compared to MH63, STP28 WYJ7 Compared to WYJ7, the material showed an average increase of 45 and 109 seeds per plant; finally, regarding the yield per plant under low nitrogen conditions, stp28... NIPThe mutant material increased by an average of 3g compared to NIP, stp28 MH63 The material content is 3g higher on average compared to MH63, STP28 WYJ7 The material increased by an average of 2g compared to WYJ7.

[0075] In addition, under normal nitrogen supply conditions, STP28 NIP The mutant material has an average increase of 2 effective tillers compared to NIP, stp28 MH63 The effective tillering number of the material increases by an average of 4 compared to MH63, STP28 WYJ7 Compared to WYJ7, the material has an average increase of 3 particles; measurements of the number of filled particles and the total number of particles under normal nitrogen supply conditions indicate that stp28... NIP The mutant material showed an average increase of 155 and 249 particles compared to NIP, respectively, at stp28. MH63 The material has an average increase of 164 and 235 particles compared to MH63, STP28 WYJ7 Compared to WYJ7, the material showed an average increase of 230 and 308 seeds; finally, for the yield per plant under normal conditions, stp28... NIP The mutant material increased by an average of 2g compared to NIP, stp28 MH63 The material content is 4g higher on average compared to MH63, STP28 WYJ7 The material is 4g larger on average compared to WYJ7.

[0076] Table 2: Summary of agronomic traits of mutants and wild types under low nitrogen conditions

[0077] NIP 7.7 748 825.7 21 <![CDATA[stp28 NIP ]]> 12.1 911.3 1039.5 24.6 MH63 10.1 1205.1 1530.7 24.9 <![CDATA[stp28 MH63 ]]> 13.5 1400 1754 28.2 WYJ7 9.2 1515.2 2191.6 36.2 <![CDATA[stp28 WYJ7 ]]> 10 1560.5 2300.3 38.2

[0078] Table 3: Summary of agronomic traits of mutants and wild types under normal nitrogen supply conditions

[0079] NIP 13.3 1080.6 1229.3 31.3 <![CDATA[stp28 NIP ]]> 15.7 1235.6 1478.1 33.9 MH63 19.3 1187.9 1965.1 28.8 <![CDATA[stp28 MH63 ]]> 23 1351.3 2200.8 33.1 WYJ7 13 2116.1 3126.6 44.7 <![CDATA[stp28 WYJ7 ]]> 16.1 2346.2 3434.8 49

[0080] Example 5: Application of nitrogen use efficiency effect of rice stp28 mutant in experimental design

[0081] Using the same materials grown under the same conditions as in Example 3, the biomass of the stp28 mutant material was significantly higher than that of the wild-type material under both normal and low nitrogen application conditions. The stp28 mutant material and the corresponding wild-type were blanched and dried at 105°C, then separated and digested. The nitrogen concentration in each part was determined using the Kjeldahl method, and nitrogen use efficiency was calculated using the following three formulas.

[0082] ① Traditional nitrogen fertilizer utilization efficiency (%) = [(cumulative nitrogen absorption of rice in nitrogen-applied areas (kg) – cumulative nitrogen absorption of rice in areas without nitrogen fertilizer (kg)) / total amount of fertilizer nitrogen (kg)] * 100%; characterizes the proportion of nitrogen fertilizer absorbed (recovered) by rice in the current season;

[0083] ② Nitrogen physiological use efficiency (kg / kg) = Rice grain yield (or biomass) kg / Total amount of nitrogen absorbed by rice (kg); characterizes the efficiency of converting nitrogen absorbed by rice plants into yield within the plant.

[0084] ③ Agronomic nitrogen fertilizer use efficiency (kg / kg) = (rice yield in nitrogen-fertilized area (kg) – rice yield in non-nitrogen-fertilized area (kg)) / total nitrogen fertilizer applied (kg); characterizes the contribution of a unit amount of nitrogen fertilizer to the increase in rice yield.

