Mesenchymal stem cell aging-related molecular marker and application thereof

Abstract

The application provides a mesenchymal stem cell aging-related molecular marker and application thereof, and the molecular marker is miR-311. Researches on umbilical cord blood-derived mesenchymal stem cells, induced pluripotent stem cell-derived mesenchymal stem cells and mesenchymal stem cell-derived extracellular vesicles show that the expression level of miR-311 increases with the aging of mesenchymal stem cells. Therefore, miR-311 can be used as a molecular marker of mesenchymal stem cell aging, provides a theoretical basis for detecting mesenchymal stem cell aging in vitro, helps to develop a new method for monitoring and evaluating the state / quality of mesenchymal stem cells, is applied to quality monitoring of large-scale production of mesenchymal stem cells, improves the quality and yield of mesenchymal stem cells, and promotes the application of mesenchymal stem cells in the fields of regenerative medicine and tissue engineering.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology, cell biology, and stem cell culture and application, and particularly to a molecular marker related to aging of mesenchymal stem cells and its application. Background Technology

[0002] Cellular senescence is considered the cellular counterpart of tissue and biological aging, characterized by irreversible arrest of cell growth and alterations in function and behavior. Cellular senescence allows the body to halt the proliferation of damaged cells, acting as a barrier against tumorigenesis. However, cells that have undergone permanent proliferative arrest can be harmful to the entire individual. Senescent cells exist in aging tissues and depend on age-related accumulation; this accumulation accelerates tissue function decline and promotes age-related diseases.

[0003] MicroRNAs (miRNAs) are a class of specialized RNAs composed of approximately 22 nucleotides. They influence the translation and stability of target mRNAs to regulate post-transcriptional gene expression and are considered important contributors to gene regulation. miRNAs are crucial regulatory molecules for aging-related gene expression. Extracellular vesicles (EVs) are heterogeneous vesicles induced by stimuli such as cell differentiation, aging, and transformation. They are formed by a lipid bilayer and contain proteins, nucleic acids, lipids, and their derivatives. EVs are important participants in intercellular communication and can also reflect the pathological state of releasing cells, serving as promising biomarkers for various pathologies. Cells produce different types of miRNAs due to external interventions and different functional needs. miRNAs encapsulated in EVs are strictly regulated by various stress stimuli and microenvironmental conditions. The contents of EVs secreted by senescent cells differ from those of normal cells, and EV miRNAs can serve as promising molecular markers of aging.

[0004] Stem cells are the foundation of regenerative medicine, and mesenchymal stem cells (MSCs) are one of the key therapeutic tools in the fields of regenerative medicine and tissue engineering. However, during in vivo or in vitro culture, MSCs undergo functional decline and gradually lose their stemness as the donor ages and develops disease. Long-term in vitro culture induces replicative senescence in MSCs, with cell morphology changing from a spindle-shaped to a flattened form, reduced proliferation capacity, downregulated differentiation potential, increased lysosomal density, increased mitochondrial density, and altered membrane potential. This senescence and degeneration of MSCs during in vitro culture has, to some extent, constrained basic stem cell research, industrialization, and clinical applications. Therefore, researching and developing molecular markers related to MSC senescence is a crucial issue that urgently needs to be addressed to advance the application of MSCs. This research will help develop new methods for monitoring and evaluating the status / quality of MSCs, thereby improving MSC quality and yield.

[0005] Therefore, existing technologies still need improvement. Summary of the Invention

[0006] In view of the shortcomings of the prior art, the purpose of this invention is to provide a molecular marker related to mesenchymal stem cell aging and its application, aiming to solve the problems existing in the current detection or monitoring of aging of mesenchymal stem cells in vitro by developing a molecular marker related to mesenchymal stem cell aging.

[0007] The technical solution adopted in this invention is as follows:

[0008] A molecular marker associated with aging of mesenchymal stem cells, wherein the molecular marker is miR-311, and the nucleotide sequence of miR-311 is shown in SEQ.ID NO 1.

