Application of soybean calcium-dependent protein kinase gene GmCDPK17

Abstract

The application discloses application of a soybean CDPK kinase gene GmCDPK17.The soybean CDPK kinase gene GmCDPK17 shown in SEQ ID NO.1 is applied in genetic engineering modification of soybean resistance to Spodoptera litura.The overexpression of GmCDPK17 can restore the sensitivity of cpk10 Arabidopsis thaliana mutants to Spodoptera litura, and can significantly improve the resistance of soybean to Spodoptera litura.The soybean CDPK kinase gene GmCDPK17 can be transformed into soybean hairy roots through genetic engineering, and finally positively regulates the resistance of soybean to Spodoptera litura.

Description

Technical Field

[0001] This invention relates to the application of the soybean calcium-dependent protein kinase gene GmCDPK17, and belongs to the field of genetic engineering. Background Technology

[0002] Soybeans, as an important oilseed and economic crop, provide high-quality oils and proteins for humans and animals. Throughout their growth cycle, soybeans are susceptible to damage from phytophagous insects, with the beet armyworm being a particularly prevalent species, feeding extensively on a wide range of parts of the plant and consuming large quantities, causing severe yield losses in southern soybean regions. Relying solely on chemical pesticides for pest control not only continuously pollutes the environment and harms human and animal health but also induces pesticide resistance in insects. Therefore, identifying and utilizing soybean insect-resistant genes and breeding resistant varieties is a crucial strategy for soybean pest control and holds significant research importance for sustainable agricultural development.

[0003] Previous studies have located an insect-resistant locus on soybean chromosome 6, which contains 18 genes, one of which is a calcium-dependent protein kinase (CDPK) gene, GmCDPK17. Calcium-dependent protein kinases are involved in plant growth and development, and responses to biotic and abiotic stresses and hormones. The Arabidopsis homolog AtCPK10 enhances Arabidopsis' resistance to pathogens and drought tolerance by promoting salicylic acid (SA) accumulation. It also participates in hormone signaling pathways and regulates seedling root development in response to ABA, IAA, 2,4-D, GA(3), and 6-BA hormone treatments. The rice homolog OsCPK9 enhances rice drought resistance and regulates spikelet fertility through stomatal regulation. OsCPK21 enhances rice salt tolerance in response to ABA hormone induction. In tobacco, NtCDPK2 and MAPKs jointly regulate the expression of ethylene synthesis genes, promoting ethylene synthesis. Only a small number of genes are functional in plant insect resistance, and these genes all belong to the CDPK subfamily V. NaCDPK4 and NaCDPK5 are both involved in regulating JA accumulation and responding to insect stress; mutant plants exhibit strong insect resistance. In soybean, GmCDPK38, belonging to the same subfamily V, has been reported to enhance soybean plant resistance to the beet armyworm when knocked out, but this gene shares only 52.06% similarity with the GmCDPK17 gene of this invention. However, there are no reports on the insect resistance of soybean CDPK III subfamily genes. Summary of the Invention

[0004] The purpose of this invention is to disclose the insect-resistant genetic engineering application of the soybean CDPK gene GmCDPK17, which is mainly expressed in soybean roots and rapidly upregulated in leaves after induction by the beet armyworm. Furthermore, subcellular localization analysis revealed that GmCDPK17 is a nuclear and membrane localization protein. GmCDPK17 can be introduced as a target gene into the hairy roots of Arabidopsis thaliana and soybean, positively regulating the plant's resistance to the beet armyworm.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The application of the soybean CDPK gene GmCDPK17 in genetically engineered soybean resistance to beet armyworm, the coding region sequence of the soybean CDPK gene GmCDPK17 is shown in SEQ ID NO.1.

[0007] In Arabidopsis thaliana, overexpression of GmCDPK17 restored the resistance of the cpk10 mutant to the beet armyworm. In soybean, overexpression of this gene significantly improved the insect resistance of soybean.

