Soybean flowering and plant height related protein Gmmrf2 and its encoding gene and application

Abstract

The application discloses a protein GmMRF2 related to soybean flowering and plant height and an encoding gene and application thereof, and belongs to the technical field of biotechnology, and particularly relates to the protein GmMRF2 related to soybean flowering and plant height and the encoding gene and application thereof. The protein is any one of the following: A1) a protein with an amino acid sequence shown in SEQ ID No. 2; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues of the protein of A1) and having more than 80% identity with the protein shown in A1) and having a function of regulating plant flowering and plant height; and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). Experiments prove that the protein GmMRF2 can regulate a plant flowering period and plant height, and has important theoretical significance for soybean breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a protein GmMRF2 that promotes soybean flowering and plant height, its encoding gene, and its applications. Background Technology

[0002] Soybean seeds contain approximately 40% protein and 20% oil, making them an important dual-purpose crop for both grain and oil. With the continuous improvement of people's living standards, the increasing abundance of material life, and the growing pursuit of health, the demand for high-quality protein and oil is increasing daily, further amplifying the demand for soybeans. Although my country has abundant soybean germplasm resources, soybeans are short-day, photoperiod-sensitive dicotyledonous crops. Most soybean varieties can only transition from vegetative growth to reproductive growth, and then flower and set pods, after the day length shortens to a certain limit. It is precisely this sensitivity to photoperiod that significantly affects the flowering and growth stages of soybeans, as their flowering and growth periods are heavily influenced by the length of daylight during the growing season in the planting area. This results in a limited suitable planting area for soybean varieties, making it difficult to widely promote some high-yielding, high-quality, and stress-resistant superior soybean varieties. In agricultural production, there is a saying, "Wheat for a thousand miles, soybeans for a hundred miles," highlighting the crucial role of photoperiod response characteristics in influencing the regional adaptability of soybean varieties. Wide adaptability breeding of soybeans has always been a highly focused agronomic trait and a major issue urgently needing resolution in breeding work.

[0003] Plant architecture plays a decisive role in the morphogenesis of individual plants and crop populations, and is a crucial factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and ear type (pod-setting habit), and is not only an important agronomic trait but also a key factor determining crop yield. Plant architecture regulation is an effective way to improve varieties and increase yield. However, current research on the mechanism of soybean plant architecture regulation and key genes involved in soybean plant architecture regulation is still in the exploratory stage, with relatively few related research reports. Therefore, discovering and exploring more soybean plant architecture regulatory genes has significant theoretical value for breeding high-yielding, ideal soybean plant architectures; moreover, through the creation of specific materials, it has important practical application value for ultimately realizing breeding applications and increasing soybean yield. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate the flowering and plant height-related functions of plants.

[0005] To address the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by this invention may be any of the following:

[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 2;

[0008] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that has more than 80% identity with the protein shown in A1) and has functions related to regulating plant flowering and plant height; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 2 and conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 2 by substituting, deleting and / or adding one or more amino acids without affecting its activity.

[0009] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in a1) above is named GmMRF2.

[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GmMRF2 of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein GmMRF2 isolated in this invention, as long as they encode and function as protein GmMRF2, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0017] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The protein mentioned above is derived from soybeans (Glycine max).

[0020] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0021] B1) Nucleic acid molecules that encode the proteins described above;

[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

[0028] In the above-mentioned biological materials, the nucleic acid molecule described in B1) can be a gene as shown in C1) or C2) below:

[0029] C1) The coding sequence of the coding strand is the cDNA molecule or DNA molecule of SEQ ID No. 1;

[0030] C2) The nucleotides encoding the coding strand are the cDNA molecule or DNA molecule of SEQ ID No. 1.

[0031] The DNA molecule (GmMRF2 gene) shown in SEQ ID No. 1 encodes the protein GmMRF2, whose amino acid sequence is the same as that in SEQ ID No. 2.

[0032] The nucleotide sequence shown in SEQ ID NO.1 is the nucleotide sequence of the gene encoding protein GmMRF2 (CDS).

[0033] B1) The nucleic acid molecule may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 1.

[0034] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 1 and originate from the same species.

[0035] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0036] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector PTF101-GFP.

[0037] Recombinant expression vectors containing the GmMRF2 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0038] When constructing a recombinant plant expression vector using the GmMRF2 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0039] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0040] By using any vector capable of guiding the expression of exogenous genes in plants, the GmMRF2 gene or gene fragments provided in this invention can be introduced into plant cells or recipient plants, resulting in transgenic cell lines and transgenic plants with shortened flowering cycles and increased plant height. The expression vector carrying the GmMRF2 gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0041] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* EHA101 is an example.

[0042] The present invention also provides the protein GmMRF2 or substances that regulate the activity and / or content of the protein GmMRF2, and / or the biomaterial in any of the following applications:

[0043] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating the flowering and plant height-related functions of plants.

