Her2 binding polypeptides and uses thereof

Abstract

The application relates to a HER2 binding polypeptide and a diagnostic and therapeutic radionuclide label, a preparation method and application thereof. The HER2 binding polypeptide sequence of the application has good in-vivo stability and pharmacokinetic properties, and an immunocompound synthesized by labeling the HER2 binding polypeptide sequence with a diagnostic or therapeutic radionuclide label has good affinity and functional activity to a HER2 molecule, and is expected to become a targeted HER2 imaging and tumor treatment radioactive drug with good application prospect.

Description

Technical Field

[0001] This application relates to the field of biomedicine, specifically to a HER2-binding polypeptide and its uses. Background Technology

[0002] Human epidermal growth factor receptor 2 (HER2) is a member of the epidermal growth factor receptor (EGFR) family and is expressed to varying degrees in a variety of tumor tissues. HER2 amplification or overexpression is closely associated with high tumor invasiveness, high recurrence rate, and increased mortality.

[0003] Conventional cancer treatments include surgery, radiotherapy, and chemotherapy, which, while producing therapeutic effects, also damage and toxicize other normal cells. Although targeted therapy has emerged in recent years and has extended patient survival to some extent, it is prone to drug resistance. For example, significant resistance to trastuzumab treatment for breast cancer typically develops after about a year. Therefore, a radioactive targeted therapy drug with a different killing mechanism is needed as an alternative treatment option. After binding to the tumor site, the radioactive targeted therapy drug can physically kill tumor cells with radiation released by the radionuclide.

[0004] There is a need in this field for detection agents that can be used to detect cells expressing HER2 and therapeutic agents that target HER2-positive tumors, so as to provide effective molecular imaging and targeted therapy for patients with HER2-positive tumors. Summary of the Invention

[0005] The purpose of this invention is to provide a HER2-binding polypeptide, as well as a diagnostic and therapeutic radionuclide marker, its preparation method, and its application.

[0006] On one hand, this application provides a HER2-binding polypeptide that competitively binds to the HER2 protein with a reference antibody, wherein the reference antibody comprises a heavy chain variable region (VH); wherein the VH comprises the amino acid sequence shown in SEQ ID NO:10.

[0007] In some embodiments, in an ELISA assay, the HER2-binding peptide is able to react at a Kc not exceeding about 1.20E-09. D The value binds to the HER2 protein.

[0008] In some embodiments, the HER2-binding polypeptide has one or more of the following properties:

[0009] (i) It can bind to the packing material of A3 affinity chromatography columns;

[0010] (ii) It can bind to HER2 with the same or higher affinity compared to the reference antibody with the amino acid sequence shown in SEQ ID NO:1;

[0011] (iii) It exhibits increased expression levels compared to the reference antibody with the amino acid sequence shown in SEQ ID NO:1; and

[0012] (iv) Its isoelectric point is increased compared to the reference antibody with the amino acid sequence shown in SEQ ID NO:1.

[0013] In some embodiments, the HER2-binding polypeptide comprises an antibody or an antigen-binding fragment thereof.

[0014] In some embodiments, the antibody includes monoclonal antibodies, multispecific antibodies, chimeric antibodies, humanized antibodies, and / or fully human antibodies.

[0015] In some embodiments, the antigen-binding fragment includes Fab, Fab', Fv fragment, F(ab')2, scFv, VHH, and / or dAb.

[0016] In some embodiments, the VHH is camelidoid, chimeric, human, partially humanized, or fully humanized.

[0017] In some embodiments, it comprises at least one CDR of the amino acid sequence shown in any one of SEQ ID NO:158, SEQ ID NO:2 to SEQ ID NO:12.

[0018] In some embodiments, it comprises HCDR1, HCDR2 and HCDR3 of any of the amino acid sequences shown in SEQ ID NO:158, SEQ ID NO:2 to SEQ ID NO:12.

[0019] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in any one of SEQ ID NO:159, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:21.

[0020] In some embodiments, the HCDR1 comprises the amino acid sequences shown in SEQ ID NO:13, SEQ ID NO:86, and SEQ ID NO:87.

[0021] In some embodiments, the HCDR1 comprises the amino acid sequences shown in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24.

[0022] In some embodiments, the HCDR2 comprises the amino acid sequence shown in any one of SEQ ID NO:160, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:34.

[0023] In some embodiments, the HCDR2 comprises the amino acid sequences shown in SEQ ID NO:25, SEQ ID NO:88, and SEQ ID NO:89.

[0024] In some embodiments, the HCDR2 comprises the amino acid sequence shown in any one of SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37.

[0025] In some embodiments, the HCDR3 comprises the amino acid sequence shown in any one of SEQ ID NO:161, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46.

[0026] In some embodiments, the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:38, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95 or SEQ ID NO:96.

[0027] In some embodiments, the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:47 or SEQ ID NO:48.

[0028] In some embodiments, it comprises VH, wherein VH comprises: HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO:159, HCDR2 comprises the amino acid sequence shown in SEQ ID NO:160, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO:161; or

[0029] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:14, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:26, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:39; or

[0030] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:15, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:27, and the HCDR3 contains the amino acid sequence shown in any one of SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, and SEQ ID NO:45; or

[0031] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:21, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:34, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:46.

[0032] In some embodiments, it comprises VH, wherein VH comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO:13, SEQ ID NO:86, or SEQ ID NO:87, HCDR2 comprises the amino acid sequence shown in SEQ ID NO:25, SEQ ID NO:88, or SEQ ID NO:89, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO:38, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, or SEQ ID NO:96.

[0033] In some embodiments, it comprises VH, wherein VH comprises: HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO:16, HCDR2 comprises the amino acid sequence shown in SEQ ID NO:28, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO:40; or

[0034] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:17, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:29, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:41; or

[0035] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:18, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:30, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:42; or

[0036] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:19, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:31, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:43; or

[0037] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:16, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:32, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:44; or

[0038] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:20, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:33, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:45; or

[0039] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:22, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:35, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:47; or

[0040] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:23, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:36, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:48; or

[0041] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:24, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:37, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:47.

[0042] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises the amino acid sequence shown in any one of SEQ ID NO:158, SEQ ID NO:2 to SEQ ID NO:12.

[0043] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises the amino acid sequence shown in any one of SEQ ID NO:1, SEQ ID NO:118 to SEQ ID NO:157.

[0044] In some embodiments, the HER2-binding polypeptide contains at least one VH.

[0045] In some embodiments, the HER2-binding polypeptide comprises a nanobody containing the amino acid sequence shown in any one of SEQ ID NO:158, SEQ ID NO:2 to SEQ ID NO:12.

[0046] In some embodiments, the HER2-binding polypeptide comprises a nanobody containing an amino acid sequence shown in any one of SEQ ID NO:1, SEQ ID NO:118 to SEQ ID NO:157.

[0047] On the other hand, this application provides one or more isolated nucleic acid molecules that encode the HER2-binding polypeptide described in this application.

[0048] On the other hand, this application provides a construct comprising the nucleic acid molecule described in this application.

[0049] On the other hand, this application provides a cell that contains the nucleic acid molecules or constructs described in this application.

[0050] On the other hand, this application provides a method for preparing the HER2-binding polypeptide described in this application, comprising culturing the cells described in this application under conditions that allow the expression of the HER2-binding polypeptide.

[0051] In some embodiments, the method further includes recovering the HER2-binding peptide expressed by the cells.

[0052] In some embodiments, the method further includes purifying and / or modifying the HER2-binding peptide.

[0053] On the other hand, this application provides an immunoconjugate comprising the HER2-binding polypeptide described in this application.

[0054] In some embodiments, the immunoconjugate comprises:

[0055] i) The HER2-binding polypeptide described in this application;

[0056] ii) Conjugates selected from the following group: detectable markers, drugs, toxins, cytokines, viral capsid proteins or VLPs, or combinations thereof.

[0057] In some embodiments, the detectable marker is selected from one or more reagents from the group consisting of: radionuclides, fluorescent agents, chemiluminescent agents, bioluminescent agents, paramagnetic ions, and enzymes.

[0058] In some embodiments, the radionuclide is suitable for medical imaging and / or treatment.

[0059] In some embodiments, the radionuclide includes 110 In、 111 In、 177 Lu、 18 F, 52 Fe、 62 Cu、 67 Cu、 67 Ga、 68 Ga、 68 Ge 86 Y、 90 Y、 89 Zr、 94m Tc, 120 I, 123 I, 124 I, 125 I, 131 I, 154-158 Gd, 32 P, 11 C 13 N、 15 O、 186 Re、 188 Re、 51 Mn, 52m Mn, 72 As、 75 Br、 76 Br、 82m Rb、 83 Sr or other γ-, β-, or positron emitters.

[0060] In some embodiments, the HER2-binding polypeptide is conjugated directly or indirectly to the detectable marker.

[0061] In some embodiments, the HER2-binding polypeptide is conjugated to the detectable marker via a chelating agent.

[0062] In some embodiments, the chelating agent is selected from one or more of DTPA, EDTA, NOA, DOTA, TRAP, TETA, NETA, CB-TE2A, Cyclen, Cyclam, Bispidine, TACN, ATSM, SarAr, AmBaSar, MAG3, MAG2, HYNIC, DADT, EC, NS3, H2dedpa, HBED, DFO, PEPA, HEHA, and their derivatives.

[0063] On the other hand, this application provides a composition comprising the HER2-binding polypeptide described in this application, the nucleic acid molecule described in this application, the construct described in this application, the cell described in this application, and / or the immunoconjugate described in this application, and optionally a pharmaceutically acceptable carrier.

[0064] In some embodiments, the composition comprises the HER2-binding polypeptide or the immunoconjugate described in this application, and the composition is a detection agent or a therapeutic agent.

[0065] In some embodiments, the detection agent is a reagent for detecting HER2 protein.

[0066] In some embodiments, the detection agent is a contrast agent.

[0067] In some embodiments, the contrast agent is a contrast agent for detecting HER2 protein.

[0068] In some embodiments, the therapeutic agent is used to treat tumors.

[0069] In some embodiments, the therapeutic agent is used to treat HER2-positive tumors.

[0070] On the other hand, this application provides the use of the HER2 binding peptide, nucleic acid molecule, construct, cell, immunoconjugate and / or composition described in this application in the preparation of pharmaceuticals, reagents, detection plates or kits;

[0071] The reagents, test plates, or kits mentioned above are used to detect HER2 protein in samples;

[0072] The agent is used to detect the expression of HER2 protein and / or to treat tumors expressing HER2.

[0073] On the other hand, this application provides a recombinant protein comprising the HER2-binding polypeptide described in this application.

[0074] In some embodiments, the recombinant protein comprises: (i) the HER2-binding polypeptide described in this application; and (ii) an optional tag sequence for expression and / or purification.

[0075] On the other hand, this application provides a method for detecting the presence and / or amount of HER2 in a biological sample, comprising: contacting the biological sample with the HER2-binding peptide, the immunoconjugate, or the composition described in this application.

[0076] In some embodiments, the contact is performed outside the body or outside the body.

[0077] In some embodiments, the biological sample is a tissue.

[0078] In some embodiments, the tissue is selected from blood tissue, lymphatic tissue, and tumor tissue.

[0079] In some embodiments, the method includes detecting the presence and / or amount of HER2-positive cells in a biological sample.

[0080] In some implementations, the presence and / or amount of HER2-positive cells in a biological sample are determined by imaging.

[0081] In some implementations, the presence and / or quantity of HER2-positive cells in a biological sample are determined by flow cytometry.

[0082] On the other hand, this application provides a method for detecting and / or diagnosing diseases or conditions associated with abnormal HER2 expression, including administering the HER2-binding peptide, the immunoconjugate, or the composition described in this application to a subject in need of such treatment.

[0083] In some embodiments, the method further includes imaging the subject.

[0084] In some embodiments, the imaging includes ECT imaging.

[0085] In some embodiments, the ECT imaging includes SPECT imaging or PET imaging.

[0086] In some implementations, the disease or condition associated with abnormal HER2 expression includes tumors.

[0087] On the other hand, this application provides a method for treating and / or preventing tumors, the method comprising administering to a subject in need the HER2-binding peptide, the immunoconjugate, or the composition described in this application.

[0088] On the other hand, this application provides a method for monitoring the efficacy of an antitumor therapy in a subject, the method comprising:

[0089] (i) administering the HER2-binding peptide, the immunoconjugate, or the composition described in this application to a subject suffering from a tumor and receiving antitumor therapy; and

[0090] (ii) Determine the amount of HER2-positive cells in the subject's tumor.

[0091] In some implementations, the presence and / or quantity of HER2-positive cells in the subject's tumor are determined by imaging.

[0092] In some embodiments, the tumor includes a HER2-positive tumor.

[0093] In some embodiments, the tumor includes a solid tumor.

[0094] In some embodiments, the tumor is selected from at least one of the following: breast cancer, gastric cancer, esophageal cancer, bile duct cancer, ovarian cancer, pancreatic cancer, endometrial cancer, cervical squamous cell carcinoma, salivary gland tumor, bladder cancer, lung cancer, colorectal cancer, head and neck cancer, prostate cancer, osteosarcoma, and pediatric medulloblastoma.

[0095] On the other hand, this application provides a kit comprising the HER2-binding peptide, the immunoconjugate, or the composition described in this application.

[0096] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0097] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:

[0098] Figures 1A - 1C This shows the binding of the anti-Her2 antibody described in this application to N87 cells;

[0099] Figure 2 The results shown are the KD affinity test results for the anti-Her2 antibody H1 described in this application;

[0100] Figure 3 The results shown are the KD affinity test results for the anti-Her2 antibody H2 described in this application;

[0101] Figures 4A - 4B The results show the epitope competition between the anti-Her2 antibody described in this application and Herceptin;

[0102] Figure 5 The image shows the binding of the anti-Her2 antibody H1 (Her2-Nb1) described in this application to BT474 cells;

[0103] Figure 6 This shows the binding of the anti-Her2 antibody H1 described in this application to MCF7 cells;

[0104] Figure 7 This shows the single-point binding of the anti-Her2 antibody H1 described in this application to BT474 cells;

[0105] Figure 8 The results shown are the internalization results of the anti-Her2 antibody H1 described in this application;

[0106] Figure 9 This application describes... 125 I-labeled anti-Her2 antibody ( 125 The saturation binding curve of I-Her2-Nbs in cells (SKOV3);

[0107] Figure 10 This application describes... 125 Biodistribution of I-Her2-Nb1 in BT474 tumors;

[0108] Figure 11 This application describes... 125 Dynamic imaging of I-Her2-Nb1 in BT474 tumor;

[0109] Figure 12 This application describes... 99m TC-Her2-Nb1 was visualized on SPE CT / CT scans of BT474 tumor;

[0110] Figure 13 This application describes... 177Biological distribution of Lu-Her2-Nb1 in MCF7 tumors;

[0111] Figure 14 This application describes... 177 Antitumor effects of Lu-Her2-Nb1.

[0112] Figures 15A - 15B The results shown are SDS-PAGE analysis results of the H1 antibody before and after mutation and purification as described in this application. Detailed Implementation

[0113] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.

[0114] Terminology Definition

[0115] In this application, the term "HER2" generally refers to a type I transmembrane protein belonging to the epidermal growth factor receptor family, also known as c-erbB2, ErbB2, or Neu. The term "HER2" also encompasses homologues, variants, and isotypes of HER2, including splice isotypes. HER2 is associated with tumor transformation in human breast cancer cells, as evidenced by overexpression of the HER2 protein detected in patients with breast cancer, gastric cancer, pancreatic cancer, ovarian cancer, peritoneal cancer, or colorectal cancer. The terms "HER2 positive" and "HER2-expressing" are used interchangeably in this application. A "HER2-positive" tumor comprises tumor cells with higher than normal levels of HER2. Examples of HER2-positive tumors include HER2-positive breast cancer and HER2-positive gastric cancer. Optionally, HER2 positivity is a cancer that overexpresses HER2, and in some embodiments, HER2-positive cancer has an immunohistochemical (IHC) score of 2+ or 3+ and / or an in situ hybridization (ISH) amplification rate ≥2.0.

