Method for identifying the number of teats of a pig and specific primer pair
By designing primer pairs to amplify a specific site on chromosome 3 of the pig reference genome Sscrofa11.1, the problem of identifying the number of pig nipples was solved, enabling efficient and accurate selection of the number of pig nipples, reducing breeding costs and supporting automated detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- LIAONING WEIJIA AGRI & ANIMAL HUSBANDRY ECOLOGICAL FOOD CO LTD
- Filing Date
- 2022-12-27
- Publication Date
- 2026-07-21
AI Technical Summary
The number of pig nipples is a complex trait, making breeding difficult. Current technologies are insufficient for efficiently and accurately identifying and selecting pigs with this trait.
Specific primer pairs were designed and used to amplify the DNA fragment at the 120,443,794th polymorphic site on chromosome 3 of the pig reference genome Sscrofa11.1, starting from the 5' end. The pig genotype (TT, CT, CC) was determined by PCR amplification and sequencing, thereby identifying the number of pig teats.
It achieves highly accurate and low-cost identification of the number of pig nipples, enabling early screening of pigs with more or fewer nipples, reducing breeding costs, and supporting automated detection, thus having high practical application value.
Smart Images
Figure CN115992263B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for identifying the number of pig nipples and its specific primer pair, belonging to the field of biotechnology. Background Technology
[0002] The number of teats is an important economic trait in pigs, closely related to their reproductive performance and the economic benefits of pig farming. With increasing litter sizes, the number of teats has become a crucial factor affecting piglet survival rates, attracting growing attention from researchers and breeders and becoming part of pig breeding programs.
[0003] However, the number of teats in pigs is a complex trait, making breeding difficult. Molecular breeding can be used to screen for molecular markers associated with this trait. Therefore, research on molecular markers and QTLs for the number of teats in pigs is very important. One study performed a QTL mapping analysis on the number of teats in pigs, which located the QTL for this trait in the 120.4–120.8 Mb region on chromosome 3 (Bovo S, Ballan M, Schiavo G, Ribani A, Tinarelli S, Utzeri VJ, Dall'Olio S, Gallo M, Fontanesi L. Single-marker and haplotype-based genome-wide association studies for the number of teats in two heavy pig breeds. AnimGenet. 2021 Aug;52(4):440-450. doi: 10.1111 / age.13095. Epub 2021 Jun 6. PMID:34096632; PMCID: PMC8362157.). Summary of the Invention
[0004] The purpose of this invention is to provide a method for identifying the number of pig nipples and its specific primer pair.
[0005] This invention discloses a method for amplifying a pig reference genome. Sscrofa Primer pair for the DNA fragment at the 120,443,794th polymorphic base site on chromosome 3, starting from the 5' end; the pig reference genome. Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017.
[0006] The primer pair consists of the DNA molecule shown in SEQ ID No. 1 and the DNA molecule shown in SEQ ID No. 2.
[0007] The present invention also discloses a kit for identifying or assisting in the identification of the number of pig nipples, the kit comprising the primers described in claim 1 or 2.
[0008] The present invention also discloses a method for identifying or assisting in the identification of the number of pig nipples, wherein the number of pig nipples in pigs with the TT genotype is significantly greater than the number of pig nipples in pigs with the CT and CC genotypes;
[0009] The TT genotype pigs are the pig reference genome. Sscrofa Pigs with a T base at position 120443794 from the 5' end of chromosome 3 in 11.1;
[0010] The CT genotype pigs are those whose bases are C and T at position 120443794 from the 5' end on chromosome 3 of the pig reference genome Sscrofa11.1;
[0011] The pigs with the CC genotype are the pig reference genome. Sscrofa Pigs with a C base at position 120443794 from the 5' end of chromosome 3 in 11.1;
[0012] The pig reference genome Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017.
[0013] The method for determining the TT, CT, or CC genotypes is as follows: Using pig genomic DNA as a template, PCR amplification is performed using the primers described in claim 1 or 2 to obtain PCR amplification products. If the base at position 56 from the 5' end of the PCR amplification product is T, then the pig's genotype is TT. If the base at position 56 from the 5' end of the PCR amplification product is C and T, then the pig's genotype is CT. If the base at position 56 from the 5' end of the PCR amplification product is C, then the pig's genotype is CC.
[0014] The present invention also discloses a method for breeding pigs with more teats, which involves selecting pigs with the TT genotype for breeding;
[0015] The TT genotype pigs are the pig reference genome. Sscrofa Pigs with a T base at position 120443794 from the 5' end of chromosome 3 in 11.1;
[0016] The pig reference genome Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017.
[0017] The method for determining the TT genotype is as follows: using pig genomic DNA as a template, PCR amplification is performed using the primers described in claim 1 or 2 to obtain PCR amplification products. If the base at position 56 from the 5' end of the PCR amplification product is T, then the genotype of the pig is the TT genotype.