[0044] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant flowering and plant height-related functions.

[0045] The application of the protein or gene expression substance or substance regulating the activity or content of the protein described in U3) in cultivating plants with altered flowering and plant height-related functions.

[0046] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U4) in the preparation of products that cultivate plants with altered functions related to flowering and plant height.

[0047] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.

[0048] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmMRF2.

[0049] In the above applications, the substance regulating gene expression or the substance regulating the activity or content of the protein is a biological material related to the protein, and the biological material may be any one of B1) to B7) below:

[0050] B1) A nucleic acid molecule encoding the protein described in claim 1;

[0051] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0052] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0053] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0054] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0055] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0056] B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

[0057] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0058] This invention also provides a method for regulating plant flowering and plant height.

[0059] The present invention also provides a method for regulating plant flowering and plant height, including regulating the expression level of the gene encoding the protein GmMRF2 to regulate plant flowering and plant height.

[0060] In the above method, the regulation of the activity and / or content of the protein GmMRF2 in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding the protein GmMRF2 into the recipient seed plant to obtain the target plant with shortened flowering and maturation time and higher plant height than the recipient plant; the gene encoding the GmMRF2 encodes the protein GmMRF2.

[0061] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0062] In the above applications and methods, the gene encoding the protein GmMRF2 can be modified as follows before being introduced into the target plant to achieve better expression:

[0063] 1) Linked to promoters of various plant expression to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-selective, and tissue-specific promoters; the selection of promoters will vary with the time and space requirements of expression, and also depends on the target species; for example, tissue or organ-specific expression promoters, depending on the stage of development of the target receptor; although it has been shown that many promoters derived from dicotyledons are functional in monocotyledons and vice versa, ideally, dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters are selected for expression in monocotyledons;

[0064] 2) Linking with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked with the gene of the present invention.

[0065] 3) Introduce enhancer sequences, such as intron sequences (e.g., derived from Adhl and Bronzel) and viral leader sequences (e.g., derived from TMV, MCMV, and AMV).

[0066] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress. Plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants but also their progeny. For transgenic plants, the gene can be propagated within the species or transferred into other varieties of the same species using conventional breeding techniques, especially commercial varieties. The transgenic plants include seeds, callus tissue, intact plants, and cells.

[0067] In the above applications or methods, the plant may be any of the following:

[0068] C1) Dicotyledons or monocotyledons;

[0069] C2) Plants of the Rosales order;

[0070] C3) Leguminosae (family legumes);

[0071] C4) Plants of the genus *Glycine*;

[0072] C5) Soybeans.

[0073] The discovery of GmMRF2, a protein related to soybean flowering and plant height, provides important candidate genes and breeding methods for expanding the planting areas of soybean varieties. It offers guidance for precise regulation of soybean flowering time, holding significant theoretical importance for soybean breeding. Furthermore, it provides crucial gene research information and tools for the genetic improvement of soybean's adaptability. Precise control of soybean flowering time can effectively reduce the sensitivity of soybean to photoperiod, thereby expanding the suitable planting areas for soybean, which has positive implications for soybean breeding. Attached Figure Description

[0074] Figure 1 PCR and test strip detection were performed on soybean plants that were overexpressing GmMRF2.

[0075] Figure 2 Phenotypes of GmMRF2-overexpressing soybean plants and wild-type plants during flowering under long and short photoperiod treatments.

[0076] Figure 3 Phenotypic results of soybean plants overexpressing GmMRF2 and wild-type plants under long and short photoperiod treatments. Detailed Implementation

[0077] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0078] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0079] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0080] White-flowered cultivated soybean Jack is documented in the following literature: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. This information is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0081] The pTF101 vector is described in the following literature: Paz M, Shou H, Guo Z, Zhang Z, Banerjee A, et al. Assessment of conditions affecting Agrobacterium-mediated soybean transformation using the cotyledonary node explant. Euphaitica. 2004, 136: 167–179. It is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0082] Agrobacterium tumefaciens EHA101 is described in the following literature: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. It is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0083] MS Salt: Phyto Tech, Catalog No.: M524. MS Organic: Phyto Tech, Catalog No.: M533.

[0084] B5 Organic: Phytotech, catalog number: G219. B5 Salt: Phytotech, catalog number: G768.

[0085] YEP solid medium consists of a solute and a solvent; the solutes and their concentrations in YEP solid medium are: NaCl 5 g / L, yeast extract 5 g / L, tryptone 10 g / L, and agar 15 g / L; the solvent is water. The pH of YEP solid medium is 7.0.

[0086] Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 mL / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.