[0008] Beneficial effects

[0009] GmCDPK17 is a soybean CDPK gene that positively regulates the resistance of transgenic Arabidopsis thaliana and soybean hairy roots to the beet armyworm. Expression analysis showed that GmCDPK17 was highly expressed in soybean roots, stems, and leaves, and upregulated in insect-induced leaves. Subcellular localization analysis confirmed that GmCDPK17 is a nuclear and membrane localized protein. Functional validation further revealed that this gene positively regulates the resistance of transgenic Arabidopsis thaliana and soybean hairy roots to the beet armyworm. Therefore, GmCDPK17 can serve as a target for regulating soybean resistance to the beet armyworm and can be used for the modification of soybean insect resistance. Attached Figure Description

[0010] Figure 1 Agarose gel electrophoresis image of PCR clone GmCDPK17. Target fragment size: 1656 bp. Marker: DL2000

[0011] Figure 2 GmCDPK17 organization expression pattern. N=3.

[0012] Figure 3 GmCDPK17 can respond to Spodoptera litura stress induction. Changes in GmCDPK17 expression levels in soybean leaves at 1, 6, 12, 24, and 48 h after insect induction (N=3).

[0013] Figure 4Subcellular localization analysis of GmCDPK17 protein. GFP: fluorescence; Light: bright field; Merge: fusion of fluorescence and bright field; 35S:GFP: empty vector control; 35S:GmCDPK17-GFP: GmCDPK17 protein with GFP tag. Scale bar: 50 μm.

[0014] Figure 5 PCR detection in transgenic Arabidopsis thaliana. (A) PCR detection of the Arabidopsis thaliana cpk10 mutant (T-DNA insertion). The Arabidopsis thaliana cpk10 mutant amplified a shorter fragment, while the Col-0 plant amplified a longer fragment. (B)

[0015] PCR detection of GmCDPK17 transgenic Arabidopsis thaliana, target fragment size 1713bp. M: Marker DL2000, P: positive plasmid, Col-0: wild-type Arabidopsis thaliana Col-0, cpk10: Arabidopsis thaliana cpk10 mutant, 1-5: different GmCDPK17-OEcpk10 transgenic plants, H2O: blank control.

[0016] Figure 6 Overexpression of GmCDPK17 in the cpk10 mutant enhanced the plant's resistance to *Spodoptera litura*. (A) Weights of *Spodoptera litura* larvae fed with *Arabidopsis thaliana* Col-0, cpk10 mutant, and GmCDPK17-OE cpk10 plants at 0, 2, and 4 days. Two-tail test, N=3. *: P<0.05, ns: not significant, error bars indicate ±SEM. (B) *Spodoptera litura* larvae fed with *Arabidopsis thaliana* Col-0, cpk10 mutant, and GmCDPK17-OE cpk10 plants at 0 and 4 days. Scale bar = 1 cm.

[0017] Figure 7 PCR detection of transgenic hairy roots. (A) PCR detection of overexpression of hairy root OE-GmCDPK17 and overexpression of empty hairy root OE-KZ. Target fragment size: 1655bp. M: Marker DL2000, P: Positive plasmid (pMDC83-GmCDPK17), H2O: Blank control, 1-5: Negative hairy roots, 1#-5#: Different positive hairy roots carrying the pMDC83-GmCDPK17 plasmid. (B) PCR detection of interference hairy root RNAi-GmCDPK17 and interference empty hairy root RNAi-KZ. Target fragment size: 378bp. M: Marker DL2000, P: Positive plasmid [pB7GWIWG2(II)-GmCDPK17], H2O: Blank control, 1-5: Negative hairy roots, 1#-5#: Different positive hairy roots carrying pB7GWIWG2(II)-GmCDPK17 plasmid.

[0018] Figure 8 Relative expression level of GmCDPK17 gene in transgenic soybean hairy roots and identification of its resistance to Spodoptera litura. (A) Soybean hairy roots overexpressing OE-CDPK17 and control OE-KZ, RNA-interfered hairy roots RNAi-CDPK17 and control RNAi-KZ. Scale bar = 2 cm. (B) Relative expression level of GmCDPK17 in soybean hairy roots of four genotypes. N = 3. *: P < 0.05; **: P < 0.01. Error bars indicate ± SEM. (C) Weight of Spodoptera litura larvae fed with soybean hairy roots of four genotypes for 0, 4, and 6 days, and larvae at 0 and 6 days. Scale bar = 1 cm. Two-tail test, N = 3. ****: P < 0.0001. Error bars indicate ± SEM. Detailed Implementation

[0019] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0020] Unless otherwise specified, the methods used in the following embodiments are conventional methods.