[0116] In this application, the term "HER2-binding polypeptide" refers to any polypeptide capable of specifically binding to HER2. In some embodiments, the binding polypeptide is an antibody. In other embodiments, the binding polypeptide is, for example, an antibody mimic, a cytokine, or a growth factor. For example, the single-domain antibody that specifically binds to HER2 in this application. "HER2-binding polypeptide" may also refer to a monovalent polypeptide that binds to HER2 (i.e., a polypeptide that binds to one epitope of HER2), as well as a divalent or multivalent binding polypeptide (i.e., a binding polypeptide that binds to more than one epitope). The "HER2-binding polypeptide" of this application may contain at least one variable domain that binds to HER2. In some embodiments, the "HER2-binding polypeptide" of this application may contain 2, 3, 4, or more variable domains that bind to HER2. In addition to the variable domain that binds to HER2, the HER2-binding polypeptide of this application may also contain a linker and / or a portion having effector function, such as a half-life extension portion (e.g., a variable domain that binds to serum albumin), and / or a fusion coupler (e.g., serum albumin) and / or a conjugated polymer (e.g., PEG) and / or an Fc region. In some embodiments, the “HER2-binding polypeptide” of this application also encompasses a bispecific antibody containing a variable domain that binds to different antigens.

[0117] In this application, the term "antibody" is used in the broadest sense and specifically encompasses monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, provided they exhibit the desired biological activity (Miller et al. (2003) Jour. of Immunology 170:4854-4861), namely, binding to HER2. Antibodies can be mouse, human, humanized, chimeric, or derived from other species.

[0118] Full-length antibodies typically refer to antibodies composed of two full-length antibody heavy chains and two full-length antibody light chains.

[0119] A “full-length antibody heavy chain” is typically a polypeptide consisting of an antibody heavy chain variable domain (VH), an antibody heavy chain constant domain 1 (CH1), an antibody hinge region (HR), an antibody heavy chain constant domain 2 (CH2), and an antibody heavy chain constant domain 3 (CH3) in the N-terminal to C-terminal direction, abbreviated as VH-CH1-HR-CH2-CH3; and in the case of IgE subclass antibodies, optionally also including an antibody heavy chain constant domain 4 (CH4). In some embodiments, a “full-length antibody heavy chain” is a polypeptide consisting of VH, CH1, HR, CH2, and CH3 in the N-terminal to C-terminal direction. A “full-length antibody light chain” is typically a polypeptide consisting of an antibody light chain variable domain (VL) and an antibody light chain constant domain (CL) in the N-terminal to C-terminal direction, abbreviated as VL-CL. The antibody light chain constant domain (CL) can be κ (kappa) or λ (lambda). Two full-length antibody chains are linked together by interpeptide disulfide bonds between the CL and CH1 domains and between the interpeptide disulfide bonds in the hinge region of the full-length antibody heavy chain. Typical examples of full-length antibodies are natural antibodies such as IgG (e.g., IgG1 and IgG2), IgM, IgA, IgD, and IgE).

[0120] In this application, the term "antigen-binding fragment" generally refers to a portion of an antibody molecule containing amino acids responsible for the specific binding between the antibody and the antigen. The portion of the antigen that is specifically recognized and bound by the antibody is called an "epitope," as described above. An antigen-binding domain typically includes a variable region (VL) and a variable region (VH) of the antibody light chain; however, it is not necessary to include both. Fd fragments, for example, have two VH regions and typically retain some of the antigen-binding function of the intact antigen-binding domain. Examples of antigen-binding fragments of antibodies include (1) Fab fragments, monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains; (2) F(ab')2 fragments, bivalent fragments having two Fab fragments connected by disulfide bridges of hinge regions; (3) Fd fragments having two VH and CH1 domains; (4) Fv fragments having VL and VH domains of an antibody single arm; (5) dAb fragments (Ward et al., “Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli,” Nature 341:544-546 (1989), which are incorporated herein by reference in their entirety), having a VH domain; (6) separate complementarity-determining regions (CDRs); and (7) single-chain Fv (scFv), for example derived from scFV libraries.Although the two domains VL and VH of the Fv fragment are encoded by independent genes, they can be conjugated using a recombination method via a synthetic linker. The synthetic linker allows it to be prepared as a single protein chain in which the VL and VH regions pair to form a monovalent molecule (called single-chain Fv (scFv)) (see, for example, Huston et al., “Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichiacoli,” Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)); and (8) VHH, “VHH” refers to the variable antigen-binding domain of heavy chain antibodies from camelids (camels, dromedaries, llamas, alpacas, etc.) (see Nguyen VK et al., 2000, The EMBO Journal, 19, 921-930; Muyldermans S., 2001, J Biotechnol., 74, 277-302 and review Vanlandschoot P. et al., 2011, Antiviral Research 92, 389-407). VHHs may also be referred to as nanobodies (Nb) and / or single-domain antibodies. These antibody fragments are obtained using conventional techniques known to those skilled in the art and their function is evaluated in the same manner as that of intact antibodies.

[0121] In this application, the term "variable domain" generally refers to a variable domain of an antibody capable of specifically binding to an antigenic epitope. For example, antibody variable domains VH and VL (VH domain and VL domain). Another example of a variable domain is the "VHH domain" (or simply "VHH"). The "VHH domain" is also known as a heavy chain single-domain antibody, VHH, V... HThe H domain, VHH antibody fragment, and VHH antibody are variable domains of antigen-binding immunoglobulins called "heavy chain antibodies" (i.e., "antibodies lacking light chains") (Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, Bendahman N, Hamers R.: "Naturally occurring antibodies devoid of light chains"; Nature 363, 446-448 (1993)). The term "VHH domain" is used to distinguish the variable domain from the heavy chain variable domain (referred to herein as the "VH domain") present in conventional 4-chain antibodies and the light chain variable domain (referred herein as the "VL domain") present in conventional 4-chain antibodies. The VHH domain specifically binds to epitopes without the need for other antigen-binding domains (unlike the VH or VL domains in conventional 4-chain antibodies, in which case their epitopes are recognized by the VL domain along with the VH domain).

[0122] In this application, the "variable domains" generally have the same overall structure, with each domain containing four highly conserved frame (FR) regions. The FR regions include four "frame regions": "Frame Region 1" or "FR1", "Frame Region 2" or "FR2", "Frame Region 3" or "FR3", and "Frame Region 4" or "FR4". The three "complementarity-determining regions" or "CDR1", "complementarity-determining region 2" or "CDR2", and "complementarity-determining region 3" or "CDR3" of the FR regions are connected. The general structure or sequence of the variable domain can be represented as: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Antibody variable domains endow antibodies with antigen specificity due to the presence of antigen-binding sites.

[0123] In this application, the term "CDR" generally refers to the complementarity-determining region within the antibody variable sequence. There are three CDRs in each variable region of the heavy and light chains, designated CDR1, CDR2, and CDR3 for each variable region. The precise boundaries of these CDRs have been defined differently depending on the system. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides a definitive residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs. These CDRs may be referred to as Kabat CDRs. Chothia and colleagues (Chothia & Lesk, J. MoI. Biol. 196:901-917 (1987) and Chothia et al., Nature 342:877-883 (1989)) found that some sub-regions within the Kabat CDRs take almost the same peptide skeleton image, despite significant differences at the amino acid sequence level. These sub-regions are designated as L1, L2, and L3, or H1, H2, and H3, where “L” and “H” refer to the light chain and heavy chain regions, respectively. These regions may be referred to as Chothia CDRs, which have similar characteristics to the Kabat CDRs. CDR overlap boundaries. Other boundaries defining CDRs overlapping with the Kabat CDR have been described in Padlan (FASEB J.9:133-139 (1995)) and MacCallum (JMoI Biol 262(5):732-45 (1996)). Other CDR boundaries may not strictly follow one of the above systems but still overlap with the Kabat CDR, although they may be shortened or lengthened according to predictions or experimental findings, and specific residues or groups of residues or even the entire CDR may not significantly affect antigen binding. Unless otherwise expressly stated in the specification, as used in this application, the terms “CDR,” “HCDR1,” “HCDR2,” “HCDR3,” “LCDR1,” “LCDR2,” and “LCDR3” include the CDR as defined by any of the methods described above (Kabat, Chothia, or IMGT).

[0124] In this application, the term "monoclonal antibody" generally refers to an antibody obtained from a substantially homogeneous group of antibodies, meaning that the individual antibodies in the cluster are identical, except for a small number of possible natural mutations. Monoclonal antibodies typically exhibit high specificity against a single antigenic site. Moreover, unlike conventional polyclonal antibody formulations (which usually have different antibodies targeting different determinants), each monoclonal antibody targets a single determinant on the antigen. In addition to their specificity, monoclonal antibodies have the advantage that they can be synthesized through hybridoma culture without contamination by other immunoglobulins. The modifier "monoclonal" indicates the characteristic of antibodies obtained from a substantially homogeneous group of antibodies and is not to be interpreted as requiring the antibody to be produced by any particular method. For example, the monoclonal antibodies used in this application can be prepared in hybridoma cells or by recombinant DNA methods.

[0125] In this application, the term "humanized antibody" generally refers to an antibody in which some or all of the amino acids outside the CDR region of a non-human antibody (e.g., a mouse antibody) are replaced by corresponding amino acids derived from human immunoglobulins. Small additions, deletions, insertions, substitutions, or modifications of amino acids in the CDR region are also permissible, as long as they retain the antibody's ability to bind to a specific antigen. Humanized antibodies may optionally contain at least a portion of the constant region of human immunoglobulins. "Humanized antibodies" retain antigen specificity similar to the original antibody. The "humanized" form of a non-human (e.g., mouse) antibody may minimally contain a chimeric antibody with a sequence derived from a non-human immunoglobulin. In some cases, CDR region residues in a human immunoglobulin (receptor antibody) may be replaced with CDR region residues from a non-human species (donor antibody) (such as a mouse, rat, rabbit, or non-human primate) having the desired properties, affinity, and / or capabilities. In some cases, FR region residues in a human immunoglobulin may be replaced with corresponding non-human residues. Furthermore, humanized antibodies may contain amino acid modifications not found in receptor antibodies or in donor antibodies. These modifications can be made to further improve antibody performance, such as binding affinity.

[0126] In this application, the term "fully human antibody" generally refers to an antibody expressed by transferring a human antibody-encoding gene into a genetically engineered animal lacking an antibody gene. All parts of the antibody (including the variable and constant regions) are encoded by a human-derived gene. Fully human antibodies can significantly reduce the immune side effects caused by heterologous antibodies in humans. Methods for obtaining fully human antibodies in this field include phage display technology, transgenic mouse technology, ribosome display technology, and RNA-peptide technology, among others.

[0127] In this application, the term "reference antibody" generally refers to an antibody that competes with the antigen-binding protein described in this application for binding to an antigen (e.g., HER2).

[0128] The term “competition” when used in the context of competing antigen-binding proteins for the same epitope generally refers to competition between antigen-binding proteins, such as that determined by an assay in which the antigen-binding protein being tested (e.g., an antibody or an immune-functional fragment thereof) prevents or inhibits (e.g., reduces) the specific binding of a reference antigen-binding protein (e.g., a ligand or a reference antibody) to a common antigen (e.g., HER2 or a fragment thereof). Many types of competitive binding assays can be used to determine whether one antigen-binding protein competes with another, such as: solid-phase direct or indirect radioimmunoassay (RIA), solid-phase direct or indirect enzyme immunoassay (EIA), sandwich competition assay (see, for example, Stahli et al., 1983, Methods in Enzymology 9: 242-253); solid-phase direct biotin-avidin EIA (see, for example, Kirkland et al., 1986, J. Immunol. 137: 3614-3619); solid-phase direct labeling assay; solid-phase direct labeling sandwich assay (see, for example, Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor). Press); solid-phase direct-labeled RIA using I-125 (see, for example, Morel et al., 1988, Molec. Immunol. 25: 7-15); solid-phase direct biotin-avidin EIA (see, for example, Cheung et al., 1990, Virology 176: 546-552); and direct-labeled RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32: 77-82). Typically, this assay involves the use of purified antigen or a unit carrying any of these bound to a solid surface, an unlabeled test antigen-binding protein, and a labeled reference antigen-binding protein. Competitive inhibition is measured by determining the amount of labeling bound to the solid surface or unit in the presence of the test antigen-binding protein. Typically, an excess of the test antigen-binding protein is present. Antigen-binding proteins identified by competitive assays (competitive antigen-binding proteins) include antigen-binding proteins that bind to the same epitope as the reference antigen-binding protein and antigen-binding proteins that bind to adjacent epitopes that are sterically hindered by sufficient proximity to the epitope bound to the reference antigen-binding protein. Typically, when a competitive antigen-binding protein is present in excess, it inhibits (e.g., reduces) the specific binding of the reference antigen-binding protein to the common antigen by at least about 40-45%, about 45-50%, about 50-55%, about 55-60%, about 60-65%, about 65-70%, about 70-75%, or about 75% or more. In some cases, binding is inhibited by at least about 80-85%, about 85-90%, about 90-95%, about 95-97%, or about 97% or more.

[0129] In this application, the term "sequence identity" generally refers to the identical nucleic acid or amino acid sequences between two or more aligned sequences when aligned using a sequence alignment program. The term "% sequence identity" generally refers to the level of nucleic acid or amino acid sequence identity between two or more aligned sequences when aligned using a sequence alignment program. Methods for evaluating the degree of sequence identity between amino acids or nucleotides are known to those skilled in the art. For example, amino acid sequence identity is typically measured using sequence analysis software. For example, the BLAST program from the NCBI database can be used to determine identity. For determining sequence identity, see, for example: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, 20 von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York, 1991.

[0130] In this application, amino acid residues will be represented according to standard three-letter or one-letter amino acid codes as known and agreed upon in the art. When comparing two amino acid sequences, the term "amino acid difference" generally refers to the insertion, deletion, or substitution of a specified number of amino acid residues at a position in a reference sequence compared to another sequence. In some embodiments, the substitution is a conserved amino acid substitution, which means that an amino acid residue is replaced by another amino acid residue with a similar chemical structure, and has little or no effect on the function, activity, or other biological properties of the polypeptide. The conserved amino acid substitutions are well known in the art, for example, a conserved amino acid substitution is the substitution of one amino acid in the following groups (i)-(v) by another amino acid residue in the same group: (i) smaller aliphatic nonpolar or weakly polar residues: Ala, Ser, Thr, Pro and Gly; (ii) polar negatively charged residues and their (uncharged) amides: Asp, Asn, Glu and Gln; (iii) polar positively charged residues: His, Arg and Lys; (iv) larger aliphatic nonpolar residues: Met, Leu, Ile, Val and Cys; and (v) aromatic residues: Phe, Tyr and Trp. Particularly preferred conserved amino acid substitutions are as follows: Ala is substituted with Gly or Ser; Arg is substituted with Lys; Asn is substituted with Gln or His; Asp is substituted with Glu; Cys is substituted with Ser; Gln is substituted with Asn; Glu is substituted with Asp; Gly is substituted with Ala or Pro; His is substituted with Asn or Gln; Ile is substituted with Leu or Val; Leu is substituted with Ile or Val; Lys is substituted with Arg, Gln, or Glu; Met is substituted with Leu, Tyr, or Ile; Phe is substituted with Met, Leu, or Tyr; Ser is substituted with Thr; Thr is substituted with Ser; Trp is substituted with Tyr; Tyr is substituted with Trp or Phe; Val is substituted with Ile or Leu. In some embodiments, the substitutions are non-conservative amino acid substitutions, for example, Ala is substituted with Asp, Asn, Glu, or Gin.