[0009] An application of a molecular marker related to aging of mesenchymal stem cells, wherein the application is for non-diagnostic purposes, and the molecular marker described above is used to detect the aging of mesenchymal stem cells.

[0010] In the aforementioned application, the mesenchymal stem cells include umbilical cord blood-derived mesenchymal stem cells and induced pluripotent stem cell-derived mesenchymal stem cells.

[0011] In the aforementioned application, the aging indicators of the mesenchymal stem cells include at least one of the following: cell morphology, cell proliferation capacity, intracellular lysosomal density, intracellular mitochondrial density, expression level of stemness-related genes, or changes in cell osteogenic differentiation potential.

[0012] In the aforementioned application, the stemness-related genes include NANOG or SOX2.

[0013] A mesenchymal stem cell aging detection kit, wherein the kit includes the mesenchymal stem cell aging-related molecular markers as described above.

[0014] The kit further includes miR-311 detection primers and probes.

[0015] The kit described herein, wherein the nucleotide sequence of the miR-311 detection primer is shown in SEQ.ID NO 2.

[0016] An application of a mesenchymal stem cell aging detection kit, wherein the application is for non-diagnostic purposes, and the kit described above is used to screen for mesenchymal stem cell aging-related drug molecules.

[0017] Beneficial Effects: This invention provides a molecular marker related to mesenchymal stem cell aging and its application, wherein the molecular marker is miR-311. Studies conducted on umbilical cord blood-derived mesenchymal stem cells, induced pluripotent stem cell-derived mesenchymal stem cells, and extracellular vesicles derived from mesenchymal stem cells show that the expression level of miR-311 increases with the aging of mesenchymal stem cells. Therefore, miR-311 can serve as a molecular marker for mesenchymal stem cell aging, providing a theoretical basis for in vitro detection of mesenchymal stem cell aging. This will contribute to the development of new methods for monitoring and evaluating the status / quality of mesenchymal stem cells, enabling its application in quality monitoring for large-scale production of mesenchymal stem cells, improving the quality and yield of mesenchymal stem cells, and promoting the application of mesenchymal stem cells in regenerative medicine and tissue engineering. Attached Figure Description

[0018] Figure 1 A schematic diagram of the precursor structure of the molecular marker miR-311 provided in an embodiment of the present invention.

[0019] Figure 2 The results are small RNA sequencing analysis of extracellular vesicles from iMSCs derived from healthy individuals and patients with progeria, as presented in this embodiment of the invention.

[0020] Figure 3 This is a schematic diagram of the morphology of iMSC cells derived from healthy individuals and patients with progeria in an embodiment of the present invention.

[0021] Figure 4 This is a schematic diagram comparing the proliferation capacity of iMSC cells derived from healthy individuals and patients with progeria in an embodiment of the present invention.

[0022] Figure 5 This is a schematic diagram illustrating the changes in intracellular lysosomal density of iMSCs derived from healthy individuals and patients with progeria in an embodiment of the present invention.

[0023] Figure 6 This is a schematic diagram illustrating the changes in intracellular mitochondrial density in iMSCs derived from healthy individuals and patients with progeria, as described in this embodiment of the invention.

[0024] Figure 7 The expression levels of the stem genes Nanog and Sox2 in iMSCs derived from healthy individuals and progeria patients in this embodiment of the invention.

[0025] Figure 8 The p16 aging-related gene from iMSCs derived from healthy individuals and patients with progeria in this embodiment of the invention. INK4A and p21 expression level.

[0026] Figure 9 This is a schematic diagram illustrating the osteogenic differentiation results of iMSCs derived from healthy individuals and patients with progeria in an embodiment of the present invention.

[0027] Figure 10 This is a schematic diagram showing the expression levels of miR-311 in extracellular vesicles of iMSCs derived from healthy individuals and progeria patients in this embodiment of the invention.

[0028] Figure 11 This is a schematic diagram showing the miR-311 expression levels of MSCs derived from induced pluripotent stem cells and umbilical cord blood in an embodiment of the present invention. Detailed Implementation

[0029] This invention provides a molecular marker related to mesenchymal stem cell aging and its application. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0030] This invention provides a molecular marker related to aging of mesenchymal stem cells, wherein the molecular marker is miRNA, and the miRNA is miR-311.