[0021] Example 1: Cloning and Expression Characteristics Analysis of the Soybean GmCDPK17 Gene

[0022] 1) Cloning of the soybean GmCDPK17 gene

[0023] Using soybean variety PI 227687 as the sample, its leaves were collected, ground in a mortar and pestle, and added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, the mixture was transferred to another 1.5 mL EP tube, and total RNA was extracted using an RNA extraction kit (Shanghai Pudi). The quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometry. Using the obtained total RNA as a template, reverse transcription was performed according to the instructions of the Novizan HiScript III 1st Strand cDNA Synthesis Kit (Nanjing). After obtaining the first strand of cDNA, PCR amplification was performed. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 90 seconds, for a total of 35 cycles, followed by incubation at 72℃ for 5 minutes, and then isothermal treatment at 4℃ to obtain cDNA from PI 227687.

[0024] Using the coding sequence of GmCDPK17 (Glyma.06g189600) from the soybean database Phytozome v12 as a template, specific primers were designed, and the gene was amplified from leaf cDNA of soybean variety PI 227687 using PCR. The PCR product was ligated with a T vector to construct the T-GmCDPK17 recombinant vector. After sequencing, the complete CDS sequence of the soybean GmCDPK17 gene was obtained, with a full length of 1656 bp. Figure 1 The coding sequence of the GmCDPK17 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The specific primer sequences required for the PCR reaction are F1: atgtcgccaggggacacta and R1: tcaaaccaccacagcttgac.

[0025] 2) Tissue expression analysis of GmCDPK17

[0026] Roots, stems, leaves, flowers, and seeds of soybean variety PI 227687 were collected to identify the expression level of GmCDPK17 in different tissues. Roots, stems, and leaves were collected at stage V4, flowers at stage R2, and seeds and pods were collected 15 days after flowering. Samples were flash-frozen in liquid nitrogen and stored at -80℃. Total RNA extraction was performed as described in section 1. Total RNA from each tissue was used as a template to convert cDNA. The primer sequences for GmCDPK17 quantitative PCR were: F2: ttttcagagattgttgggag and R2: ccacaccttgctcagtctct. The relative expression level of the gene in each tissue was detected by real-time quantitative PCR (RT-PCR), using soybean Tubulin gene as an internal reference. Primer sequences are shown in F3: ggagttcacagaggcagag and R3: cacttacgca tcacatagca. GmCDPK17 was mainly expressed in soybean roots, flowers, and leaves, with lower expression levels in stems and seeds. Figure 2 ).

[0027] 3) Expression analysis of GmCDPK17 in *Spodoptera litura* under stress.

[0028] Two beet armyworms were placed on the true leaves and second compound leaves of soybean cultivar PI 227687 (V4 stage) plants. After 48 hours, the insects were removed, completing the induction treatment. At this point, approximately 20% of the soybean leaves had been lost. Fresh leaves from the induction group and the control group (uninduced group) were collected at 1, 6, 12, 24, and 48 hours after induction, flash-frozen in liquid nitrogen, and stored at -80℃. Total RNA extraction was performed as described in section 1). Using the total RNA from the leaves of the induction group and control group as templates, cDNA was reverse-engineered and subjected to real-time quantitative PCR (RT-PCR). The primer sequences for GmCDPK17 and the internal reference gene Tubulin were the same as described in section 2.

[0029] After treating soybean leaves with Spodoptera litura, the expression level of GmCDPK17 was significantly upregulated, reaching a peak at 24 h. Figure 3 The results indicate that GmCDPK17 expression is induced by stress from the beet armyworm.

[0030] 4) Subcellular localization of soybean GmCDPK17 gene

[0031] Specific primers were designed to amplify the CDS sequence of the GmCDPK17 gene (without a stop codon) from the T-GmCDPK17 vector via PCR. This sequence was then inserted into the pFGC5941 expression vector containing a GFP tag to construct a subcellular localization vector. This vector possesses a 35S promoter, which strongly induces the expression of the target gene GmCDPK17 in the recipient. The vector was transformed into Agrobacterium tumefaciens strain EHA105 using a freeze-thaw method (35S:GmCDPK17-GFP). Simultaneously, the empty vector pFGC5941 was also transformed into EHA105 as an empty vector control (35S:GFP). The primer sequences for vector construction were F4: acaaatctat ctctctctcgagatgggaaactgcaacgtgtg and R4: gctcaccatggatccaaccaccacagcttgaccag.