[0131] In this application, the term "affinity" generally refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., a peptide or antibody) and its binding partner (e.g., a target or antigen). The affinity of molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by commonly used methods known in the art, such as surface plasmon resonance, and also includes those methods reported in this application. Higher affinity of molecule X for its binding partner Y is seen in lower Kd values ​​and / or EC values. 50 value.

[0132] In this application, the term "isolated" generally refers to a molecule (e.g., antibody, nucleic acid, etc.) that is at least partially isolated from other molecules that are normally bound to it in their natural state. "Isolated polypeptides" are essentially free of other biomolecules such as nucleic acids, proteins, lipids, carbohydrates, cell debris, and growth media. "Isolated nucleic acids" are generally present in a form or context different from their natural occurrence.

[0133] In this application, the term "construct" generally refers to a DNA or RNA molecule containing a nucleotide sequence encoding a protein. The coding sequence, or "coding nucleic acid sequence," may include start and stop signals operatively linked to regulatory elements, including promoters and polyadenylation signals capable of directing expression in the cells of an individual to which the nucleic acid molecule has been administered. Examples include, but are not limited to, circular, linear, double-stranded, extrachromosomal DNA molecules (plasmids), plasmids (plasmids containing a COS sequence from λ phage), viral genomes containing non-natural nucleic acid sequences, etc.

[0134] In this application, the term "immunoconjugate" generally refers to a conjugate formed by linking an antibody or an antibody fragment thereof to other active agents, such as chemotherapeutic agents, toxins, immunotherapeutic agents, radioactive elements, imaging probes, spectroscopic probes, etc. The link can be a covalent bond or a non-covalent interaction, for example, via electrostatic forces. A variety of linkers known in the art can be used to form immunoconjugates. The conjugate can deliver the other agents to target cells (e.g., tumor cells) through the specific binding of the antibody or its antigen-binding fragment to an antigen on target cells. Furthermore, the immunoconjugate can be provided in the form of a fusion protein, which can be expressed from a polynucleotide encoding the immunoconjugate.

[0135] In this application, the term "chelating agent" generally refers to an organic molecule capable of forming a complex with a metal ion. Chelating agents are commonly used to label proteins or peptides. The final product of the metal ion conjugate is used in radioimmunoassay, radioimmunotherapy, magnetic resonance imaging, photodynamic therapy, or other similar modalities. Non-limiting examples of chelating or complexing agents include DTPA (diethylenetriaminepentaacetic anhydride) and its derivatives, NOTA (1,4,7-triazacyclononane-N,N',N”-triacetic acid) and its derivatives such as NODA-GA (NODAGA), Maleimide-NODAGA, DOTA (1,4,7,10-tetraazacyclododecane-N,N',N”,N”'-tetraacetic acid) (which binds radioactive metal ions) and its derivatives, TETA (1,4,8,11-tetraazacyclotetradecane-N,N',N”,N”'-tetraacetic acid) and its derivatives, and DTTA (N-(p-benzyl isothiocyanate)-diethylenetriamine-N,N',N”,N”'-tetraacetic acid). These and other chelating agents are readily available from commercial sources.

[0136] In this application, the term "pharmaceutically acceptable carrier" generally refers to one or more nontoxic materials that do not interfere with the effectiveness of the bioactivity of the active ingredient. Such formulations may conventionally contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations may also contain compatible solid or liquid fillers, diluents, or encapsulating substances suitable for human administration. Other contemplated carriers, excipients, and / or additives that may be used in the formulations described herein include, for example, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, lipids, protein excipients (such as serum albumin, gelatin, casein), salt-forming ions (such as sodium), etc. Suitable drug carriers, excipients, and / or additives for use in the formulations described herein are known in the art, for example, as listed in Remington: The Science & Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins (2005) and Physician's Desk Reference, 60th edition, Medical Economics, Montvale, New Jersey (2005). Pharmaceutically acceptable carriers suitable for the desired or required manner of administration, solubility, and / or stability can be routinely selected.

[0137] In this application, the term "administer" and similar terms are generally not limited to bodily administration, and suitable methods include in vitro, in vitro-then-in vivo, or in vivo methods. For example, any administration method known to those skilled in the art for contacting cells, organs, or tissues with the composition may be employed. For example, the compound may be introduced into the body of a subject requiring treatment via any route of introduction or delivery. In some embodiments, the compositions of this application may be administered orally, topically, intranasally, intramuscularly, subcutaneously, intradermally, intrathecally, intraperitoneally, or percutaneously.

[0138] In this application, the terms “ex vivo” and “in vitro” are used interchangeably and generally refer to activities performed in a controlled environment on cells, tissues and / or organs that have been removed from a subject.

[0139] In this application, the term "diagnosis" generally refers to the detection of a disease or condition, or the determination of the state or extent of a disease or condition. The term "diagnosis" may also include detecting the causes of a disease or condition, determining the therapeutic effect of drug treatment, or predicting the response pattern to drug treatment.

[0140] In this application, the term “treatment” generally means: (i) preventing a patient who may be susceptible to a disease, condition and / or symptom but has not yet been diagnosed with the disease, from developing such a disease, condition or symptom; (ii) suppressing such a disease, condition or symptom, i.e., curbing its development; and (iii) alleviating such a disease, condition or symptom, i.e., achieving the relief of such a disease, condition and / or symptom and / or symptoms associated with such a disease, condition and / or symptom.

[0141] In this application, the terms "tumor" and "cancer" are used interchangeably and generally refer to the growth of neoplastic or malignant cells. The tumor in this application may be benign or malignant. The tumor in this application may be solid or non-solid.

[0142] In this application, the term "subject" generally refers to a human or non-human animal, including but not limited to cats, dogs, horses, pigs, cows, sheep, rabbits, mice, rats, or monkeys.

[0143] In this application, the term "comprising" generally means including, encompassing, containing, or including. In some cases, it also means "to be" or "composed of".

[0144] In this application, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of about 0.5%, about 1%, about 1.5%, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, or about 10% above or below a specified value.

[0145] In this application, the term "comprising" and its variations, including "containing," "including," and other forms, generally refers to including other components, elements, values, steps, etc.

[0146] In this specification and claims, unless the context clearly indicates otherwise, the singular forms “a / an” and “the” include the plural references. The terms “a / an” (or “an”), “one or more”, and “at least one” may be used interchangeably herein. For example, a cell may refer to a single cell or a group of cells. Invention Details

[0148] HER2 - binding polypeptide

[0149] On one hand, this application provides a HER2-binding polypeptide that competitively binds to the HER2 protein with a reference antibody, wherein the reference antibody comprises a heavy chain variable region (VH); wherein the VH comprises the amino acid sequence shown in SEQ ID NO:10.

[0150] In some embodiments, in an ELISA assay, the HER2-binding peptide is capable of reacting at K values ​​not exceeding approximately 1.20E-09, approximately 1.10E-09, approximately 1.0E-09, approximately 9.0E-10, approximately 8.0E-10, approximately 7.0E-10, approximately 6.0E-10, approximately 5.0E-10, approximately 4.0E-10, approximately 3.0E-10, approximately 2.0E-10, approximately 1.0E-10, and approximately 9.0E-11. D The value binds to the HER2 protein.

[0151] In some embodiments, the HER2-binding polypeptide comprises an antibody or an antigen-binding fragment thereof.

[0152] In some embodiments, the antibody includes monoclonal antibodies, multispecific antibodies, chimeric antibodies, humanized antibodies, and / or fully human antibodies.

[0153] In some embodiments, the antigen-binding fragment includes Fab, Fab', Fv fragment, F(ab')2, scFv, VHH, and / or dAb. For example, the antibody or its antigen-binding fragment may be VHH.

[0154] In some embodiments, the VHH is not limited to a specific biological source or a specific preparation method. For example, the VHH can generally be obtained by: (1) isolating the VHH domain of a naturally occurring heavy chain antibody; (2) expressing a nucleotide sequence encoding a naturally occurring VHH domain; (3) by “humanizing” a naturally occurring VHH domain or by expressing a nucleic acid encoding such a humanized VHH domain; (4) by “camelizing” a naturally occurring VH domain from any animal species, such as from mammalian species, such as humans, or by expressing a nucleic acid encoding such a camelized VH domain; (5) by “camelizing” a “domain antibody” or “Dab” as described in the art, or by expressing a nucleic acid encoding such a camelized VH domain; (6) by preparing a protein, polypeptide, or other amino acid sequence known in the art using synthetic or semi-synthetic techniques; (7) by preparing a nucleic acid encoding a VHH using nucleic acid synthesis techniques known in the art, followed by expression of the obtained nucleic acid; and / or (8) by any combination of one or more of the above.

[0155] In some embodiments, the VHH is camelidoid, chimeric, human, partially humanized, or fully humanized.

[0156] In some embodiments, the HER2-binding peptide may comprise a "humanized" VHH, i.e., a VHH obtained by replacing one or more amino acid residues in the amino acid sequence (and specifically the framework sequence) of a naturally occurring VHH sequence with one or more amino acid residues present at the corresponding position in the VH domain of a conventional human 4-chain antibody. This can be done using humanization techniques known in the art. In some embodiments, possible humanization substitutions or combinations of humanization substitutions can be determined by methods known in the art, for example, by comparing the sequence of the VHH with the sequence of a naturally occurring human VH domain. In some embodiments, the humanization substitutions are selected such that the resulting humanized VHH retains advantageous functional properties. Generally, as a result of humanization, the VHH of this application can become more "human-like" compared to the corresponding naturally occurring VHH domain while retaining advantageous properties, such as reduced immunogenicity. The humanized VHH of this application can be obtained by any suitable method known in the art and is therefore not strictly limited to peptides already obtained using peptides containing naturally occurring VHH domains as starting materials.

[0157] In some embodiments, it comprises at least one CDR of the amino acid sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:12.

[0158] In some embodiments, it comprises HCDR1, HCDR2 and HCDR3 of any of the amino acid sequences shown in SEQ ID NO:1 to SEQ ID NO:12.

[0159] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in any one of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:21.

[0160] In some embodiments, the HCDR1 comprises the amino acid sequences shown in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24.

[0161] In some embodiments, the HCDR2 comprises the amino acid sequence shown in any one of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:34.

[0162] In some embodiments, the HCDR2 comprises the amino acid sequence shown in any one of SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37.

[0163] In some embodiments, the HCDR3 comprises the amino acid sequence shown in any one of SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46.

[0164] In some embodiments, the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:47 or SEQ ID NO:48.

[0165] In some embodiments, it comprises VH, wherein VH comprises: HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO:13, HCDR2 comprises the amino acid sequence shown in SEQ ID NO:25, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO:38; or

[0166] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:14, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:26, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:39; or

[0167] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:15, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:27, and the HCDR3 contains the amino acid sequence shown in any one of SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, and SEQ ID NO:45; or

[0168] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:21, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:34, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:46.

[0169] In some embodiments, it comprises VH, wherein VH comprises: HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO:16, HCDR2 comprises the amino acid sequence shown in SEQ ID NO:28, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO:40; or

[0170] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:17, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:29, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:41; or

[0171] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:18, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:30, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:42; or

[0172] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:19, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:31, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:43; or

[0173] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:16, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:32, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:44; or

[0174] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:20, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:33, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:45; or

[0175] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:22, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:35, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:47; or

[0176] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:23, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:36, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:48; or

[0177] The HCDR1 contains the amino acid sequence shown in SEQ ID NO:24, the HCDR2 contains the amino acid sequence shown in SEQ ID NO:37, and the HCDR3 contains the amino acid sequence shown in SEQ ID NO:47.

[0178] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises the amino acid sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:12.

[0179] In some embodiments, the amino acid sequence of the variable domain may have one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences shown in any one of SEQ ID NO:1 to SEQ ID NO:12; the substitutions, deletions, or additions do not substantially reduce the ability of the HER2-binding polypeptide of this application to specifically bind to HER2.

[0180] In some embodiments, the amino acid mutation may be in the CDR (e.g., CDR1, CDR2, or CDR3) of the target region. In another embodiment, the amino acid change may be in the framework region (FR) of the target region (e.g., FR1, FR2, FR3, or FR4).

[0181] In some embodiments, the HER2-binding polypeptide contains at least one VH domain. For example, the HER2-binding polypeptide may contain one, two, or three variable domains.

[0182] In some embodiments, the HER2-binding polypeptide comprises a nanobody containing an amino acid sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:12.

[0183] Variant

[0184] The HER2-binding polypeptide of this application also includes variants of the polypeptide containing the aforementioned CDR region, having the same function as the HER2-binding polypeptide of this application. These variants include (but are not limited to): deletions, insertions, and / or substitutions of one or more (typically 1-50, 1-30, 1-20, or 1-10) amino acids, and the addition of one or more (typically up to 20, 10, or 5) amino acids at the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids of similar or comparable properties generally does not alter the function of the protein. Similarly, adding one or more amino acids at the C-terminus and / or N-terminus generally does not alter the function of the protein. This term also includes active fragments and active derivatives of the antibodies of this invention.

[0185] The variant forms of the polypeptide include: homologous sequences, conserved variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low severity conditions, and polypeptides or proteins obtained using antiserum against the antibody of the present invention.

[0186] This application also provides other peptides, such as fusion proteins comprising nanobodies or fragments thereof. In addition to nearly full-length peptides, the present invention also includes fragments of the nanobodies of the present invention. Typically, the fragment has at least about 50 consecutive amino acids, more preferably at least about 50 consecutive amino acids, more preferably at least about 80 consecutive amino acids, and most preferably at least about 100 consecutive amino acids of the HER2-binding peptide of this application.

[0187] In this application, "conservative variant" generally refers to a polypeptide formed by replacing up to 10, up to 8, up to 5, or up to 3 amino acids with similar or related properties compared to the amino acid sequence of the HER2-binding polypeptide of this application.

[0188] In some embodiments, the substitution is a conserved amino acid substitution, which refers to the replacement of an amino acid residue with another amino acid residue of similar chemical structure, and has little or no effect on the function, activity, or other biological properties of the polypeptide. Such conserved amino acid substitutions are well known in the art, for example, a conserved amino acid substitution is the replacement of one amino acid within the following groups (i)-(v) by another amino acid residue within the same group: (i) smaller aliphatic nonpolar or weakly polar residues: Ala, Ser, Thr, Pro, and Gly; (ii) polar negatively charged residues and their (uncharged) amides: Asp, Asn, Glu, and Gln; (iii) polar positively charged residues: His, Arg, and Lys; (iv) larger aliphatic nonpolar residues: Met, Leu, Ile, Val, and Cys; and (v) aromatic residues: Phe, Tyr, and Trp. Particularly preferred conserved amino acid substitutions are as follows: Ala is substituted with Gly or Ser; Arg is substituted with Lys; Asn is substituted with Gln or His; Asp is substituted with Glu; Cys is substituted with Ser; Gln is substituted with Asn; Glu is substituted with Asp; Gly is substituted with Ala or Pro; His is substituted with Asn or Gln; Ile is substituted with Leu or Val; Leu is substituted with Ile or Val; Lys is substituted with Arg, Gln, or Glu; Met is substituted with Leu, Tyr, or Ile; Phe is substituted with Met, Leu, or Tyr; Ser is substituted with Thr; Thr is substituted with Ser; Trp is substituted with Tyr; Tyr is substituted with Trp or Phe; Val is substituted with Ile or Leu. In some embodiments, the substitutions are non-conservative amino acid substitutions, for example, Ala is substituted with Asp, Asn, Glu, or Gin.