[0085] Under low nitrogen conditions, STP28 NIP The conventional nitrogen fertilizer use efficiency of the mutant materials increased by an average of 2.3% compared to NIP, stp28 MH63 The material yielded an average increase of 2.5 compared to MH63, STP28. WYJ7 The material showed an average increase of 2.4 compared to WYJ7; regarding nitrogen physiological utilization efficiency, stp28 NIP The material yields an average increase of 1.7 compared to NIP, STP28. MH63 The material yielded an average increase of 3.4 compared to MH63, STP28. WYJ7 Compared to WYJ7, the average increase in nitrogen fertilizer use efficiency was 4.7%; finally, calculations of agronomic nitrogen fertilizer use efficiency among various materials showed that stp28... NIP The material yields an average increase of 1.5 compared to NIP, STP28. MH63 The material yielded an average increase of 2.2 compared to MH63, STP28. WYJ7 The material's average increase was 0.9 compared to WYJ7.

[0086] Under normal nitrogen supply conditions, for traditional nitrogen fertilizer utilization efficiency, stp28 NIP The mutant material showed an average increase of 3.4 compared to NIP, and stp28 MH63 The material yielded an average increase of 2.2 compared to MH63, STP28. WYJ7 The material showed an average increase of 1.2 compared to WYJ7; regarding nitrogen physiological utilization efficiency, stp28 NIP The material yields an average increase of 1.7 compared to NIP, STP28. MH63 The material yielded an average increase of 2.7 compared to MH63, STP28. WYJ7 Compared to WYJ7, the average increase in nitrogen fertilizer use efficiency was 3.0; finally, calculations of agronomic nitrogen fertilizer use efficiency among various materials showed that stp28... NIP The material yields an average increase of 2.0 compared to NIP, STP28. MH63 The material yielded an average increase of 2.2 compared to MH63, STP28. WYJ7 The material's strength increased by an average of 1.9 compared to WYJ7.

[0087] Table 4: Nitrogen use efficiency of mutants and wild types under low nitrogen conditions

[0088] WT 37.5 64.7 10.2 <![CDATA[stp28 NIP ]]> 39.8 67.9 11.7 MH63 15.1 74.2 38.2 <![CDATA[stp28 MH63 ]]> 17.6 77.6 40.5 WYJ7 36.7 65.4 26.2 <![CDATA[stp28 WYJ7 ]]> 39.2 70.1 27.1

[0089] Table 5: Nitrogen use efficiency of mutants and wild types under normal nitrogen conditions

[0090] WT 21.1 53.2 7.1 <![CDATA[stp28 NIP ]]> 24.6 54.9 9.1 MH63 7.9 62.9 21.1 <![CDATA[stp28 MH63 ]]> 10.1 65.6 23.4 WYJ7 29.0 56.0 11.5 <![CDATA[stp28 WYJ7 ]]> 30.2 59.0 13.4

Claims

1. The application of substances that knock out or inhibit the rice OsSTP28 gene in delaying rice heading date, increasing rice yield, and improving nitrogen fertilizer use efficiency, characterized in that... The rice OsSTP28 gene, the genome sequence of which is shown in Nipponbare background is shown in SEQ ID NO.1, the CDS is located at 1522-2005bp and 2112-3198bp in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2; The genome sequence of this gene in the Minghui 63 background is shown in SEQ ID NO.3, with CDS located at 587-1069bp and 1176-2264bp in SEQ ID NO.3; the genome sequence of this gene in the Wuyunjing 7 background is shown in SEQ ID NO.4, with CDS located at 590-1073bp and 1180-2266bp in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that... The substance used to knock out or inhibit the rice OsSTP28 gene as described in claim 1 is a CRISPR / Cas9 gene editing system targeting the rice OsSTP28 gene or siRNA targeting the rice OsSTP28 gene.

3. The application of substances that knock out or inhibit the rice OsSTP28 gene as described in claim 1 in constructing rice materials with delayed heading date, improved yield, and enhanced nitrogen fertilizer use efficiency.

4. The application according to claim 3, characterized in that... The substance used to knock out or inhibit the rice OsSTP28 gene as described in claim 1 is a CRISPR / Cas9 gene editing system targeting the rice OsSTP28 gene or siRNA targeting the rice OsSTP28 gene.

5. A method for creating rice materials with delayed heading date, improved yield, and increased nitrogen fertilizer use efficiency, characterized in that... The expression of the rice OsSTP28 gene as described in claim 1 is knocked out or suppressed by genetic engineering methods.

6. The method according to claim 5, characterized in that... The OsSTP28 gene in rice was knocked out using CRISPR / Cas9 gene editing technology to create rice materials with delayed heading date, improved yield, and enhanced nitrogen fertilizer use efficiency.

Images