[0032] Bacterial suspensions containing 35S:GmCDPK17-GFP and 35S:GFP were injected into leaves of 7-8 week old Nicotiana benthamiana. After culturing for 36-48 hours, the localization of the reporter gene GFP was observed using a Leica TCS SP2 laser confocal microscope. GFP signal analysis showed that the GmCDPK17-GFP fusion protein was localized in the nucleus and cell membrane, while the empty vector was localized throughout the entire tobacco cell. Figure 4 ).

[0033] Example 2: Genetic Engineering Application of Soybean CDPK Gene GmCDPK17

[0034] 1) Construction of plant expression vector for soybean CDPK gene GmCDPK17

[0035] When constructing the gene overexpression vector, primers containing the double enzyme restriction sites (BamHI and KpnI) of the overexpression vector (pMDC83) were designed (see F5: ggggacaagtttgtacaaaaaagcaggctccatgggaaactgcaacgtgtg and R5: ggggaccactttgtacaagaaagctgggttcaaaccaccacagcttgac). The complete CDS sequence of the GmCDPK17 gene with a linker was cloned from the T-GmCDPK17 vector. This CDS sequence was then digested with the pMDC83 vector sequence using double enzymes, and the recombinant vector pMDC83-GmCDPK17 was constructed by ligation. The plant transformation vector pMDC83 contains a strong 35S promoter, which can strongly induce the expression of the target gene GmCDPK17 in the recipient. The vector was then transformed into Agrobacterium tumefaciens strain EHA105 and Agrobacterium rhizogenes strain K599 using a freeze-thaw method. At the same time, the unloaded pMDC83 was also converted to K599 as an unloaded reference.

[0036] When constructing the RNA interference vector, a 190bp sequence from the CDS of the GmCDPK17 gene was selected and compared with that of Invitrogen. Technology with Clonase TM The pDONR221 vector in Kit II was subjected to a BP reaction, followed by colony PCR sequencing for verification. Primer sequences are shown in F6: ggggacaagtttgtacaaaaaagcaggctcccaagccaggggagaggtttt and R6: ggggaccactttgtacaagaaagctgggtacccctcaagatcgccaaag. The specific PCR procedure is the same as step 1) in Case Implementation 1, obtaining the entry clone. Next, the obtained entry clone was recombinated with the target expression vector pB7GWIWG2(II) developed by Invitrogen to obtain the pB7GWIWG2(II)-GmCDPK17 plant interference vector. The constructed vector pB7GWIWG2(II)-GmCDPK17 and the empty vector pB7GWIWG2(II) were transformed into Agrobacterium rhizogenes strain K599.

[0037] 2) The GmCDPK17 gene can rescue the insect resistance of Arabidopsis thaliana cpk10 plants.

[0038] Arabidopsis mutant cpk10 was purchased from arashare ( https: / / www.arashare.cn / index / Product / index.htmlAccording to the website information, the Arabidopsis mutant cpk10 was identified by PCR reaction. Figure 5 A) The primer sequences used for PCR were LP: cgaagttttgctggttctctg, BP: tcagaaggtcggttcacaac and RP: atttgccgatttcggaac. LP and BP were used for the mutant cpk10, and LP and RP were used for the wild type.

[0039] Arabidopsis thaliana was transformed using the flower-dipping method. Flower buds of the cpk10 Arabidopsis thaliana mutant were immersed in a bacterial solution of Agrobacterium tumefaciens strain EHA105 containing pMDC83-GmCDPK17 (step 1) for 30 seconds to 1 minute. The plants were wrapped in plastic wrap or a plastic bag to maintain humidity and cultured in the dark for 24 hours. Afterwards, depending on the plant growth, transformation was repeated once a new batch of inflorescences appeared. The Arabidopsis thaliana was then placed under normal conditions to continue growth, and seeds were harvested. The harvested seeds were simultaneously sown with wild-type Arabidopsis thaliana Col and mutant cpk10 seeds. DNA was extracted from the leaves of each Arabidopsis thaliana, and the GmCDPK17-overexpressing Arabidopsis thaliana mutant cpk10 was identified by PCR, yielding 5 T1 generation transgenic Arabidopsis thaliana cpk10 (35S:GmCDPK17 / cpk10) plants. Figure 5 B). PCR detection primers are F7:ATGGGAAACTGCAACGTGTG and R7:GATAATCATCGCAAGACCGG.