[0189] On the one hand, this application provides a HER2-binding polypeptide, which may contain at least one VH, wherein the amino acid sequence of the VH may have one or more amino acid substitutions, deletions or additions compared with the amino acid sequence shown in SEQ ID NO:1.

[0190] In some embodiments, the HER2-binding polypeptide may contain one, two, or three VHs.

[0191] In some embodiments, the VH may comprise an amino acid sequence having one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty amino acid substitutions, deletions, or additions relative to SEQ ID NO:1.

[0192] In some embodiments, the amino acid sequence of the VH may have one or more amino acid substitutions compared to the amino acid sequence shown in SEQ ID NO:1, and may include conserved and / or non-conserved substitutions.

[0193] In some embodiments, the amino acid mutation may be in the CDR (e.g., CDR1, CDR2, or CDR3) of the target region. In another embodiment, the amino acid change may be in the framework region (FR) of the target region (e.g., FR1, FR2, FR3, or FR4).

[0194] The modification of amino acid sequences can be achieved using any technique known in the art, such as site-directed mutagenesis or PCR-based mutagenesis. Such techniques are described, for example, in the following literature: Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, 1989; and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1989.

[0195] In some embodiments, the substitution, deletion or addition does not substantially reduce the ability of the HER2-binding peptide of this application to specifically bind to HER2.

[0196] The equilibrium dissociation constant (KD) can be used to describe the binding affinity of the HER2 binding peptide of this application to the full-length and / or mature form and / or isotype and / or splice variant and / or fragment and / or any other naturally occurring or synthetic analogs, variants or mutants (including monomers, dimers, heterodimers, polymers and / or related forms) of human HER2. The HER2-binding peptide may include a targeting moiety that binds to the full-length and / or mature form and / or isotype and / or splice variant and / or fragment and / or any other naturally occurring or synthetic analog, variant, or mutant (including monomers, dimers, heterodimers, polymers, and / or related forms) of human HER2, wherein the KD is less than about 1 μM, about 900 nM, about 800 nM, about 700 nM, about 600 nM, about 500 nM, about 400 nM, about 300 nM, about 200 nM, about 100 nM, about 90 nM, about 80 nM, about 70 nM, about 60 nM, about 50 nM, about 40 nM, about 30 nM, about 20 nM, about 10 nM, or about 5 nM, or about 1 nM.

[0197] In some embodiments, the HER2-binding polypeptide has one or more of the following properties:

[0198] (i) It can bind to the packing material of A3 affinity chromatography columns;

[0199] (ii) It can bind to HER2 with the same or higher affinity compared to the reference antibody with the amino acid sequence shown in SEQ ID NO:1;

[0200] (iii) It exhibits increased expression levels compared to the reference antibody with the amino acid sequence shown in SEQ ID NO:1; and

[0201] (iv) Its isoelectric point is increased compared to the reference antibody with the amino acid sequence shown in SEQ ID NO:1.

[0202] In some embodiments, the expression of the HER2-binding polypeptide of this application, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, may be about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher.

[0203] In some embodiments, the reference antibody (designated H1) with an amino acid sequence as shown in SEQ ID NO:1 has an isoelectric point (PI) of 5.3, and the HER2-binding peptide has a PI of not less than 5.3. For example, the PI of the HER2-binding peptide may be about 5.5, about 6.0, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, or about 7.

[0204] In some embodiments, the HER2-binding polypeptide comprises an antibody or an antigen-binding fragment thereof.

[0205] In some embodiments, the antibody may include monoclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), chimeric antibodies, humanized antibodies, and / or fully human antibodies.

[0206] In some embodiments, the antigen-binding fragment may include Fab, Fab', Fv fragment, F(ab')2, scFv, di-scFv, VHH, and / or dAb. For example, the antibody or its antigen-binding fragment may be VHH.

[0207] In some embodiments, the VHH is not limited to a specific biological source or a specific preparation method. For example, the VHH can generally be obtained by: (1) isolating the VHH domain of a naturally occurring heavy chain antibody; (2) expressing a nucleotide sequence encoding a naturally occurring VHH domain; (3) by “humanizing” a naturally occurring VHH domain or by expressing a nucleic acid encoding such a humanized VHH domain; (4) by “camelizing” a naturally occurring VH domain from any animal species, such as from mammalian species, such as humans, or by expressing a nucleic acid encoding such a camelized VH domain; (5) by “camelizing” a “domain antibody” or “Dab” as described in the art, or by expressing a nucleic acid encoding such a camelized VH domain; (6) by preparing a protein, polypeptide, or other amino acid sequence known in the art using synthetic or semi-synthetic techniques; (7) by preparing a nucleic acid encoding a VHH using nucleic acid synthesis techniques known in the art, followed by expression of the obtained nucleic acid; and / or (8) by any combination of one or more of the above.

[0208] In some embodiments, the HER2-binding peptide may comprise a “camelized” VHH, i.e., a VHH formed by replacing one or more amino acid residues in the amino acid sequence of a naturally occurring VH domain from a conventional 4-chain antibody with one or more amino acid residues present at the corresponding position in the VHH domain of a camel heavy chain antibody. In some embodiments, such “camelization” substitutions are inserted at amino acid positions forming and / or present at the VH-VL interface and / or at so-called cameloid marker residues (see, for example, WO9404678, the entire contents of which are incorporated herein by reference). In some embodiments, the VH sequence used as a starting material or starting point for generating or designing the camelized VHH is a VH sequence from mammals, such as a human VH sequence, like the VH3 sequence. The camelized VHH may be obtained in any suitable manner known in the art (i.e., as indicated in points (1) through (8) above) and is therefore not strictly limited to peptides already obtained using peptides containing a naturally occurring VH domain as a starting material.

[0209] In some embodiments, the VHH may be camelidoid, chimeric, human, partially humanized, or fully humanized.

[0210] In some embodiments, the HER2-binding peptide may comprise a "humanized" VHH, i.e., a VHH obtained by replacing one or more amino acid residues in the amino acid sequence (and specifically the framework sequence) of a naturally occurring VHH sequence with one or more amino acid residues present at the corresponding position in the VH domain of a conventional human 4-chain antibody. This can be done using humanization techniques known in the art. In some embodiments, possible humanization substitutions or combinations of humanization substitutions can be determined by methods known in the art, for example, by comparing the sequence of the VHH with the sequence of a naturally occurring human VH domain. In some embodiments, the humanization substitutions are selected such that the resulting humanized VHH retains advantageous functional properties. Generally, as a result of humanization, the VHH of this application can become more "human-like" compared to the corresponding naturally occurring VHH domain while retaining advantageous properties, such as reduced immunogenicity. The humanized VHH of this application can be obtained by any suitable method known in the art and is therefore not strictly limited to peptides already obtained using peptides containing naturally occurring VHH domains as starting materials.

[0211] In some embodiments, the VH may comprise CDR1, CDR2, and CDR3 of the amino acid sequence shown in SEQ ID NO:1. The CDR may be Kabat CDR, AbM CDR, Chothia CDR, or Contact CDR. In some embodiments, the CDR is a Chothia CDR.

[0212] On one hand, this application provides a HER2-binding polypeptide comprising VH, wherein, when compared with an antibody comprising VH containing the amino acid sequence shown in SEQ ID NO:1, the HER2-binding polypeptide comprises amino acid substitutions at one or more of the following positions in VH: L2, I28, V31, A41, E43, Q44, R45, A57, D61, V67, D73, A74, S76, V78, N84, D98, W101, D103, D104, F106, E107, and Q117.

[0213] In some embodiments, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide comprises one or more amino acid substitutions selected from the group consisting of:

[0214] (a) L2V, A41P, E43K, Q44G, R45L, A57T, V67F, D73N, A74S, S76N, V78L, N84S and / or Q117L;

[0215] (b) D61A, D103A, D104A, D98A and / or E107S;

[0216] (c) I28T, V31G, A57T, N84S, W101G, W101S and / or F106Y; and

[0217] (d)Y37V, A41P, R45L, A57T, D73N, A74S, N84S, K86R and / or P87A.

[0218] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO:159, HCDR2 comprises the amino acid sequence shown in SEQ ID NO:160, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO:161.

[0219] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH comprises HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises the amino acid sequence shown in any one of SEQ ID NO:13, SEQ ID NO:86, and SEQ ID NO:87, wherein HCDR2 comprises the amino acid sequence shown in any one of SEQ ID NO:25, SEQ ID NO:88, and SEQ ID NO:89, and wherein HCDR3 comprises the amino acid sequence shown in any one of SEQ ID NO:38, SEQ ID NO:90-SEQ ID NO:96.

[0220] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:38.

[0221] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:86, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:38.

[0222] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:87, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:38.

[0223] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:88 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:38.

[0224] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:89 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:38.

[0225] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:90.

[0226] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, wherein HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and wherein HCDR3 may contain the amino acid sequence shown in SEQ ID NO:91.

[0227] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:92.

[0228] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:25 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:93.

[0229] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:88 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:94.

[0230] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:88 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:95.

[0231] For example, the HER2-binding polypeptide contains VH, wherein the VH contains HCDR1, HCDR2 and HCDR3, wherein HCDR1 may contain the amino acid sequence shown in SEQ ID NO:13, HCDR2 may contain the amino acid sequence shown in SEQ ID NO:88 and HCDR3 may contain the amino acid sequence shown in SEQ ID NO:96.

[0232] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3, and HFR4, wherein HFR1 comprises the amino acid sequence shown in SEQ ID NO:162, HFR2 comprises the amino acid sequence shown in SEQ ID NO:163, HFR3 comprises the amino acid sequence shown in SEQ ID NO:164, and HFR4 comprises the amino acid sequence shown in SEQ ID NO:165.

[0233] In some embodiments, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3, and HFR4, wherein HFR1 comprises the amino acid sequence shown in SEQ ID NO:49 or SEQ ID NO:51, wherein HFR2 comprises the amino acid sequence shown in any one of SEQ ID NO:55, SEQ ID NO:97-SEQ ID NO:106, wherein HFR3 comprises the amino acid sequence shown in any one of SEQ ID NO:60, SEQ ID NO:107-SEQ ID NO:116, and wherein HFR4 comprises the amino acid sequence shown in SEQ ID NO:70 or SEQ ID NO:117.

[0234] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in any one of SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in any one of SEQ ID NO:60, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0235] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:97, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:60, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0236] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:98, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:60, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0237] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:99, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:60, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0238] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:100, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:60, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0239] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:107, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0240] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:108, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0241] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:109, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0242] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:110, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0243] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:111, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0244] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:112, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0245] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:51, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:55, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:60, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:117.

[0246] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:51, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:101, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:113, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:117.

[0247] For example, the HER2-binding polypeptide comprises VH, wherein the VH further comprises HFR1, HFR2, HFR3 and HFR4, wherein HFR1 may comprise the amino acid sequence shown in SEQ ID NO:49, HFR2 may comprise the amino acid sequence shown in SEQ ID NO:101, HFR3 may comprise the amino acid sequence shown in SEQ ID NO:113, and HFR4 may comprise the amino acid sequence shown in SEQ ID NO:70.

[0248] In some embodiments, the HER2-binding peptide, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:1, has a VH portion comprising one or more amino acid substitutions selected from the group consisting of: L2V, A41P, E43K, Q44G, R45L, A57T, V67F, D73N, A74S, S76N, V78L, N84S, and Q117L.

[0249] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: A41P, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:122. The HER2-binding polypeptide is named H1-A41P.

[0250] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: E43K, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:125. The HER2-binding polypeptide is named H1-E43K.

[0251] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: Q44G, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:123. The HER2-binding peptide is named H1-Q44G.

[0252] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: R45L, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:124. The HER2-binding peptide is named H1-R45L.

[0253] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: A57T, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:126. The HER2-binding polypeptide is named H1-A57T.

[0254] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: V67F, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:127. The HER2-binding polypeptide is named H1-V67F.

[0255] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2 binding peptide may contain amino acid substitutions selected from the following: D73N, and the VH of the HER2 binding peptide may contain the amino acid sequence shown in SEQ ID NO:118. The HER2 binding peptide is named H1-D73N.

[0256] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: A74S. The VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:119, and the HER2-binding polypeptide is named H1-A74S.

[0257] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: S76N, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:120. The HER2-binding polypeptide is named H1-S76N.

[0258] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: V78L, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:128. The HER2-binding polypeptide is named H1-V78L.

[0259] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: N84S, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:129. The HER2-binding polypeptide is named H1-N84S.

[0260] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: L2V and Q117L, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:121. The HER2-binding peptide is named H1-VL.

[0261] In some embodiments, the HER2-binding polypeptide, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:1, has a VH comprising one or more amino acid substitutions selected from the group consisting of D61A, D103A, D104A, D98A, and E107S.

[0262] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: D61A, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:140. The HER2-binding polypeptide is named H1-D61A.

[0263] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: D103A, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:141. The HER2-binding polypeptide is named H1-D103A.

[0264] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: D104A, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:142. The HER2-binding polypeptide is named H1-D104A.

[0265] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: D98A, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:143. The HER2-binding polypeptide is named H1-D98A.

[0266] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding polypeptide may contain amino acid substitutions selected from the following: E107S, and the VH of the HER2-binding polypeptide may contain the amino acid sequence shown in SEQ ID NO:144. The HER2-binding polypeptide is named H1-E107S.

[0267] In some embodiments, the HER2-binding polypeptide, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:1, has a VH that comprises one or more amino acid substitutions selected from the group consisting of: I28T, V31G, A57T, N84S, W101G, W101S, and F106Y.

[0268] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: A57T and N84S, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:145. The HER2-binding peptide is named H1-AN-TS.

[0269] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: V31G, A57T and N84S, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:146. The HER2-binding peptide is named H1-VG.

[0270] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: I28T, A57T and N84S, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:147. The HER2-binding peptide is named H1-IT.

[0271] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: A57T, N84S and W101G, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:148. The HER2-binding peptide is named H1-WG.

[0272] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: A57T, N84S and W101S, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:149. The HER2-binding peptide is named H1-WS.

[0273] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain amino acid substitutions selected from the following: A57T, N84S and F106Y, and the VH of the HER2-binding peptide may contain the amino acid sequence shown in SEQ ID NO:150. The HER2-binding peptide is named H1-FY.

[0274] In some embodiments, the HER2-binding peptide, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:130, has a VH that comprises one or more amino acid substitutions selected from the group consisting of: P41A, K43E, G44Q, L45R, T57A, F67V, L78V, S84N, V2L, and L117Q.

[0275] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding polypeptide may contain the following amino acid substitution: P41A, the HER2-binding polypeptide contains the amino acid sequence shown in SEQ ID NO:131, and the HER2-binding polypeptide is named FH1-P41A.

[0276] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding polypeptide may contain the following amino acid substitution: K43E, the HER2-binding polypeptide contains the amino acid sequence shown in SEQ ID NO:132, and the HER2-binding polypeptide is named FH1-K43E.

[0277] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding peptide may contain the following amino acid substitution: G44Q, the HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:133, and the HER2-binding peptide is named FH1-G44Q.

[0278] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding peptide may contain the following amino acid substitution: L45R, the HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:134, and the HER2-binding peptide is named FH1-L45R.

[0279] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2 binding peptide may contain the following amino acid substitution: T57A, the HER2 binding peptide contains the amino acid sequence shown in SEQ ID NO:131, and the HER2 binding peptide is named FH1-T57A.

[0280] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding polypeptide may contain the following amino acid substitution: F67V, the HER2-binding polypeptide contains the amino acid sequence shown in SEQ ID NO:136, and the HER2-binding polypeptide is named FH1-F67V.

[0281] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding polypeptide may contain the following amino acid substitution: L78V, the HER2-binding polypeptide contains the amino acid sequence shown in SEQ ID NO:137, and the HER2-binding polypeptide is named FH1-L78V.