[0018] The present invention also discloses a method for breeding pigs with fewer teats, which involves selecting pigs with the CC genotype for breeding;
[0019] The pigs with the CC genotype are the pig reference genome. Sscrofa Pigs with a C base at position 120443794 from the 5' end of chromosome 3 in 11.1;
[0020] The pig reference genome Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017.
[0021] The method for determining the CC genotype is as follows: using pig genomic DNA as a template, PCR amplification is performed using the primers described in claim 1 or 2 to obtain PCR amplification products. If the base at position 56 from the 5' end of the PCR amplification product is C, then the genotype of the pig is CC genotype.
[0022] The pig mentioned is a Large White pig.
[0023] This invention uses sequencing methods to detect porcine reference genome Sscrofa 11.1 The genotype of pig individuals is determined by the base at the g.120443794C>T polymorphism site (SSC3 g.120443794C>T) on chromosome 3, thereby allowing selection of pigs with a higher number of teats. This invention provides a method for early screening of pigs, reducing breeding costs and effectively increasing the number of teats in actual production. The method is highly accurate, inexpensive, and can be automated, making it highly valuable for practical application in pig breeding. Attached Figure Description
[0024] Figure 1 The results are from forward sequencing, showing the sequencing results of the sequence near the g.120443794C>T polymorphism site (red arrow) on chromosome 3 of the Sscrofa11.1 reference genome of a Daweijia Large White pig individual. CC and TT are single peaks, while CT in heterozygotes is a double peak.
[0025] Figure 2The reverse sequencing results are the sequencing results of the sequence near the g.120443794C>T polymorphism site (red arrow) on chromosome 3 of the Sscrofa11.1 of the Daweijia Large White pig individual pig reference genome. CC and TT are single peaks, and CT of heterozygotes is double peak. Detailed Implementation
[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0027] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0028] All the Large White sows come from the Daweijia Breeding Pig Core Breeding Farm.
[0029] The pig reference genome 11.1 sequences in the following examples all refer to the pig reference genome sequence updated on February 7, 2017 in GenBank. Sscrofa 11.1).
[0030] Example 1: Identifying the number of pig teats
[0031] I. Determination of the SSC3 g.120443794C>T polymorphism site in pigs
[0032] (a) Using two Daweijia core breeding farm large white pigs as experimental materials, genomic DNA was extracted from their ear margin tissues.
[0033] (II) Primer Design and Synthesis
[0034] Based on the sequence of the pig reference genome 11.1, the following primers were designed and synthesized:
[0035] U (upstream primer): 5'-GCAACATGGGGATTTTAAGG-3' (SEQ ID No. 1);
[0036] D (downstream primer): 5'-GTTCAGGGATGGCATTGAAT-3' (SEQ ID No. 2).
[0037] (III) PCR amplification
[0038] Using the Large White pig genomic DNA obtained in step (I) as a template, and U and D from step (II) as primers, PCR amplification was performed to obtain PCR amplification products with a length of 132 bp.
[0039] PCR amplification system (Phanta Max Super-Fidelity DNA Polymerase, Vazyme): 100 ng genomic DNA, 12.5 µL 2X Phanta Max Buffer, 0.5 µL dNTPs Mix (10 mM each), 1 µL each of forward and reverse primers, 0.5 µL Phanta Max Super-Fidelity DNA Polymerase, and ddH2O to bring the total volume to 25 µL.
[0040] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 15 s, for a total of 30 cycles; final extension at 72℃ for 10 min.
[0041] (iv) Sequencing and sequence analysis
[0042] The PCR product was sequenced, yielding a total length of 132 bp. Sequence of the product from individuals with the CC genotype:
[0043] The product sequence for the TT genotype individual is: GCAACATGGGGATTTTAAGGCATACTATTTATGGTTAACATTTAATTATGCCTAACCTTAAAGCAGGTGATTCTGCTGCATTTCCCCCCAGCCCTCCAGAAGCTAGATAGGAGTTCAGGGATGGCATTGAAT. The base at position 56 from the 5' end of this product is either T or C. Figure 1 The middle arrow indicates that this site is the pig reference genome. Sscrofa The 120443794th base from the 5' end on chromosome 3 of 11.1 is therefore named SSC3 g.120443794C>T.
[0044] An individual whose genotype is C at the 120443794th base from the 5' end of chromosome 3 of the pig reference genome Sscrofa11.1 (or the 56th base from the 5' end of the PCR amplification product obtained in step (iii)) is homozygous. This individual is named CC. SscrofaAn individual whose genotype is T (base position 120443794 from the 5' end of chromosome 3 in step (iii) or base position 56 from the 5' end of the PCR amplification product obtained in step (iii)) is homozygous. This individual is named TT. (In the pig reference genome...) Sscrofa An individual whose genotype is C and T is the 120443794th base from the 5' end on chromosome 3 of 11.1 (or the 56th base from the 5' end of the PCR amplification product obtained in step (iii)). This individual is a heterozygous individual, and its genotype is named CT.