[0040] Five Arabidopsis thaliana plants each of WT, cpk10, and 35S:GmCDPK17 / cpk10 were planted for a forced feeding experiment on the beet armyworm. Five randomly selected second-instar beet armyworms were placed on rosette leaves, and the Arabidopsis thaliana plants were placed in white mesh bags for forced feeding. The larvae were weighed on days 0, 2, and 4, and the average larval weight was calculated. The weight of a single beet armyworm larva was used as an indicator of resistance. Figure 6 As shown, the larval weight of those fed the cpk10 mutant was significantly higher than that of the WT mutant on days 2 and 4, and the larvae of the beet armyworm were larger, indicating a lack of insect resistance. The larval weight and size of those fed the 35S:GmCDPK17 / cpk10 mutant were not significantly different from those fed the WT mutant. This indicates that overexpression of GmCDPK17 in the cpk10 mutant restored the insect resistance of the Arabidopsis mutant.

[0041] 3) The GmCDPK17 gene positively regulates soybean resistance to the beet armyworm.

[0042] Five-day-old soybean seedlings were wounded on the underside of their cotyledons. Agrobacterium tumefaciens strain K599, containing the vectors pMDC83-GmCDPK17 and pB7GWIWG2(II)-GmCDPK17 respectively, along with a corresponding empty vector control, was then inoculated into the wounds on the underside of the soybean cotyledons. The inoculated cotyledons were then placed in White medium containing 500 μg / mL carboxybenzyl and 50 μg / mL cephalosporin. After three weeks of dark incubation at 25°C, hairy roots emerged from the wounds on the underside of the cotyledons. The overexpressing hairy roots were designated OE-CDPK17, with the empty vector control designated OE-KZ; the interfering hairy roots were designated RNAi-CDPK17, with the empty vector control designated RNAi-KZ. To detect whether the hairy roots were positive, PCR was performed on the extracted soybean hairy root DNA using specific primers. The primer sequences for detecting overexpression of hairy roots were F7: ATGGGAAACTGCAACGTGTG and R7: GATAATCATCGCAAGACCGG. A gel image of PCR-positive hairy roots is shown below. Figure 7 A. Primer sequences for RNA interference hairy root detection are shown in F8: GGGAGTCCTTACTACATGG and R8: GACGGAGGAACCCCACA. PCR-positive hairy root detection is shown in [link to primer]. Figure 7 B. Real-time quantitative qPCR revealed that the expression level of the GmCDPK17 gene was significantly higher in hairy roots overexpressing OE-CDPK17 than in OE-KZ, while the expression level of the GmCDPK17 gene was significantly lower in RNAi-CDPK17 than in RNAi-KZ. Figure 8 A and B). The primer sequences for GmCDPK17 and the soybean internal reference gene Tubulin are the same as those in step 2 of Implementation Case 1).

[0043] Soybean hairy roots of four genotypes (OE-CDPK17, OE-KZ, RNAi-CDPK17, and RNAi-KZ) were used to feed uniformly sized second-instar Spodoptera litura larvae in petri dishes indoors, with 5 larvae per dish and 10 replicates. Fresh hairy roots were provided daily, and larvae were weighed on days 0, 2, 4, and 6. The average larval weight per dish was calculated, and the average larval weight of Spodoptera litura was used as an indicator of insect resistance. Spodoptera litura larvae fed with OE-CDPK17 transgenic hairy roots were significantly lighter than those fed with the control OE-KZ, indicating resistance, while Spodoptera litura larvae fed with RNAi-CDPK17 transgenic hairy roots were significantly heavier than those fed with the control RNAi-KZ, indicating susceptibility. Figure 8 C). This result indicates that GmCDPK17 overexpression can increase soybean resistance to the beet armyworm.

Claims

1. Soybean CDPK kinase gene GmCDPK17 The application of the coding region in genetically engineered soybean resistance to the beet armyworm, specifically the soybean CDPK kinase gene. GmCDPK17 The coding region sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The overexpression described GmCDPK17 The gene can significantly improve the resistance of soybeans to the beet armyworm.

Images