[0282] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2 binding peptide may contain the following amino acid substitution: S84N, the HER2 binding peptide contains the amino acid sequence shown in SEQ ID NO:138, and the HER2 binding peptide is named FH1-S84N.

[0283] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:130, the VH of the HER2-binding polypeptide may contain the following amino acid substitutions: V2L and L117Q. The HER2-binding polypeptide contains the amino acid sequence shown in SEQ ID NO:139. The HER2-binding polypeptide is named FH1-V2L-L117Q.

[0284] In some embodiments, the HER2-binding polypeptide, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:145, comprises one or more amino acid substitutions selected from the group consisting of: A41P, E43K, Q44G, R45L, R66V, D73N, A74S, S76N, K86R, and P87A.

[0285] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:145, the VH of the HER2-binding peptide contains the following amino acid substitutions: A41P, Q44G, R45L, R66V, D73N, A74S, and S76N, the HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:151, and the HER2-binding peptide is named FH1-H.

[0286] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:145, the VH of the HER2-binding peptide contains the following amino acid substitutions: A41P, E43K, Q44G, R45L, R66V, D73N, A74S, and S76N. The HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:152. The HER2-binding peptide is named FH1-3KE.

[0287] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:145, the VH of the HER2-binding peptide contains the following amino acid substitutions: A41P, D73N, A74S, S76N, K86R, and P87A. The HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:153. The HER2-binding peptide is named hH1-AN-TS.

[0288] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:145, the HER2-binding peptide has the following amino acid substitutions in its VH: A41P, K86R and P87A, the HER2-binding peptide has the amino acid sequence shown in SEQ ID NO:154, and the HER2-binding peptide is named hH1-DA.

[0289] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:145, the HER2-binding peptide has the following amino acid substitutions in its VH: A41P, E43K and Q44G, the HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:155, and the HER2-binding peptide is named hH1-KP.

[0290] In some embodiments, the HER2-binding polypeptide, compared to a reference antibody with an amino acid sequence as shown in SEQ ID NO:1, comprises one or more amino acid substitutions selected from the group consisting of: Y37V, A41P, R45L, A57T, D73N, A74S, N84S, K86R, and / or P87A.

[0291] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain the following amino acid substitutions: Y37V, A41P, R45L, D73N, A74S, K86R, and P87A. The HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:156, and the HER2-binding peptide is named FH1-N.

[0292] For example, compared with the reference antibody whose amino acid sequence is shown in SEQ ID NO:1, the VH of the HER2-binding peptide may contain the following amino acid substitutions: R45L, A57T, and N84S. The HER2-binding peptide contains the amino acid sequence shown in SEQ ID NO:157, and the HER2-binding peptide is named H1-RL-VH.

[0293] Nucleic acids, constructs and cells

[0294] On the other hand, this application provides one or more isolated nucleic acid molecules that encode the HER2-binding polypeptide described in this application.

[0295] In some embodiments, the nucleic acid may encode an amino acid sequence containing the VHH of the antibody. In some embodiments, an isolated nucleic acid encoding the variable region of the heavy chain of an anti-HER2 antibody is provided, wherein the nucleic acid comprises a sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the nucleic acid sequence encoding any one of SEQ ID NO:74 to SEQ ID NO:84.

[0296] On the other hand, this application provides a construct comprising the nucleic acid molecule described in this application.

[0297] On the other hand, this application provides a cell that contains the nucleic acid molecules or constructs described in this application.

[0298] The nucleic acid encoding the HER2-binding polypeptide of this application can be incorporated (linked) into a construct, which can be introduced into a host cell via transfection, transformation, or transduction techniques. For example, the nucleic acid encoding the HER2-binding polypeptide of this application can be introduced into a host cell via retroviral transduction. In one embodiment, the host cell is eukaryotic, such as Chinese hamster ovary (CHO) cells or lymphoid cells (e.g., Y0, NSO, Sp20 cells). In one embodiment, the host cell is prokaryotic, such as Escherichia coli cells.

[0299] On the other hand, this application provides a method for preparing the HER2-binding polypeptide described in this application, comprising culturing the cells described in this application under conditions that allow the expression of the HER2-binding polypeptide.

[0300] Specific expression and purification conditions will vary depending on the expression system used. For example, if expressing a gene in *E. coli*, it is first cloned into an expression vector by placing the engineered gene downstream of a suitable bacterial promoter, such as Trp or Tac, and a prokaryotic signaling sequence. In another example, if an engineered gene is to be expressed in eukaryotic cells, such as CHO cells, it is first inserted into an expression vector containing, for example, a suitable eukaryotic promoter, secretion signal, enhancer, and various introns. The gene construct can be introduced into the host cell using transfection, transformation, or transduction techniques.

[0301] In some embodiments, the method further includes recovering the HER2-binding peptide expressed by the cells.

[0302] In some embodiments, the method further includes purifying and / or modifying the HER2-binding peptide.

[0303] The HER2-binding polypeptide of this application can also be expressed in vivo, for example, in a patient. For instance, in some embodiments, the HER2-binding polypeptide of this application can be administered in the form of a nucleic acid encoding the HER2-binding polypeptide of this application. The nucleic acid can be DNA or RNA. In some embodiments, the HER2-binding polypeptide of this application is encoded by modified mRNA, i.e., mRNA containing one or more modified nucleotides. In some embodiments, this application relates to a gene therapy vector containing said modified mRNA. In some embodiments, this application relates to a gene therapy method comprising said gene therapy vector. In some embodiments, the nucleic acid is in the form of an oncolytic virus, such as adenovirus, reovirus, measles, herpes simplex virus, Newcastle disease virus, or vaccinia virus.

[0304] Immunoconjugates

[0305] On the other hand, this application provides an immunoconjugate comprising the HER2-binding polypeptide described in this application.

[0306] In some embodiments, the immunoconjugate comprises:

[0307] i) The HER2-binding polypeptide described in this application;

[0308] ii) Conjugates selected from the following group: detectable markers, drugs, toxins, cytokines, viral capsid proteins or VLPs, or combinations thereof.

[0309] In some embodiments, the detectable marker is selected from one or more reagents from the group consisting of: radionuclides, fluorescent agents, chemiluminescent agents, bioluminescent agents, paramagnetic ions, and enzymes.

[0310] In some embodiments, the radionuclide is suitable for medical imaging and / or treatment.

[0311] Fluorescent agents that can be used for conjugation include, but are not limited to, isothiocyanate fluorescein, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, and fluorescein; chemiluminescent agents that can be used for conjugation include, but are not limited to, luminol, isoluminol, aromatic acridine esters, imidazole, acridine salts, and oxalates; bioluminescent agents that can be used for conjugation include, but are not limited to, fluorescein, luciferase, and jellyfish luminescent protein. Paramagnetic ions that can be used for conjugation include, but are not limited to, chromium(III), manganese(II), iron(III), cobalt(II), nickel(II), copper(II), neodymium(III), samarium(III), ytterbium(III), gadolinium(III), vanadium(II), terbium(III), dysprosium(III), holmium(III), and erbium(III), or radiation-impermeable materials such as dams, diatrizoates, ethyl iodinated oil, gallium citrate, iocarboxylic acid, iodotinic acid, iodamide, cholinesteric acid, iosaccharide, iogulum, iohexol, iopamidol, ioprosylate, iodixazoline, iosifaric acid, iodoserilic acid, iodolesulfonate meglumine, iophthalyl thiocyanate, iodotinic acid, iodotalamic acid, iodoxazoline, hydroxydiatrizoate, iopoise, meglumine, methyl diatrizoate, methyl diatrizoate salt, propiodosperidone, and thallium oxide. Enzymes that can be used for conjugation include, but are not limited to, horseradish peroxidase.

[0312] In some embodiments, the detectable marker may be a radionuclide. The radionuclide that can be used for conjugation may be a radionuclide with an energy between 20 and 4000 keV, including but not limited to those... 110 In、 111 In、 177 Lu、 18 F, 52 Fe、 62 Cu、 67 Cu、 67 Ga、 68 Ga、 68 Ge 86 Y、 90 Y、 89 Zr、 94m Tc, 120 I, 123 I, 124 I, 125 I, 131 I, 154-158 Gd, 32 P, 11 C 13 N、 15 O、 186 Re、 188 Re、 51 Mn, 52m Mn, 72 As、 75 Br、 76 Br、 82mRb、 83 Sr or other γ-, β-, or positron emitters.

[0313] For example, the radionuclide can be 99m Tc, 177 Lu or 125 I.

[0314] In some embodiments, the HER2-binding peptide is conjugated directly or indirectly to the detectable marker. Methods for conjugating a detectable marker to a peptide are well known to those skilled in the art. For example, the HER2-binding peptide can be conjugated to the detectable marker using a chelating agent.

[0315] In some embodiments, the chelating agent is selected from one or more of DTPA, EDTA, NOA, DOTA, TRAP, TETA, NETA, CB-TE2A, Cyclen, Cyclam, Bispidine, TACN, ATSM, SarAr, AmBaSar, MAG3, MAG2, HYNIC, DADT, EC, NS3, H2dedpa, HBED, DFO, PEPA, HEHA, and their derivatives.

[0316] On the other hand, this application provides a method for preparing the radionuclide of this application, such as... 177 A method for producing Lu-labeled immunoconjugates, comprising: 1) conjugating the HER2-binding polypeptide of this application with a chelating agent to generate a precursor of the HER2-binding polypeptide-chelating agent conjugate; and 2) conjugating the precursor of the conjugate from step 1) with a radionuclide such as... 177 Lu contact, thereby radioactive nuclides such as 177 Lu marks the HER2-binding peptide of this application through the chelating action of a chelating agent.

[0317] In some embodiments, the chelating agent is NOTA, and in step 1), the HER2-binding polypeptide is reacted with p-SCN-Bn-NOTA or p-NH2-Bn-NOTA to generate a precursor of the HER2-binding polypeptide and NOTA conjugate.

[0318] This application can also employ the IODO-BEADS solid-phase labeling method, using radioactive nuclides such as... 125 I label the HER2-binding polypeptide described in this application.

[0319] Compositions

[0320] On the other hand, this application provides a composition comprising the HER2-binding polypeptide described in this application, the nucleic acid molecule described in this application, the construct described in this application, the cell described in this application, and / or the immunoconjugate described in this application, and optionally a pharmaceutically acceptable carrier.

[0321] In some embodiments, the compositions described herein are in the form of pharmaceutically acceptable salts. The HER2-binding polypeptides described herein may have sufficiently basic functional groups capable of reacting with inorganic or organic acids, or carboxyl groups capable of reacting with inorganic or organic bases, to form pharmaceutically acceptable salts.

[0322] Any of the compositions described in this application may be administered to a subject as a component of a composition comprising a pharmaceutically acceptable carrier. Such compositions may optionally contain an appropriate amount of a pharmaceutically acceptable excipient to provide a form suitable for appropriate administration.

[0323] Pharmaceutical excipients can be liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. The pharmaceutical excipients can be, for example, physiological saline, gum arabic, gelatin, starch paste, talc, keratin, colloidal silica, urea, etc. Additionally, adjuvants, stabilizers, thickeners, lubricants, and colorants can be used. In one embodiment, the pharmaceutically acceptable excipient is sterile when administered to a subject. Water is a usable excipient when any of the agents described in this application is administered intravenously. Physiological saline solutions, glucose solutions, and glycerol solutions can also be used as liquid excipients, specifically for injectable solutions. Suitable pharmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerin, propylene, ethylene glycol, water, ethanol, etc. Other examples of suitable pharmaceutical excipients are described in Remington's Pharmaceutical Sciences 1447-1676 (edited by Alfonso R. Gennaro, 19th edition, 1995), which is incorporated herein by reference.

[0324] This application includes various formulations of the described compositions (and / or other therapeutic agents). Any of the inventive compositions (and / or other therapeutic agents) described in this application may be in the form of a solution, suspension, emulsion, drops, tablet, pill, bolus, capsule, liquid-containing capsule, gelatin capsule, powder, sustained-release formulation, suppository, emulsion, aerosol, spray, suspension, lyophilized powder, frozen suspension, dried powder, or any other combined form. In one embodiment, the composition is in capsule form. In another embodiment, the composition is in tablet form. In another embodiment, the composition is formulated as a soft gel capsule. In another embodiment, the composition is formulated as a gelatin capsule. In another embodiment, the composition is formulated as a liquid.

[0325] Any composition described in this application is formulated according to conventional procedures to suit the administration method described in this application.

[0326] Routes of administration include, for example: oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, sublingual, intranasal, intracerebral, intrathecal, percutaneous, rectal, inhalation, or local. Administration can be local or systemic. In some embodiments, administration is achieved orally. In another embodiment, administration is achieved via parenteral injection. The mode of administration is left to the physician's judgment and depends in part on the site of the medical condition.

[0327] In some embodiments, the composition comprises the HER2-binding polypeptide or the immunoconjugate described in this application, and the composition is a detection agent or a therapeutic agent.

[0328] In some embodiments, the detection agent is a reagent for detecting HER2 protein.

[0329] In some embodiments, the detection agent is a contrast agent.

[0330] In some embodiments, the contrast agent is a contrast agent for detecting HER2 protein. For example, the contrast agent may be an ECT contrast agent. As another example, the ECT contrast agent may include a SPECT contrast agent or a PET contrast agent.

[0331] In some embodiments, the therapeutic agent is used to treat tumors.

[0332] In some embodiments, the therapeutic agent is used to treat HER2-positive tumors.

[0333] Uses

[0334] On the other hand, this application provides the use of the HER2 binding peptide, nucleic acid molecule, construct, cell, immunoconjugate and / or composition described in this application in the preparation of pharmaceuticals, reagents, detection plates or kits;

[0335] The reagents, test plates, or kits mentioned above are used to detect HER2 protein in samples;

[0336] The agent is used to detect the expression of HER2 protein and / or to treat tumors expressing HER2.

[0337] On the other hand, this application provides a recombinant protein comprising the HER2-binding polypeptide described in this application.

[0338] In some embodiments, the recombinant protein comprises: (i) the HER2-binding polypeptide described in this application; and (ii) an optional tag sequence for expression and / or purification.

[0339] On the other hand, this application provides a method for detecting the presence and / or amount of HER2 in a biological sample, comprising: contacting the biological sample with the HER2-binding peptide, the immunoconjugate, or the composition described in this application.

[0340] In some embodiments, the contact is performed outside the body or outside the body.

[0341] In some embodiments, the biological sample is a tissue.

[0342] In some embodiments, the tissue is selected from blood tissue, lymphatic tissue, and tumor tissue.

[0343] In some embodiments, the method includes detecting the presence and / or amount of HER2-positive cells in a biological sample.

[0344] In some implementations, the presence and / or amount of HER2-positive cells in a biological sample are determined by imaging.

[0345] In some implementations, the presence and / or quantity of HER2-positive cells in a biological sample are determined by flow cytometry.

[0346] On the other hand, this application provides a method for detecting and / or diagnosing diseases or conditions associated with abnormal HER2 expression, including administering the HER2-binding peptide, the immunoconjugate, or the composition described in this application to a subject in need of such treatment.

[0347] In some embodiments, the method further includes imaging the subject.

[0348] In some embodiments, the imaging includes ECT imaging.

[0349] In some embodiments, the ECT imaging includes SPECT imaging or PET imaging.

[0350] In some implementations, the disease or condition associated with abnormal HER2 expression includes tumors.

[0351] On the other hand, this application provides a method for treating and / or preventing tumors, the method comprising administering to a subject in need the HER2-binding peptide, the immunoconjugate, or the composition described in this application.