[0045] II. Association Analysis of the Porcine SSC3 g.120443794C>T Polymorphism Site with the Number of Porcine Teats
[0046] To determine whether the SSC3 g.120443794C>T polymorphism is related to the number of pig nipples, the following experiment was conducted using 2247 Large White pigs from the Daweijia core breeding farm:
[0047] (i) Extract genomic DNA from the ear margin tissue of each pig and perform PCR amplification according to the method in step (iii) of step one to obtain each PCR amplification product. Determine the genotype of each pig as CC, CT or TT according to the method in step (iv) of step one.
[0048] (ii) Record the number of teats, phenotype, and pedigree information for each pig.
[0049] (iii) A least-squares association analysis was conducted on the genotype of pigs and the number of teats. For details, please refer to the literature "L. Shi, L. Liu, Z. Ma, X. Lv, C. Li, L. Xu, B. Han, Y. Li, F. Zhao, Y. Yang, and D. Sun, Idnetification of genetic associations of ECHS1 gene with milkfatty acid traits in dairy cattle, Anim Genet. 2019 Oct;50(5):430-438".
[0050] The model used is as follows:
[0051] Y = μ + G + S + B + e
[0052] Where Y is the nipple count phenotypic value, G is the genotype effect, S is the sex effect, B is the batch effect, and e is the residual effect.
[0053] The results are shown in Table 1.
[0054] Table 1. Association analysis of porcine SSC3 g.120443794C>T locus genotype with porcine teat number trait.
[0055] genotype quantity Number of left nipples (least squared mean ± standard deviation) Number of right nipples (least squared mean ± standard deviation) TT 780 <![CDATA[7.246±0.042 Aa ]]> <![CDATA[7.230±0.045 A ]]> CT 1068 <![CDATA[7.171±0.041 Bb ]]> <![CDATA[7.180±0.045 A ]]> CC 399 <![CDATA[7.097±0.046 Bc ]]> <![CDATA[7.097±0.050 B ]]>
[0056] Note: Different capital letters in the superscript of the same column indicate extremely significant differences. P < 0.01), different lowercase letters indicate significant differences ( P < 0.05).
[0057] Table 1 shows that, for the left teat number trait, the number of teats in pigs with the TT genotype was significantly greater than that in pigs with the CT and CC genotypes. P < 0.01), the number of teats in pigs with the CT genotype was significantly greater than the number of teats in pigs with the CC genotype. P < 0.05; For the right teat number trait, pigs with the TT and CT genotypes had significantly more teats than those with the CC genotype. P (< 0.01), there was no significant difference in the number of pig nipples between the TT genotype and the CT genotype.
[0058] The results show that the pig reference genome used in this invention... Sscrofa The result of identifying the number of pig nipples using the polymorphism at position 120,443,794 from the 5' end of chromosome 3 (11.1) is consistent with the actual measured number of pig nipples. In actual pig breeding, to obtain pigs with a higher number of nipples, it is best to select pigs with the TT genotype for breeding.
Claims
1. A method for identifying or assisting in the identification of the number of pig teats, characterized in that, The method was as follows: pigs with the TT genotype had significantly more teats than those with the CT and CC genotypes; The TT genotype pigs are the pig reference genome. Sscrofa Pigs with a T base at position 120443794 from the 5' end on chromosome 3 of 11.1; The CT genotype pigs are those whose bases are C and T at position 120443794 from the 5' end on chromosome 3 of the pig reference genome Sscrofa11.1; The pigs with the CC genotype are the pig reference genome. Sscrofa Pigs with a C base at position 120443794 from the 5' end on chromosome 3 of 11.1; The pig reference genome Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017; The pig in question is a Large White pig.
2. A method for breeding pigs with a higher number of teats, characterized in that, Select pigs with the TT genotype for breeding; The TT genotype pigs are the pig reference genome. Sscrofa Pigs with a T base at position 120443794 from the 5' end on chromosome 3 of 11.1; The pig reference genome Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017; The pig in question is a Large White pig.
3. A method for breeding pigs with fewer teats, characterized in that, Pigs with the CC genotype were selected for breeding; The pigs with the CC genotype are the pig reference genome. Sscrofa Pigs with a C base at position 120443794 from the 5' end on chromosome 3 of 11.1; The pig reference genome Sscrofa Sequence 11.1 is the pig reference genome sequence from the GenBank database, updated on February 7, 2017; The pig in question is a Large White pig.
4. The method described in any one of claims 1 to 3 is applied in the selection of large white pigs based on the number of teats.