[0087] Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 mL / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0088] Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 mL / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0089] Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 mL / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 mL / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0090] Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 mL / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 mL / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0091] Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 mL / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 mL / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0092] Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 mL / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0093] Data were processed using SPSS statistical software. Experimental results are expressed as mean ± standard deviation. Student's test was used, with P < 0.05 (*) indicating a significant difference and P < 0.01 (**) indicating a highly significant difference.

[0094] The sequence list involved in the following embodiments is shown in Table 1.

[0095] Table 1. Sequences involved in this invention

[0096]

[0097] Example 1: A method for identifying transgenic soybean plants by flower color

[0098] I. Cloning of the GmMRF2 gene

[0099] RNA was extracted from the leaves of the cultivated soybean variety Jack and reverse transcribed to synthesize cDNA.

[0100] Using cDNA as a template, PCR amplification was performed using a new primer pair consisting of primers F and R, and the product size was approximately 400 bp.

[0101] F: 5′-ATGCATGGATTTGGGGTATAC-3′;

[0102] R: 5′-TCACACAATGGGAATTGGGATGCTC-3′.

[0103] Sequencing revealed that the PCR product was 402 bp, which is the coding region of the GmMRF2 gene. The coding sequence (CDS) of the GmMRF2 gene in the soybean variety Jack is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0104] II. Construction of GmMRF2 overexpression vector

[0105] 1. Using the PCR product obtained in step one above as a template, perform PCR amplification using a primer pair consisting of primer F-inf and primer R-inf, and recover approximately 400 bp of PCR amplification product.

[0106] F-inf:5′- GAGAACACGGGGGACTCTAGA ATGCATGGATTTGGGGTATAC-3′;

[0107] R-inf: 5′- CCCTTGCTCACCATTCTAGA CACAATGGGAATTGGGATGCTC-3′.

[0108] 2. The PTF101-GFP vector was digested with the restriction endonuclease XbaⅠ, and approximately 10,000 bp of the vector backbone was recovered. The PTF101-GFP vector was constructed by double digesting the PTF101 vector with restriction endonucleases XbaⅠ and SacⅠ, recovering approximately 10,000 bp of the vector backbone, and then ligating the GFP gene to the PTF101 vector backbone.

[0109] 3. The PCR product obtained in step 1 and the vector backbone obtained in step 2 are ligated and homologous recombination is performed to obtain the recombinant expression vector PTF-MRF2.

[0110] The recombinant expression vector PTF-MRF2 is obtained by inserting the GmMRF2 gene shown in sequence 1 of the sequence listing into the PTF101-GFP vector.

[0111] III. Construction of Recombinant Bacteria

[0112] The recombinant expression vector PTF-MRF2 was transformed into Agrobacterium tumefaciens EHA101, and the plasmid was extracted for sequencing verification. The recombinant strain that was correctly sequenced was named EHA101 / PTF101-MRF2.

[0113] IV. Agrobacterium-mediated transformation

[0114] The constructed EHA101 / PTF101-MRF2 was transformed into the soybean variety Jack using Agrobacterium-mediated transformation. The specific method is as follows:

[0115] 1. Seed sterilization

[0116] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.

[0117] 2) After completing step 1), place a 100mL beaker in the desiccator, pour 80mL of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4mL of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and let it stand for 12-16 hours for chlorine sterilization.

[0118] 2. Preparation of infecting bacterial solution

[0119] 1) Incubate Agrobacterium tumefaciens EHA101 / PTF101-MRF2 at 28℃, resuspend in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.

[0120] 2) Place the germinated seeds in a clean bench and, under a microscope, peel off the seed coat, separate the two cotyledons along the long axis, and keep the cotyledon with the complete hypocotyl. Make 3-5 cuts at the junction of the hypocotyl and cotyledon. Then, immerse the seeds in a 28°C incubator for 2 hours.

[0121] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.

[0122] 4) After co-culturing for 5 days, the hypocotyl of the explants elongated to 1-2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16h light / 8h dark conditions for 7 days.

[0123] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.

[0124] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.

[0125] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / L IBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybean plants.

[0126] T0 generation GmMRF2 soybeans were sown, and seeds of T1 generation GmMRF2 soybeans were harvested to cultivate T1 generation GmMRF2 soybeans. T1 generation GmMRF2 soybeans were then self-pollinated to harvest seeds of T2 generation GmMRF2 soybeans to cultivate T2 generation GmMRF2 soybeans.

[0127] V. Identification of Transgenic Plants

[0128] 1. PCR identification

[0129] Leaf DNA was extracted from T1 generation transformed soybean plants. Based on the transformation vector, amplification primers were designed: F-JC: 5'-CACGGGGGACTCTAGAATGCATGGATTTGGGGTATA-3' and R-JC: 5'-TGCTCACCATTCTAGACACACAATGGGAATTGGGATG-3'. The Actin gene was used as a control.