[0352] On the other hand, this application provides a method for monitoring the efficacy of an antitumor therapy in a subject, the method comprising:

[0353] (i) administering the HER2-binding peptide, the immunoconjugate, or the composition described in this application to a subject suffering from a tumor and receiving antitumor therapy; and

[0354] (ii) Determine the amount of HER2-positive cells in the subject's tumor.

[0355] In some implementations, the presence and / or quantity of HER2-positive cells in the subject's tumor are determined by imaging.

[0356] In some embodiments, the tumor includes a HER2-positive tumor.

[0357] In some embodiments, the tumor includes a solid tumor.

[0358] In some embodiments, the tumor is selected from at least one of the following: breast cancer, gastric cancer, esophageal cancer, bile duct cancer, ovarian cancer, pancreatic cancer, endometrial cancer, cervical squamous cell carcinoma, salivary gland tumor, bladder cancer, lung cancer, colorectal cancer, head and neck cancer, prostate cancer, osteosarcoma, and pediatric medulloblastoma.

[0359] On the other hand, this application provides a kit comprising the HER2-binding peptide, the immunoconjugate, or the composition described in this application.

[0360] The kit may include instructions for use. Instructions for use typically include tangible representations describing the techniques to be used to achieve the desired therapeutic outcome, such as in treating cancer, using the components of the kit. Optionally, the kit may also contain other useful components readily understood by those skilled in the art, such as diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, suction or measuring tools, bandaging materials, or other useful accessories.

[0361] The following examples are intended not to be limited by any theory, but are merely for illustrating the HER2-binding peptide, preparation method and use of this application, and are not intended to limit the scope of the invention.

[0362] Example

[0363] Example 1: Screening and Construction of Anti-Her2 Single-Domain Antibodies

[0364] 1.1 Construction of the Library

[0365] The Her2-cHis fusion protein used for immunization was expressed in 293F cells and purified by nickel column affinity chromatography. One alpaca was selected for immunization. After immunization, lymphocytes were extracted from peripheral blood of the alpaca, and RNA was extracted according to the Trizol instructions. 1 μg of RNA sample was taken for electrophoresis to determine its purity. III. The First-Strand Synthesis System for RT-PCR kit was used to reverse transcribe the extracted RNA into cDNA according to the instructions. Nested PCR was then used to amplify the nucleic acid fragment encoding the variable region of the heavy chain antibody.

[0366] The VHH fragment was purified using a DNA product purification kit. Both the vector and the fragment were digested with the restriction endonuclease sifi at 50°C overnight. The digested fragment was then recovered via gel extraction and cloned into the phage display vector pComb3XSS. The product was subsequently electroporated into *E. coli* electroporated competent cells TG1 to construct a phage display library of a heavy chain single-domain antibody against Her2, and the library was validated. The library size was calculated to be 5.04 × 10⁻⁴ CFU / mL after serial dilution plating. 9 To test the insertion rate of the library, 48 clones were randomly selected for identification. The results showed that the insertion rate reached 100% and the size was correct.

[0367] 1.2 Panning for heavy chain single-domain antibodies against Her2

[0368] The plates were coated with 5 μg / well of Her2-cHis fusion protein and incubated overnight at 4°C. The next day, the plates were blocked with 3% BSA at 37°C for 1 hour, washed three times with PBST (PBS containing 0.01% Tween 20), and then 100 μl of phage library was added and incubated at 37°C for 1 hour. Afterward, the plates were washed six times with PBST (PBS containing 0.01% Tween 20) to remove unbound phages. Then, 100 μL of Gly-HCl (pH = 2.2) was added to each well and incubated at 37°C for 6-8 min to elute specifically bound phages. The eluent was transferred to a sterile centrifuge tube and neutralized with 15 μL of Tris-HCl (pH = 9.0) solution. 10 μL of the phage was serially diluted, the titer was determined, and the panning recovery rate was calculated. The neutralized phage was then used to infect *E. coli* TG1 bacteria in the logarithmic growth phase to produce and purify phage for the next round of screening. This screening process was repeated several times, with different panning conditions for each round. As a result, positive clones were enriched, achieving the goal of using phage display technology to screen for Her2-specific antibodies in the antibody library. Tables 1 and 2 show the affinity panning conditions and the recovery rates after three rounds of acid elution.

[0369] Table 1 Affinity Selection Criteria

[0370]

[0371] Table 2. Recovery rates of target molecules after three rounds of acid elution and screening.

[0372]

[0373] Recovery rate = Recovery amount / Library input amount;

[0374] 1.3 Screening for specific single positive clones using phage enzyme-linked immunosorbent assay (ELISA).

[0375] After several rounds of selection, 48 clones were randomly selected from the final selection plates for identification. These 48 single colonies were cultured separately to produce and purify bacteriophages. Plates were coated with Her2-Fc and Her2-cHis fusion proteins and incubated overnight at 4°C. After blocking with 2% skim milk, the plates were incubated at 37°C for 1 hour. Then, 50 μL of phage culture supernatant and 50 μL of 2% skim milk were added to each well, and the plates were incubated at 37°C for 1 hour. After washing with PBST, horseradish peroxide-labeled anti-M13 secondary antibody (purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd.) was added, and the plates were incubated at 37°C for 1 hour. After washing, TMB chromogenic buffer was added, and absorbance was read at 450 nm. Samples coated with both Her2-Fc and Her2-cHis antigens showed OD values ​​greater than the negative control for sequencing.

[0376] Table 3 Her2-cHis antigen phage ELISA identification

[0377] 1 3.069 9 1.279 17 2.412 25 2.958 33 0.872 41 2.893 Blank 0.252 2 2.058 10 0.702 18 1.001 26 1.936 34 3.16 42 0.739 Blank 0.248 3 1.696 11 2.941 19 3.023 27 2.832 35 2.98 43 2.906 Blank 0.242 4 3.161 12 2.399 20 2.337 28 3.24 36 2.911 44 3.212 Blank 0.286 5 2.338 13 2.456 21 1.151 29 3.08 37 3.176 45 2.564 Blank 0.198 6 2.314 14 3.087 22 0.366 30 0.35 38 1.8 46 2.079 Blank 0.156 7 2.596 15 3.129 23 2.467 31 0.895 39 3.056 47 2.484 Blank 0.183 8 2.054 16 3.39 24 2.327 32 3.089 40 3.285 48 2.482 Blank 0.167

[0378] Table 4. Her2-FC tag antigen phage ELISA identification

[0379]

[0380]

[0381] Clones 22 and 30 were not sent for sequencing, while the remaining clones were sequenced. The protein sequences of each clone were analyzed using the DNAMAN sequence alignment software. Clones with identical CDR1, CDR2, and CDR3 sequences were considered the same antibody strain, while clones with different CDR sequences were considered different antibody strains. Ultimately, 12 candidate sequences were selected for subsequent experiments.

[0382] 1.4 Preparation of Her2 antibody protein using mammalian cells

[0383] The coding sequence of the single-domain antibody obtained from sequencing analysis was subcloned into the expression vector PSNA008 and transfected into HEK293 cells for antibody expression. The recombinant expression plasmid was diluted with Freestyle293 medium and PEI (Polyethylenimine) solution was added for transformation. The plasmid / PEI mixture was added to HEK293 cell suspension and cultured at 37°C, 10% CO2, and 90 rpm. After four hours, EX293 medium and 2 mM glutamine were added, and the cells were cultured at 135 rpm. After 24 hours, 3.8 mM VPA was added. After 6–7 days of culture, the transient expression culture supernatant was collected and purified using a nickel column. The final antibody protein had a purity of over 90%.

[0384] The amino acid sequence of the Her2-Fc fusion protein is as follows:

[0385] MELAALCRWGLLLALLPPGAASTQVCTGTDMKLRLPASPETHLDMLRHLYQGCQVVQGNLELTYLPTNASLSFLQDIQEVQGYVLIAHNQVRQVPLQRLRIVRGTQLFEDNYALAVLDNGDPLNNTTPVTGASPGGLRELQLRSLTEILKGGVLIQRNPQLCYQDTILWKDIFHKNNQLALTLIDTNRSRACHPCSPMCKGSRCWGESSEDCQSLTRTVCAGGCARCKGPLPTDCCHEQCAAGCTGPKHSDCLACLHFNHSGICELHCPALVTYNTDTFESMPNPEGRYTFGASCVTACPYNYLSTDVGSCTLVCPLHNQEVTAEDGTQRCEKCSKPCARVCYGLGMEHLREVRAVTSANIQEFAGCKKIFGSLAFLPESFDGDPASNTAPLQPEQLQVFETLEEITGYLYISAWPDSLPDLSVFQNLQVIRGRILHNGAYSLTLQGLGISWLGLRSLRELGSGLALIHHNTHLCFVHTVPWDQLFRNPHQALLHTANRPEDECVGEGLACHQLCARGHCWGPGPTQCVNCSQFLRGQECVEECRVLQGLPREYVNARHCLPCHPECQPQNGSVTCFGPEADQCVACAHYKDPPFCVARCPSGVKPDLSYMPIWKFPDEEGACQPCPINCTHSCVDLDDKGCPAEQRASPLTIEGRMDPKSSDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK

[0386] The amino acid sequence of the single-domain antibody is:

[0387]

[0388]

[0389] Note: The underlined portion represents the CDR region of the antibody sequence.

[0390] A pair of primers was designed based on the nucleotide sequences of the screened anti-Her2 single-domain antibodies. Using bacterial culture as a template, the nucleotide sequences (including the His tag) of each antibody were amplified by PCR and then cloned into the PSNA008 [pCDNA4 (Invitrogen, Cat V86220)] vector. The correctness of the obtained target clone gene sequence was confirmed by gene sequencing.

[0391] H1-cHis antibody:

[0392] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0393] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0394] The nucleotide sequence of H1-chis:

[0395] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGTTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGCGCAGC GTCTAGTAGCATCTTCAGTGTCAATAATATGGGCTGGTACCGCCAGGCTGCAGGGGAGCAGCGCGAGTTGGTCGCGA GTATCTCACGTCTTGGAACCGCGAACTATAAAGACTCCGTGAAGGGTCGGGTCACCATCTCCAGAGACGACGCCAAG AGCACGGTTTATCTGCAAATGAACAACCTGAAGCCTGAGGACACGGCCGTCTATTACTGTAATACAGACCCACCGTG GGGAGACGATCCATTCGAGCGAAGCGCGTCCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCG GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0396] H2-cHis antibody:

[0397] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0398] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0399] The nucleotide sequence of H2-chis:

[0400] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGTTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGC CTCTGGATTCACTTTGGATTATTATGCCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCAT GTATTACTAGTGGTGGTAGCACAGACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAG AACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACAGCCGTTTATTACTGTGCAGCTTCTCATTACGG TCTACGGGTTGGGACCCTCTGTCCGGAGACATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0401] H11-cHis antibody:

[0402] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0403] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0404] The nucleotide sequence of H11-chis:

[0405] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGTTGCAGCTCGTGGAGTCCGGGGGAGGATCGGTGCAGTCTGGGGAGTCTCTGAGACTCTCCTGTGCAGC CTCTGGATTCTCGATGGAGGAATATGCCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTCGTGAGGGGGTCG CATGTCTGAGTAGAGATGGTTATAGTACTCTTTACAAAGACGCCGTGAAGGGCCGATTCACCATTTTCAGAGACGTC GACAAGAACACACTGTATCTACAGATGGACAGCCTGAAACCTGAGGACACAGCCGTTTATTACTGTGCAGCAATATC GCTTTTGCCAACCGACTATCGCTGTGATAGCAGTAGTTACTCATATTATAACTACTGGGGCCAGGGGACCCAGGTCA CCGTCTCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAATTGATCATAAGAATTC

[0406] H12-cHis antibody:

[0407] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0408] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0409] The nucleotide sequence of H12-chis:

[0410] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGC CTCTGGATTCACTTTGGATTATTATGCCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCAT GTATTACTAGTGGTGGTAGCACAGACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAG AACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACAGCCGTTTATTACTGTGCAGCTTCTCATTACGG TCTACGGGTTGGGACCCTCTGTCCGGAGACATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCT CA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0411] H14-cHis antibody:

[0412] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0413] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0414] The nucleotide sequence of H14-chis:

[0415] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGTTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGC CTCTGGATTCACTTCGGATTATTATGCCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCAT GTATTAGTAGTAGTGGTAGTAGCACAAACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCC AAAAAAACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACAGCCGTCTATTACTGTGCAGCGTCATGGGA TGTCTGCCCCTACTATAGTGGTACTTATCAGGAGTATTTTGGTTGGTGGGGCCAGGGGACCCAGGTCACCGTCTCCT CG GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0416] H15-cHis antibody:

[0417] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0418] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0419] The nucleotide sequence of H15-chis:

[0420] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGGCTGGGGGGTCTCTGAGACTCTCCTGTGCAGT CTCTGGATTCACGTTCGACGAATATACCGTAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCAA GTATTAGAAGTATTGATGGTAGCACATACTATGCAGACGCCGTGAAGGGCCGATTCTCCAGCTCCACTGACGTCGCC AAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAAGACACGGGCGTTTATTATTGTGCATTGTTGCCGTT TTCCGTTTATACGTTGAGTACCGAGTACTATCAATACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0421] H27-cHis antibody:

[0422] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0423] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0424] The nucleotide sequence of H27-chis:

[0425] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGTTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGC CTCTGGATTCACTTTGGATTATTATGCCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCAT GTATTAGTAGTTATGGTGGTAAAACACACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCC AAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACAGCCGTTTATTACTGTGCGGCGTGGTATTT TAGTGGTAGTTACTGCCTCCATTCTCGGGAATACTATGACTACTGGGGCCAGGGGACCCAGGTCATCGTCGCC GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0426] H31-cHis antibody:

[0427] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0428] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0429] The nucleotide sequence of H31-chis:

[0430] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGGCTCTCCTGTGGAAT CTCGGGACTCACCTTCAATTTGTATCCCATGTCCTGGGTCCGCCAGGCTCCAGGAAAGGGGCTCGAGTGGGTCTCAT CAATTACTAAAGATGGTATTAGCACAACCTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCGGAGACAACGCC AAGAACACGCTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTGTATTACTGTGCGATAGGGGAGGA CTGTTCAGACGGTGGGTGTCTCCGGGGCCAGGGGACCCAGGTCACCGTCGCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0431] H32-cHis antibody:

[0432] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0433] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0434] The nucleotide sequence of H32-chis:

[0435] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGC CTCTGGATTCACTTTGGATGATTATGCCATAGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGTGAGGGGGTCTCAT GTATTAGTAGTAGTGGTGGTACCACAAAGTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCC AAGAGCACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACAGCCGTTTATTACTGTGCAGCAATATCGCT TTTGCCAACCGACTATCGCTGTGATAGTGGTAGTGCCTCATATTATAACTACTGGGGCCAGGGGACCCAGGTCACCG TCTCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0436] H36-cHis antibody:

[0437] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0438] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0439] The nucleotide sequence of H36-chis:

[0440] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGGAAC CTCTGGATTCGCCATCAATTTGTATCCCATGTCCTGGGTCCGCCAGGCTCCAGGAAAGGGGCTCGAGTGGGTCTCAT CAATTACTAACGGTGGGATTAGCACAAGCTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCGGAGACAACGCC AAGAACACGCTGTATCTGCAAATGAACAGCCTGAAACCTAAGGACACGGCCGTGTATTATTGTGCGATAGGGGAGGG CTGTTCGGACGGTGGGTGTCTCCGGGGCCAGGGGACCCAGGTCACCGTCGCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0441] H38-cHis antibody:

[0442] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0443] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0444] The nucleotide sequence of H38-chis:

[0445] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGTTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGC CTCTGGAAGCCGCTTCAGCTCCATAGCGCTGAGCTGGTACCGCCAGGCTCCAGGGAGTAAGCGCGAGTTGGTCGCAG TAATTGGTGTTGATGGTACCCCAAACTATCGAGACTTTGTGAAGGGCCGGTTCACCATCTCCAGAGACAACGCCAAG AACACGGTGTCGCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTCTATTATTGTTATACCTGGTTTTTGGG GCATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0446] H45-cHis antibody:

[0447] Upstream primer: CCCAAGCTTGCCGCCACCATGGAGACA

[0448] Downstream primer: CCGGAATTCTTAGTGATGATGGTGGTGGTG

[0449] The nucleotide sequence of H45-chis:

[0450] AAGCTTGCCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGT CAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGGAAC CTCTGGATTCCCCTTCAGTTTGTGGCCCATGTCCTGGGTCCGCCAGGCTCCAGGAAAGGGGCTCGAGTGGGTCTCAT CAATTACTAAAGGGCTTATTAGCACAACCTATGCAGACTCCGTGAGGGGCCGATTCACCATCTCCGGAGACAACGCC AAGAACACGCTGTATCTGCAAATGAACAGCCTGCAACCCGAGGACACGGCCGTGTATTACTGTGCGATAGGGGAGGA CTGTTCAGACGGTGGGTGTCTCCGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA GGCAGCATGGATCCTGGAGGATCTCATCATCACCACCACCATCATCACTAAGAATTC

[0451] Example 2 In vitro screening

[0452] 2.1 Alpaca secondary antibody (HRP) was used for ELISA activity screening. Her2-Fc (PP180524) antigen was coated at 5 μg / mL, blocked, and then each antibody at 5 μg / mL was added and incubated at 37℃ for 1 h. Alpaca secondary antibody (1:10000, Lot#18E001484) was added and incubated at 37℃ for 1 h. The OD value was detected at 450 nm.