[0031] The nucleotide sequence of miR-311 is shown in SEQ.ID NO 1:

[0032] SEQ.ID NO 1: GUGGGGUGUUAGGUCAUUC

[0033] In this embodiment of the invention, RNA was first extracted from mesenchymal stem cells and small RNA-seq was performed. miRNA expression levels were estimated using TPM, and differential miRNA expression analysis was performed using DESeq2 based on a negative binomial distribution. A corrected P < 0.05 was considered a significant differential expression threshold. New miRNAs were predicted using miREvo and mirdeep2 software. The predicted new miRNA was named miR-311, and the precursor structure of miR-311 is as follows... Figure 1 As shown in the figure. Subsequently, experiments were conducted in umbilical cord blood-derived MSCs, induced pluripotent stem cell-derived MSCs (iMSCs), and MSC-derived extracellular vesicles, yielding consistent results: miR-311 expression levels increased with MSC aging. Therefore, miR-311 can serve as a biomarker for MSC aging, providing a theoretical basis for in vitro detection of MSC aging, aiding in quality monitoring of large-scale MSC production, and promoting the application of MSCs in regenerative medicine and tissue engineering.

[0034] This invention also provides an application of a molecular marker related to mesenchymal stem cell aging, which is not for diagnostic purposes. The aforementioned molecular marker miR-311 is used to detect the aging of mesenchymal stem cells.

[0035] In some embodiments, the mesenchymal stem cells include umbilical cord blood-derived mesenchymal stem cells and induced pluripotent stem cell-derived mesenchymal stem cells.

[0036] Specifically, miR-311 is used to detect aging of human umbilical cord blood-derived mesenchymal stem cells and human induced pluripotent stem cell-derived mesenchymal stem cells, and the application is for non-diagnostic purposes.

[0037] In some embodiments, the aging indicators of the mesenchymal stem cells include at least one of the following: cell morphology, cell proliferation capacity, intracellular lysosomal density, intracellular mitochondrial density, mitochondrial membrane potential, expression level of stemness-related genes, or changes in the osteogenic differentiation potential of the cells.

[0038] Specifically, the stemness-related genes include NANOG or SOX2.

[0039] This invention selects several senescence indicators of mesenchymal stem cells (MSCs) and determines MSC senescence by observing changes in these indicators. It also detects the expression of miR-311 in normal and senescent MSCs. For example, changes in cell morphology include increased area, flattened morphology, and elongated cell length in senescent MSCs; altered cell proliferation capacity, with MSC proliferation capacity decreasing with increasing senescence; altered intracellular lysosome density, with MSC intracellular lysosome density increasing with increasing senescence; altered intracellular mitochondrial density, with MSC intracellular mitochondrial density increasing with increasing senescence; significantly downregulated expression levels of stem cell-related genes Nanog and Sox2; and altered osteogenic differentiation potential, with MSC osteogenic differentiation potential decreasing with increasing senescence. This invention determines MSC senescence by observing changes in at least one of the above indicators.

[0040] In some implementations, the aging of mesenchymal stem cells can also be determined by detecting the expression levels of aging-related genes. Specifically, these aging-related genes include p21 and p16. INK4A p16, a related gene in senescent MSCs. INK4A p21 expression was significantly downregulated.

[0041] This invention also provides a mesenchymal stem cell aging detection kit, which includes the mesenchymal stem cell aging-related molecular marker miR-311 as described above.

[0042] In some implementations, the kit also includes miR-311 detection primers and probes.

[0043] Specifically, the nucleotide sequence of the miR-311 detection primer is shown in SEQ.ID NO 2:

[0044] SEQ.ID NO 2:GTGGGGTGTTAGGTCATTC

[0045] In some embodiments, the miR-311 detection primers are chemically synthesized. Such chemical synthesis can be performed by common synthetic companies.