[0130] Depend on Figure 1 As shown in Figure A, the GmMRF2-transformed soybean positive plants OE-1, OE-2, and OE-3 can amplify bands, while wild-type plants (WT) cannot amplify bands.

[0131] 2. Test strip identification

[0132] Leaves were cut from the transformed soybean plants and placed in a 1.5 mL centrifuge tube containing 200 μL of sterile water. The leaves were then homogenized. A PAT test strip (Artron, catalog number A07-13-413) (the selection gene on the vector used for transformation is the bar gene) was placed in the tube, and the number of bands appearing on the test strip was recorded within 15 minutes. Two bands indicate a positive transformation plant, and one band indicates a negative transformation plant.

[0133] Depend on Figure 1 As shown in Figure B, the positively transformed plants OE-1, OE-2, and OE-3 showed two bands, while the wild-type plant (WT) showed only one band.

[0134] VI. Identification of Flowering Period

[0135] T2 generation plants GmMRF2-OE15, GmMRF2-OE23, and GmMRF2-OE27 overexpressing GmMRF2 and wild-type plants WT were subjected to short-day (12h light / 12h dark) and long-day (16h light / 8h dark) photoperiod treatments, and flowering dates were recorded.

[0136] The results are as follows Figure 2As shown: Under long-day (LD) conditions, the flowering times of the three transgenic lines overexpressing GmMRF2 were 39.2, 39.0, and 39.5 days, respectively; the flowering time of the wild-type plants was 43.3 days. The T2 generation plants overexpressing GmMRF2 flowered 3-4 days earlier than the control. Under short-day (SD) conditions, the flowering times of the three transgenic lines overexpressing GmMRF2 were 22.8, 22.6, and 23.0 days, respectively, while the flowering time of the wild-type plants was 23.2 days. Under short-day conditions, there was no significant difference in flowering time.

[0137] VII. Plant Height Identification

[0138] Plant height was recorded in T2 generation plants (GmMRF2-OE15, GmMRF2-OE23, and GmMRF2-OE27) overexpressing GmMRF2 and in wild-type WT plants. Under short-day conditions, plant height was recorded at 25 and 70 days. Under long-day conditions, plant height was recorded at 40 and 150 days.

[0139] The results are as follows Figure 3 As shown: Under short-day conditions ( Figure 3 (Left image) At 25 days, the plant heights of the three GmMRF2 overexpressing lines were 116.9 cm, 115.8 cm, and 113.4 cm, respectively, while the wild-type plant height was 90.9 cm. The overexpressing GmMRF2 plants were significantly taller than the wild-type plants. At 70 days, the plant heights of the three GmMRF2 overexpressing lines were 168.8 cm, 170.8 cm, and 171.6 cm, respectively, while the wild-type plant height was 155.4 cm. Under long-day conditions (… Figure 3 (Right figure in the middle) At 40 days, the plant heights of the three GmMRF2 overexpressing lines were 148.1 cm, 147.6 cm, and 147.8 cm, respectively, while the wild-type plant height was 113.4 cm. At 150 days, the plant heights of the three GmMRF2 overexpressing lines were 251.1 cm, 249.4 cm, and 249.2 cm, respectively, while the wild-type plant height was 227.7 cm. Under long-day conditions, the plant heights of the GmMRF2 overexpressing lines were also significantly higher than those of the wild-type.

[0140] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application, characterized in that: The application is any one of the following: U1) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in shortening the flowering time of plants and increasing plant height. U2) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in the preparation of products that shorten plant flowering time and increase plant height; U3) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in the cultivation of plants with shortened flowering time and increased plant height. U4) The application of proteins or substances that regulate gene expression or substances that regulate the activity or content of said proteins in the preparation of products that cultivate plants with shortened flowering time and increased plant height. The protein is any of the following: A1) Proteins with amino acid sequences as shown in SEQ ID No. 2; A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1); The substance regulating gene expression or the substance regulating protein activity or content is a biological material related to the protein, and the biological material is any one of B1) to B7) below: B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); The flowering time mentioned refers to the flowering time under long-day conditions; The plant in question is soybean.

2. The application according to claim 1, characterized in that: B1) The nucleic acid molecule described is a cDNA molecule whose coding sequence is SEQ ID No.

1.

3. A method for regulating plant flowering and plant height, characterized in that: This includes regulating the activity and / or content of proteins in the target plant and / or the expression level of the genes encoding said proteins, in order to regulate the flowering time and plant height of the plant; The regulation of the activity and / or content of proteins in the target plant and / or the expression level of the protein-coding gene includes introducing the protein-coding gene into the recipient plant to obtain a target plant with shortened flowering and maturation time under long-day conditions and a plant height higher than that of the recipient plant. The protein is any of the following: A1) Proteins with amino acid sequences as shown in SEQ ID No. 2; A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1); The plant in question is soybean.

Images