[0453] Table 5. Alpaca secondary antibody (HRP) ELISA activity screening

[0454] 12-chis 0.604 1-chis* 0.351 2-chis 1.681 36-chis* 0.231 11-chis 1.465 31-chis* 0.005 45-chis 1.511 <![CDATA[Her2-Fc antigen # > 0.006 38-chis 1.579 <![CDATA[Her2-chis antigen # > 0.009 27-chis 0.978 Herceptin 1.115 14-chis 1.532 5F7-chis 1.827 32-chis 1.542 2RS15D-chis 1.684 15-chis 1.719

[0455] Note: # The antigen and secondary antibody did not bind nonspecifically; *the antibody bound poorly to the alpaca secondary antibody.

[0456] 2.2 ELISA activity screening was performed using His secondary antibody (HRP).

[0457] Coat with Her2-Fc(PP180615) 5ug / mL, block, add sample (3-fold dilution starting from 1ug / mL, 12 spots in total), incubate at 37℃ for 2h; add secondary antibody ant-his(HRP)(Lot#GR3248851-4), incubate at 37℃ for 1h.

[0458] The results showed that, with Her2-31 as 100%, antibodies with good activity were selected as 1#, 36#, 12#, 2#, and 31#.

[0459] Table 6. ELISA activity screening using His secondary antibody (HRP)

[0460]

[0461]

[0462] 2.3 Binding with N87 (Her2+) cells (flow cytometry screening)

[0463] The coating was filled with Her2-Fc(PP180615) at 5 μg / mL and then blocked.

[0464] Collect N87 cells and pipette them into a single-cell suspension, aliquoting them into 2 x 10^5 cells / 200 μL / tube; add antibody to a final concentration of 5 μg / mL, mix well and incubate on ice for 1 h; centrifuge and wash 3 times, then add anti-his secondary antibody, mix well and incubate on ice for 1 h; centrifuge and wash 3 times and resuspend in 300 μL for instrumentation.

[0465] The results are shown in Figure 1: 5 ug / mL should be the saturation concentration. All antibodies showed positive binding to N87 cells, which also indicates that N87 cells are Her2+ cells. The antibodies with stronger cell binding were 1#, 2#, 12#, and 36#, which is basically consistent with the ELISA results.

[0466] 2.4 KD Affinity Detection (fortebio octet)

[0467] The SA sensor (LOT#1906062) was loaded with biotin-labeled antibody for 120 seconds; baseline was applied for 100 seconds, followed by association with Her2-chis antigen for 180 seconds; and dissociation was applied for 600 seconds.

[0468] Table 7 KD Affinity Test

[0469] Her2-1-chis 1.20E-09 9.58E+04 1.15E-04 0.9963 Her2-36-chis <1.0E-12 1.21E+04 <1.0E-07 0.8947 Her2-12-chis <1.0E-12 4.66E+04 <1.0E-07 0.9689 Her2-2-chis 1.50E-09 5.26E+04 7.90E-05 0.9697 Her2-31-chis <1.0E-12 1.38E+04 <1.0E-07 0.8756

[0470] As shown in Table 7, Figure 2-3 As shown: R of antibodies 36# and 31# 2 Data below 0.95 is unreliable; the affinity of antibodies #1 and #2 is around 1 nM, and the KD value of antibody #12 is <1.0E. -12 Unreliable (due to limitations of the ForteBio Octet assay method, the relative antibody binding activity corresponding to unreliable data is referenced from ELISA results).

[0471] 2.5 Epitope Competition with Herceptin

[0472] Her2-Fc 0.5ug / well was coated and incubated overnight at 4℃. After blocking, Her-31-chis, Her2-2-chis, Her2-12-chis, Her2-36-chis, Her2-1-chis, Her2-11-chis, and Her2-45-chis were diluted with 1ug / mL biotin-Herceptin (each at a 4-fold gradient starting from 10ug / mL, for a total of 12 concentrations). After dilution, 100uL / well was added to the wells and incubated at 37℃ for 2h. Anti-his (HRP) secondary antibody was diluted 10000-fold and streptavidin (HRP) was diluted 2000-fold, and then incubated at 37℃ for 1h with 100uL / well. TMB was used for color development and terminated with 1M H2SO4. The absorbance was read at 450nm.

[0473] 2.6 Binding of different concentrations of antibody to BT474 cells (vs 2RS15D)

[0474] Collect BT474 cells, divide into 2 x 10^5 cells / tube, 200 μL / tube, and incubate on ice for 30 min; add 2 RS15D-chis and Her2-1-chis (final concentrations of 5 μg / mL, 1 μg / mL, 0.2 μg / mL, and 0.04 μg / mL, respectively), and incubate on ice for 1 h; after centrifugation and washing twice, add his-PE secondary antibody (Mitteni, batch number 5200303504), and incubate on ice for 1 h; after centrifugation and washing twice, resuspend in 300 μL and transfer to the instrument.

[0475] Figure 5 The results showed that the Her2-1 antibody (Her2-Nb1) binds to the Her2 antigen more effectively than 2RS15D.

[0476] 2.7 Binding with MCF7 cells

[0477] Adjust the MCF7 cell density to 1*10^6 cells / mL; aliquot 100 μL into EP tubes and incubate on ice for 20 min. The final concentration of the 5F7-cHis, Her2-1-cHis, and 2RS15D-cHis reactions was 5 μg / mL. Add 1.15 μL, 0.5 μL, and 0.69 μL of the corresponding antibody to each tube, respectively, and incubate on ice for 30 min. Add 300 μL of 1XPBS + 0.5% BSA, centrifuge at 1200 rpm for 5 min, aspirate the supernatant, and wash with 300 μL of 1XPBS + 0.5% BSA. Add 2 μL of Anti-His-PE to each tube and incubate on ice for 30 min. Add 300 μL of 1XPBS + 0.5% BSA, centrifuge at 1200 rpm for 5 min, aspirate the supernatant, and wash with 300 μL of 1XPBS + 0.5% BSA. Resuspend in 300 μL of 1XPBS + 0.5% BSA and detect on a flow cytometer.

[0478] Figure 6 The results showed that Her2-1 could also bind to Her2-low expression cell lines.

[0479] 2.8 Single-point binding with BT474 cells

[0480] Collect BT474 cells, divide into 2 x 10^5 cells / tube, 100 μL / tube, and incubate on ice for 20 min; add Her2-1-chis (final concentration 1 μg / mL and 0.1 μg / mL respectively), and incubate on ice for 30 min; after centrifugation and washing 3 times, add his-PE secondary antibody and incubate on ice for 30 min; after centrifugation and washing 3 times, resuspend in 200 μL and load onto the instrument.

[0481] Figure 7 The results showed that the Her2-1 antibody bound well to Her2-overexpressing cell lines.

[0482] Based on the combined data from MCF7 and BT474, Her2-1 can specifically bind to the Her2 antigen, and its binding ability is positively correlated with the expression level of the Her2 antigen.

[0483] 2.9 Her2-Nb1 internalization (compared with 5F7, 2RS15D concurrently)

[0484] A validated temperature-controlled secondary antibody assay was used for detection: BT474 cells were collected, aliquoted into 1x10^5 cells / tube, 100 μL / tube, and incubated on ice for 20 min; 5F7-chis, Her2-1-chis, and 2RS15D-chis were added to a final concentration of 0.1 μg / mL, and incubated on ice for 30 min; after centrifugation and washing three times, the cells were grouped and incubated on ice for 0, 1, 2, and 4 h, and at 37°C for 1, 2, and 4 h; his-PE secondary antibody was added, and the cells were incubated on ice for 30 min; after centrifugation and washing three times, the cells were resuspended in 200 μL and analyzed by flow cytometry to detect the mean fluorescence intensity (MFI). At the same time, (MFI...) 0℃ -MFI 37℃ ) / MFI 0℃ *100% represents the internalization rate of the antibody over time.

[0485] Internalization results ( Figure 8 )show:

[0486] i) Affinity: Her-1 > 5F7 > 2RS15D;

[0487] ii) Internalization rate: 5F7 showed an upward trend, and there was no significant difference in the internalization rate of the three antibodies at 4h;

[0488] iii) Absolute internalization: 5F7 showed an upward trend, Her2-1 increased slightly, and 2RS15D decreased slightly. The internalization amount over 4 hours was Her2-1 > 5F7 > 2RS15D.

[0489] iv) Internalization rate: Her2-1 and 2RS15D can approach the internalization peak in 1 hour, with fast internalization, while 5F7 has slow internalization;

[0490] v)Her2-1 has the best internalization effect.

[0491] 2.10 Data Summary

[0492]

[0493] Example 3

[0494] 3.1 Radionuclide-labeled Her2 nanobodies

[0495] 125 I mark

[0496] 200 μL 1×PBS, 5 μL Na 125 Add 100 μg of protein to solution I and mix well. Finally, add one IODO-BEADS capsule. Incubate at room temperature for 0.5 h, then aspirate the liquid to terminate the reaction.

[0497] 99m Tc mark

[0498] Take 500 μL 99m Add TcO4 to the ISOLINK KIT kit and react at 80°C or higher for 1.5 h; then take out 100 μl. 99m Tc(H2O)3(CO)3 is mixed with 100 μg Her2-1 protein and incubated at 37 degrees Celsius for 1.5 h to obtain the final product.

[0499] 177 Lu mark

[0500] Mix 200 μg of DOTA-HER2-1 nanobody conjugate with 100 μL of 0.1M HCl and 500 μL of 0.25M ammonium acetate, and finally add... 177 LuCl3 solution. React at 45℃ for 1 hour. If the reaction volume is too small, 0.25M ammonium acetate can be added to increase the volume of the reaction mixture.

[0501] After 1 hour of reaction, samples were spotted and analyzed by TLC using citric acid as the developing solvent. If the TLC labeling rate was >95%, the sample was released for use. If the labeling rate was <95%, purification was performed using a PD-10 column, saturated with 1% BSA, and eluted with PBS. Radioactivity was measured in 500 μL samples. The radioactive eluates were combined and analyzed by TLC again. If the radiochemical purity was >95%, the sample was released for use.

[0502] 3.2 125 I-Her2-Nbs cell experiment

[0503] SK-OV-3 cells were cultured in culture dishes at a rate of approximately 2 × 10⁻⁶ cells / mL. 5 Cells (1000 μL / well) were added to 6-well plates (3 plates). Cells were incubated overnight at 37°C with 5% CO2 until adherence. The cells were divided into 6 groups, with 3 replicates per group. 900 μL of culture medium was added to each group, followed by the addition of diluted... 125 I-004-nbs 100μL, approximately 100,000 counts, one group is the block group, add 100 times the corresponding cold resistance (unlabeled). 125 (The corresponding antibody for I). The remaining groups were experimental groups. The total volume was 1 mL, and the mixture was incubated at 4°C for 1 h.

[0504] After incubation at 4℃, wash each well of cells once with 1mL of 1×PBS. Collect the cell supernatant and PBS wash buffer into radioimmunoassay tubes and measure the cpm value of each tube.

[0505] Add 1 mL of fresh culture medium to the cells and incubate at 37°C. The Block group was incubated for 1 h, and the experimental groups were incubated for 0 h, 1 h, 2 h, 4 h, and 24 h, respectively. After incubation, the cells were washed once with PBS and incubated with 1000 μL of glycine-hydrochloric acid buffer at 4°C for 5 min. The wash solution was collected. The cpm value of the wash solution in each tube was measured using a gamma counter.

[0506] Add 2M NaOH and wash for 20 min. Collect the cell suspension into radioimmunoassay tubes and use a gamma counter to detect the cpm value of the cell suspension in each tube.

[0507] From the results ( Figure 9 It can be seen that NO.36# and 31# bind more slowly and dissociate more quickly. In comparison, NO.1, 2, and 12# are considered to be superior antibodies.

[0508] 3.3 Distribution and in vivo imaging of Her2-Nb1

[0509] 125 Biodistribution assay of I-Her2-Nb1 in BT474 tumors

[0510] 125 The I-Her2-Nb1 test sample had a 100% labeling rate. 125 I-Her2-Nb1 was administered via tail vein injection to three BT474 tumor-bearing nude mice, at a dose of 60 μCi / 125 μL per mouse. Ninety minutes after administration, the mice were euthanized, and each tissue was dissected, weighed, and counted on a gamma counter to determine the % injection dose per gram (%ID / g) for each tissue.

[0511] result( Figure 10 )show, 125 I-labeling of Her2-Nb1 is highly efficient, and it can accumulate at high concentrations in tumor sites and be metabolized out of the body through the kidneys.

[0512] 125 Imaging of I-Her2-Nb1 in BT474 tumor

[0513] BT474-BALB / c-nude nude mice, administered via IV. 125 I-Her2-Nb1 solution 230 μCi / 125 μL / animal, SPECT-CT (IVIS spectrum) dynamic scanning 0-4 h. Results ( Figure 11 )show, 125 I-labeled Her2-Nb1 showed high enrichment at tumor sites with a high tumor / muscle ratio, indicating good tumor specificity. High uptake was also observed in the kidneys, suggesting that it is primarily metabolized by the kidneys.

[0514] 99mImaging of Tc-Her2-Nb1 in BT474 tumor

[0515] Take 500 μL 99m Add TcO4 (pH ~ 5.0) to the KIT kit (30 mCi) and incubate at 100°C for 30 minutes;

[0516] Take 100 μl (~5.62 mCi) 99 mTc(H2O)3(CO)3 and mix it with 100 μg Her2-1 protein (dissolved in PBS, not less than 100 μL), and incubate at 37°C for about 90 minutes.

[0517] 99m The labeling rate of Tc-Her2-Nb1 after purification was 100%. The sample was calculated based on the labeling rate. 99m The specific activity of Tc-Her2-Nb1 is 31.85 μCi / μg.

[0518] 99m Tc-Her2-Nb1 was administered intravenously to BT474 tumor-bearing mice. Approximately 200 μCi of purified protein was then injected via the tail vein into Balb / c nude mice, followed by SPECT / CT imaging. ROIs were used to delineate uptake in different tissues.