[0046] In other embodiments, the molecular marker miR-311 can also be used to prepare reagents for detecting cell senescence indicators or related to cell senescence.

[0047] This invention also provides an application of a mesenchymal stem cell aging detection kit, which is not for diagnostic purposes. The kit described above is used to screen for drug molecules related to mesenchymal stem cell aging.

[0048] Specifically, the mesenchymal stem cell aging-related drug molecules include drug molecules that promote or alleviate the aging of mesenchymal stem cells.

[0049] The following specific embodiments further explain and illustrate the present invention's mesenchymal stem cell aging-related molecular markers and their applications:

[0050] Example 1: Small RNA Sequencing Analysis of iMSC-Derived Extracellular Vesicles

[0051] 1. Sample collection, RNA extraction, and small RNA-seq

[0052] Culture supernatants from in vitro passaged induced pluripotent stem cell-derived mesenchymal stem cells (iMSCs) were collected separately. These included culture supernatants from passage 6 and 13 iMSCs derived from healthy individuals, and from passage 6 and 13 iMSCs (LMNA R527C mutation) derived from progeria patients. Each group contained three biological replicates. The culture supernatants were concentrated using ultrafiltration tubes with a 10000 kDa cutoff, followed by purification of extracellular vesicles using an SEC exclusion column. Total RNA was extracted from the extracellular vesicles using the exoReasy Kit, and RNA concentration was determined using Qubit. Sequencing libraries were then constructed for small RNA sequencing.

[0053] 2.Small RNA-seq analysis

[0054] miRNA expression levels were estimated using TPM. Differential miRNA expression analysis was performed using DESeq2 based on a negative binomial distribution, with a corrected P < 0.05 considered significant. Novel miRNAs were predicted using miREvo and mirdeep2 software. The predicted new miRNA was named miR-311, and its precursor structure is shown below. Figure 1As shown.

[0055] Small RNA sequencing analysis showed that, compared to generation 6, the copy number of miR-311 was upregulated in extracellular vesicles derived from iMSCs from healthy individuals and progeria patients in generation 13. Figure 2 As shown.

[0056] Example 2: Detection of aging characteristics of iMSC

[0057] 1. Cell morphology

[0058] Appropriate amounts of passage 6 and passage 13 iMSCs (including those from healthy individuals and those from progeria patients) were seeded into cell culture plates and cultured overnight. Cell morphology was observed and photographed under a microscope after one day of culture. Results are as follows: Figure 3 As shown, compared with the 6th generation, the 13th generation iMSCs have increased area, flattened morphology and longer cell length.

[0059] 2. Cell proliferation capacity

[0060] Appropriate amounts of passage 6 and passage 13 iMSCs (including those from healthy individuals and those from progeria patients) were seeded into cell culture plates and cultured overnight. Changes in cell proliferation were analyzed using the WST-1 kit at 1 and 2 days of culture, and OD450 was measured using a microplate reader. Each group contained three biological replicate wells. Results are as follows: Figure 4 As shown, the OD450 value of the 13th generation iMSC group was lower than that of the 6th generation, suggesting that the proliferation capacity of iMSCs decreases with increasing aging.

[0061] 3. Intracellular lysosomal density

[0062] Appropriate amounts of passage 6 and passage 13 iMSCs (including those from healthy individuals and those from progeria patients) were seeded into cell culture plates and cultured overnight. After 2 days of culture, the cells were lysosomal stained using a lysosomal red fluorescent probe, and the staining was observed and photographed using a fluorescence microscope. The results are as follows: Figure 5 As shown, compared with the 6th generation, the red fluorescence of the 13th generation iMSC group was significantly enhanced, suggesting that the intracellular lysosomal density of iMSCs is upregulated with increasing aging.

[0063] 4. Intracellular mitochondrial density

[0064] Appropriate amounts of passage 6 and passage 13 iMSCs (including those from healthy individuals and those from progeria patients) were seeded into cell culture plates and cultured overnight. After 2 days of culture, mitochondria were stained using a red fluorescent mitochondrial probe, and the staining was observed and photographed using a fluorescence microscope. The results are as follows: Figure 6As shown, compared with the 6th generation, the red fluorescence of the 13th generation iMSC group was significantly enhanced, suggesting that the intracellular mitochondrial density of iMSCs is upregulated with increasing aging.

[0065] 5. Stem gene expression level

[0066] Cell samples from passages 6 and 13 of iMSCs (including those from healthy individuals and progeria patients) were collected, with three biological replicates in each group. Total RNA was extracted from iMSCs using the Trizol method. After determining the RNA concentration, cDNA templates were obtained using a quantitative reverse transcription kit. Real-time PCR was then performed to detect changes in the expression of stem genes (Nanog and Sox2). The upstream primer sequence for Nanog is shown in SEQ.ID NO 3: GATGCCCTCACACGGAGACTG; the downstream primer sequence for Nanog is shown in SEQ.ID NO 4: GCAGAAGTGGGTTGTTTGCC; the upstream primer sequence for Sox2 is shown in SEQ.ID NO 5: GACAGTACGCGCACATGAA; the downstream primer sequence for Sox2 is shown in SEQ.ID NO 6: TAGGTCTGCGAGCTGGTCAT; the GAPDH gene was used as an internal control.

[0067] The results were analyzed based on the obtained CT values, and the results are as follows: Figure 7 As shown, compared with the 6th generation, the expression of stem genes Nanog and Sox2 in the 13th generation iMSCs was significantly downregulated.

[0068] 6. Expression levels of aging-related genes

[0069] Cell samples from passage 6 and passage 13 iMSCs (including those from healthy individuals and patients with progeria) were collected, with three biological replicates in each group. Total RNA was extracted from iMSCs using the Trizol method. After determining the RNA concentration, reverse transcription was performed using a quantitative reverse transcription kit to obtain cDNA templates. Real-time quantitative PCR was then used to detect aging-related genes (p16). INK4A The changes are expressed in p16 and p21. Specifically, p16... INK4A The upstream primer sequence is shown in SEQ.ID NO 7: AGGGGACAGCAGAGGAAG; p16 INK4AThe downstream primer sequence is shown in SEQ.ID NO 8: GCGTTTGGAGTGGTAGAAATCTG; the upstream primer sequence for p21 is shown in SEQ.ID NO 9: GAGGCCGGGATGAGTTGGGAGGAG; the downstream primer sequence for p21 is shown in SEQ.ID NO 10: CAGCCGGCGTTTGGAGTGGTAGAA; the GAPDH gene can be used as an internal reference for detection.

[0070] The results were analyzed based on the obtained CT values, and the results are as follows: Figure 8 As shown, compared with the 6th generation, the aging-related gene p16 in the 13th generation iMSCs... INK4A p21 expression was significantly downregulated.

[0071] 7. Cell osteogenic differentiation induction ability

[0072] Appropriate amounts of passage 6 and passage 13 iMSCs (including those from healthy individuals and progeria patients) were seeded into cell culture plates and cultured until confluence. The MSC medium was then switched to MSC osteogenic differentiation induction medium, with the medium changed every 2 days until continuous differentiation for 14 days. Each group contained three biological replicates. After 14 days of culture, MSC osteogenic differentiation staining was performed using an MSC osteogenic differentiation staining kit, and the staining was observed and photographed under a microscope. The results are as follows: Figure 9 As shown, the staining intensity of the 13th generation iMSC group was reduced compared to the 6th generation, suggesting that the osteogenic differentiation potential of iMSCs is reduced with increasing aging.

[0073] Example 3: The miR-311 content in extracellular vesicles derived from iMSCs increases with cell senescence.

[0074] Total RNA was extracted from extracellular vesicles derived from iMSCs using the exoReasy Kit. This included total RNA from iMSC passage 6 and 13 vesicles from healthy individuals, and total RNA from iMSC passage 6 and 13 vesicles (LMNA R527C mutation) from progeria patients. Each group contained three biological replicates. After determining RNA concentration, reverse transcription was performed using the Mir-X miRNA First-Strand Synthesis Kit (Clontech) to obtain cDNA templates. Quantitative real-time PCR was then performed to detect changes in miR-311 expression. The miR-311 primer sequence is shown in SEQ.ID NO 2: GTGGGGTGTTAGGTCATTC, with U6 used as an internal control.