[0519] Table 8 99m T C -Her2-Nb1—SPE CT / CT distribution of BT474 tumor

[0520]

[0521] Table 8 and Figure 12 show, 99m TC-Her2-Nb1 showed high uptake in BT474 tumors, suggesting in vivo specific targeting and binding to the HER2 antigen. Furthermore, tumor uptake remained at a high level for up to 2.5 hours after administration, without a significant decrease over time. High renal uptake also suggests… 99m TC-Her2-Nb1 is primarily metabolized by the kidneys.

[0522] 177 Biodistribution of Lu-Her2-Nb1 in MCF7 mice

[0523] 177 The specific activity of the Lu-DOTA-HER2-1 test sample was 6 μCi / μg. Three MCF7 mice were injected via tail vein. 177 One and a half hours after administering Lu-DOTA-HER2-1 (10 MBq), the animal was euthanized. The heart, lungs, liver, spleen, kidneys, stomach, intestines, bones, flesh, and tumor were harvested to measure weight and gamma count.

[0524] result( Figure 13 The results showed that Her2-Nb1 also binds to Her2-low expression cells in vivo.

[0525] 177 Lu-Her2-Nb1 anti-tumor effect

[0526] BT474 tumor-bearing mice were injected with physiological saline according to their groups (control group). 177 Lu-DOTA-Her2-110Mbq and 20Mbq (once a week, intravenous injection) and Herceptin 10mg / kg (twice a week, intraperitoneal injection) were administered to all animals during the experiment. All animals had free access to food and water, and tumors were monitored 2-3 times a week.

[0527] The result is as shown in the error message: "Reference source not found." Compared to the NS group, 177 The Lu-DOTA-Her2-1 20Mbq group showed significant inhibition of tumor growth, followed by the group with the following tumor growth inhibition: 177 Lu-DOTA-Her2-1 10Mbq showed that the tumor growth inhibition effect of the latter was basically the same as that of the Herceptin group.

[0528] Example 4

[0529] 4.1 Sequence Optimization and Identification

[0530] Following preliminary screening and identification, H1-cHis was selected as the final antibody sequence from the candidate antibodies, and a tag-free recombinant plasmid H1 was constructed. The recombinant single-domain antibody H1 fusion protein particle was transfected into HEK293 cells for antibody expression. Purification was then performed using A3 affinity chromatography. However, identification revealed that the H1 antibody did not bind to the A3 affinity chromatography material, complicating subsequent protein purification. Therefore, the H1 antibody sequence needed to be optimized to enable purification via affinity chromatography.

[0531] The FR (Framework Region) of the H1 antibody sequence was analyzed, and key amino acids related to the binding of A3 affinity packing material were selected for mutation. After sequence analysis, the final mutant H1-AN-TS can bind to A3 affinity chromatography packing material.

[0532] Nomenclature and amino acid sequence of H1 and its mutants

[0533]

[0534] Note: The underlined parts are the points of change.

[0535] Recombinant plasmid H1 and the mutated recombinant plasmid H1-AN-TS were expressed with antibodies in HEK293 cells and purified using A3 affinity chromatography to verify the binding of the mutated plasmid to the affinity chromatography material. Figure 15A-15B The results are SDS-PAGE analysis of the purified antibodies before and after mutation. Figure 15A The result shows that the H1 antibody does not bind to the A3 filler, and the protein flows through. Figure 15B The image shows H1-AN-TS binding to A3 packing material, with the protein eluting in buffer C.

[0536] 4.2 Sequence optimization targeting the binding activity and expression level of H1 antibody.

[0537] The FR (Framework Region) and CDR (Complementarity-determining Region) regions of the H1 antibody sequence were analyzed, and amino acids related to affinity and expression level were selected for mutation attempts. First, single amino acid mutations were performed, followed by multiple amino acid mutations, resulting in a total of 12 single-point mutations in regions related to expression level and binding activity.

[0538] Nomenclature and amino acid sequence of mutants

[0539]

[0540]

[0541] Note: Underlined parts represent the mutated amino acids.

[0542] The expression levels and binding activities of each mutant were detected separately. For ease of detection, this part used a recombinant plasmid with a histidine tag for transient transfection. After transient transfection, the recombinant protein was purified by affinity chromatography using the corresponding Ni+ resin gel. The obtained target protein can then be used for the detection of expression levels and binding activities.

[0543] Affinity activity assay: Her2-Fc fusion protein (0.5 μg / well) was coated onto plates and incubated overnight at 4°C. After washing with PBST, 3% BSA was added for blocking. Then, serially diluted H1 single-domain antibody proteins of each mutant were added, and the reaction was carried out at room temperature for 1 hour. After washing, anti-his horseradish peroxidase-labeled antibody was added, and the reaction was carried out at room temperature for 1 hour. After washing, chromogenic buffer was added, and absorbance was read at 450 nm. Data processing and plotting analysis were performed using SotfMaxPro v5.4 software. Four-parameter fitting was used to obtain the binding curves of the mutant antibodies to Her2-Fc. The relative activities of different mutants were compared using H1 antibody as a control to reflect the antibody affinity for Her2-Fc.

[0544] Expression level calculation: The expression level is calculated based on the total amount of the target protein obtained after one-step affinity chromatography purification.

[0545] Table 9. Binding status and expression level of Her2 antigen by each mutant.

[0546]

[0547] By analyzing the affinity and expression levels of various mutants to the Her2-Fc antigen, we selected sites with relatively good affinity and expression levels after mutation for combined mutation, resulting in a total of 9 combined mutations.

[0548] Mutant Nomenclature and Amino Acid Sequence

[0549]

[0550] Note: Underlined parts represent the mutated amino acids.

[0551] The affinity and expression levels of the nine antibodies from this round of mutations were detected using the same method. For ease of detection, histidine-tagged antibodies were still used for the corresponding transient conversion, purification, and subsequent detection. The results of the polymer detection are shown in Table 10.

[0552] Expression level calculation: The expression level is calculated based on the total amount of the target protein obtained after one-step affinity chromatography purification.

[0553] Table 10. Binding and expression levels of Her2 antigen by various mutant combinations.

[0554]

[0555]

[0556] 4.3 Optimization targeting the negatively charged amino acids in the CDR3 region of the H1 antibody

[0557] Antibody molecules generally require an isoelectric point higher than 7 to ensure their suitability for ion exchange chromatography in downstream purification processes. Furthermore, the isoelectric point of host DNA is mainly distributed between 4 and 4.5; if the antibody's PI value is close to this range, it is difficult to achieve effective removal. Mutations were performed on the negatively charged amino acids in the CDR3 region. This was done because mutations could increase the antibody's PI value, and antibody affinity is directly related to the CDR3 region; therefore, it was desirable to improve the affinity of the H1 antibody while altering the PI value. For these reasons, a total of five mutants were developed in this section.

[0558] The mutant's name and amino acid sequence are as follows:

[0559]

[0560] Note: Underlined parts represent the mutated amino acids.

[0561] After the mutation was completed, the affinity, expression level, and PI value of the modified antibody were detected. The specific results are shown in Table 11.

[0562] Table 11. Binding status, expression level, and PI value of Her2 antigen for each mutant combination.

[0563] H1 100 0.024 5.3 H1-D61A 82.2 0.060 6.41 H1-D103A 49.3 0.033 6.41 H1-D104A 70.2 0.039 6.41 H1-D98A 69.1 0.030 6.41 H1-E107S 77.5 0.039 6.39

[0564] 4.4 Optimization targeting hydrophobic amino acids on the H1 surface

[0565] When nanobodies are used for radiotherapy or radioimaging, in addition to specific absorption at the tumor site, other non-target organs also experience some non-specific absorption. If the nanobody surface contains some hydrophobic amino acids, it may increase uptake in organs such as the liver, leading to the accumulation of radionuclides in these organs during radiotherapy or radioimaging, resulting in liver toxicity. To avoid this situation, the PDB model of the H1 antibody was analyzed, and mutations were attempted on some highly hydrophobic amino acids located on the antibody surface. A total of 5 mutants were optimized in this part.

[0566] The mutant's name and amino acid sequence are as follows:

[0567]

[0568] Note: Underlined parts represent the mutated amino acids.

[0569] After antibody mutation was completed, the target protein was expressed and purified, and its expression level and affinity were detected. The specific results are shown in Table 12.

[0570] Table 12. Binding and expression levels of Her2 antigen by various mutant combinations.

[0571] H1 100 0.024 H1-VG 0 0.018 H1-IT 23.35 0.012 H1-WG 0 0.012 H1-WS 0.6 0.043 H1-FY 72.53 0.047

[0572] 4.5 Humanization of H1 single-domain antibody

[0573] Camel antibodies possess advantages that traditional antibodies lack, such as small molecular weight and good in vivo permeability, allowing them to easily cross blood vessels or tissues to reach target sites. These advantages have led to the widespread use of nanobodies as tools for disease diagnosis and detection. However, long-term clinical use of multivalent antibodies may induce varying degrees of immune responses, affecting treatment efficacy. Therefore, humanization of H1 antibodies is necessary. Humanization is achieved using methods such as amino acid humanization of the protein surface and partial transplantation of the VHH humanization universal framework.

[0574] The humanization steps are as follows: Obtain the universal humanized VHH framework h-NbBcIII0FGLA (PDB number: 3EAK) designed by Cecile Vincke et al. based on sequence homology. This framework design is based on the nanobody NbBcIII0 antibody (PDB number: 3DWT). Refer to the human antibody for protein surface amino acid humanization. Select the sites to be humanized according to the specific situation of the H1 nanobody sequence.

[0575] Humanization of the H1 antibody involved mutations using both the H1 antibody and H1-AN-TS antibody as templates, resulting in seven humanized antibody variants. Tables 13 and 14 list the amino acid changes of these humanized variants and the names of the mutated antibodies, with amino acid residue numbers corresponding to Kabat numbers. The specific names and mutation locations are shown in the tables.

[0576] Table 13 Comparison of Amino Acid Mutations (using H1-AN-TS as a template)

[0577] FH1-H √ √ √ √ √ √ √ FH1-3KE √ √ √ √ √ √ √ √ hH1-AN-TS √ √ √ √ √ hH1-DA √ √ √ hH1-KP √ √ √ H1-RL √

[0578] Table 14 Comparison of Amino Acid Mutations (using H1 as a template)

[0579] FH1-N √ √ √ √ √ √ √

[0580] The specific names and amino acid sequences of the mutants are as follows:

[0581]

[0582] Note: The underlined parts are mutant amino acids.

[0583] After the mutation was completed, the affinity and expression levels of each mutant were analyzed. The specific detection results are shown in Table 15.

[0584] Table 15. Detection of affinity and expression levels of humanized variants.

[0585]

[0586]

Claims

1. A nanobody that specifically binds to HER2, comprising: HCDR1, HCDR2, and HCDR3, wherein... The amino acid sequence of HCDR1 is shown in SEQ ID NO: 13, the amino acid sequence of HCDR2 is shown in SEQ ID NO: 25, and the amino acid sequence of HCDR3 is shown in SEQ ID NO: 38; or The amino acid sequence of HCDR1 is shown in SEQ ID NO: 13, the amino acid sequence of HCDR2 is shown in SEQ ID NO: 88, and the amino acid sequence of HCDR3 is shown in SEQ ID NO:

38.

2. The nanobody according to claim 1, wherein the nanobody is camelidoid, chimeric, partially humanized, or fully humanized.

3. The nanobody according to claim 1, comprising VH, wherein the amino acid sequence of said VH is as shown in SEQ ID NO:1 or SEQ ID NO:

145.

4. The nanobody according to claim 1, wherein the amino acid sequence of the nanobody is as shown in SEQ ID NO: 1 or SEQ ID NO:

145.

5. One or more isolated nucleic acid molecules encoding the nanobody according to any one of claims 1-4.

6. A construct comprising the nucleic acid molecule according to claim 5.

7. A cell comprising the nucleic acid molecule according to claim 5 or the construct according to claim 6.

8. A method for preparing the nanobody of any one of claims 1-4, comprising culturing the cells of claim 7 under conditions that allow the expression of the nanobody.

9. The method of claim 8, further comprising recovering the nanobodies expressed by the cells.

10. The method of claim 9, further comprising purifying and / or modifying the nanobody.

11. An immunoconjugate, said immunoconjugate comprising: i) the nanobody according to any one of claims 1-4; and ii) The conjoint portion, which is a detectable marker.

12. The immunoconjugate according to claim 11, wherein the detectable marker is selected from one or more reagents of the group consisting of: radionuclides, fluorescent agents, chemiluminescent agents, bioluminescent agents, paramagnetic ions, and horseradish peroxidase.

13. The immunoconjugate according to claim 12, wherein the radionuclide is suitable for medical imaging and / or treatment.

14. The immunoconjugate according to claim 12, wherein the radionuclide comprises 110 In、 111 In、 177 Lu、 18 F, 52 Fe、 62 Cu、 67 Cu、 67 Ga、 68 Ga、 68 Ge 86 Y、 90 Y、 89 Zr、 94m Tc, 120 I, 123 I, 124 I, 125 I, 131 I, 154-158 Gd, 32 P, 11 C 13 N、 15 O、 186 Re、 188 Re、 51 Mn, 52m Mn, 72 As、 75 Br、 76 Br、 82m Rb、 83 Sr.

15. The immunoconjugate of claim 11, wherein the nanobody is conjugated directly or indirectly to the detectable marker.

16. The immunoconjugate of claim 11, wherein the nanobody is conjugated to the detectable marker via a chelating agent.

17. The immunoconjugate according to claim 16, wherein the chelating agent is selected from one or more of DTPA, EDTA, NOA, DOTA, TRAP, TETA, NETA, CB-TE2A, Cyclen, Cyclam, Bispidine, TACN, ATSM, SarAr, AmBaSar, MAG3, MAG2, HYNIC, DADT, EC, NS3, H2dedpa, HBED, DFO, PEPA, and HEHA.

18. A composition comprising a nanobody according to any one of claims 1-4, a nucleic acid molecule according to claim 5, and / or an immunoconjugate according to any one of claims 11-17, and optionally a pharmaceutically acceptable carrier.

19. The composition of claim 18, wherein the composition comprises a nanobody of any one of claims 1-4 or an immunoconjugate of any one of claims 11-17, and the composition is a detection agent or a therapeutic agent.

20. The composition of claim 19, wherein the detection agent is a reagent for detecting HER2 protein.

21. The composition of claim 19, wherein the detection agent is a contrast agent.

22. The composition of claim 21, wherein the contrast agent is a contrast agent for detecting HER2 protein.

23. The composition of claim 19, wherein the therapeutic agent is used to treat tumors.

24. The composition of claim 23, wherein the therapeutic agent is used to treat HER2-positive tumors.

25. Use of the nanobody of any one of claims 1-4, the nucleic acid molecule of claim 5, the construct of claim 6, the cell of claim 7, the immunoconjugate of any one of claims 11-17, and / or the composition of any one of claims 18-24 in the preparation of pharmaceuticals, reagents, detection plates, or kits; The reagents, test plates, or kits mentioned above are used to detect HER2 protein in samples; The agent is used to treat tumors expressing HER2, the tumors being selected from at least one of breast cancer, gastric cancer, esophageal cancer, bile duct cancer, ovarian cancer, pancreatic cancer, endometrial cancer, cervical squamous cell carcinoma, salivary gland tumor, bladder cancer, lung cancer, colorectal cancer, head and neck cancer, prostate cancer, osteosarcoma, and pediatric medulloblastoma.

26. A kit comprising a nanobody according to any one of claims 1-4, an immunoconjugate according to any one of claims 11-17, or a composition according to any one of claims 18-24.

Images