[0075] The results were analyzed based on the obtained CT values, and the results are as follows: Figure 10As shown, compared with the 6th generation, the content of miR-311 in extracellular vesicles derived from iMSCs in the 13th generation of healthy individuals and patients with progeria was significantly upregulated. This result suggests that the content of miR-311 in extracellular vesicles of iMSCs increases with the degree of cell senescence.

[0076] Example 4: Intracellular miR-311 expression in MSCs increases with cell senescence.

[0077] Cell samples from passage 6 and passage 13 MSCs (including those derived from umbilical cord blood and induced pluripotent stem cells) were collected, with three biological replicates in each group. Total RNA was extracted from iMSCs using the Trizol assay. After determining the RNA concentration, cDNA templates were obtained by reverse transcription using the Mir-X miRNA First-Strand Synthesis Kit (Clontech). Quantitative real-time PCR was then performed to detect changes in miR-311 expression.

[0078] The results were analyzed based on the obtained CT values, and the results are as follows: Figure 11 As shown, compared with the 6th generation, the expression of miR-311 in the 13th generation MSCs was significantly upregulated. This result suggests that the expression of miR-311 increases with the deepening of MSC aging and can be regarded as a molecular marker of MSC aging.

[0079] In summary, this invention provides a molecular marker related to mesenchymal stem cell aging and its application, wherein the molecular marker is miR-311. Studies conducted on umbilical cord blood-derived mesenchymal stem cells, induced pluripotent stem cell-derived mesenchymal stem cells, and extracellular vesicles derived from mesenchymal stem cells show that miR-311 expression levels increase with the aging of mesenchymal stem cells. Therefore, miR-311 can serve as a molecular marker for mesenchymal stem cell aging, providing a theoretical basis for in vitro detection of mesenchymal stem cell aging. This will contribute to the development of new methods for monitoring and evaluating the status / quality of mesenchymal stem cells, enabling its application in quality monitoring for large-scale production of mesenchymal stem cells, improving the quality and yield of mesenchymal stem cells, and promoting the application of mesenchymal stem cells in regenerative medicine and tissue engineering.

[0080] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A molecular marker for aging-related mesenchymal stem cells, characterized in that, The molecular marker is miR-311, and the nucleotide sequence of miR-311 is shown in SEQ. ID NO 1.

2. The application of a molecular marker related to aging of mesenchymal stem cells, characterized in that, The application is for non-diagnostic purposes, using the molecular markers as described in claim 1 to detect aging of mesenchymal stem cells.

3. The application according to claim 2, characterized in that, The mesenchymal stem cells include umbilical cord blood-derived mesenchymal stem cells and induced pluripotent stem cell-derived mesenchymal stem cells.

4. The application according to claim 2, characterized in that, The aging indicators of the mesenchymal stem cells include at least one of the following: cell morphology, cell proliferation capacity, intracellular lysosomal density, intracellular mitochondrial density, expression level of stemness-related genes, or changes in the osteogenic differentiation potential of the cells.

5. The application according to claim 4, characterized in that, The stemness-related genes include NANOG or SOX2.

6. A mesenchymal stem cell aging detection kit, characterized in that, The kit includes the mesenchymal stem cell aging-related molecular markers as described in claim 1.

7. The reagent kit according to claim 6, characterized in that, The kit also includes miR-311 detection primers and probes.

8. The reagent kit according to claim 7, characterized in that, The nucleotide sequence of the miR-311 detection primer is shown in SEQ. ID NO 2.

9. The application of a mesenchymal stem cell aging detection kit, characterized in that, The application is for non-diagnostic purposes, and the kit described in any one of claims 6-8 is used to screen for mesenchymal stem cell aging-related drug molecules.

Images