Crept mutants and their use in inhibiting tumor growth

CN116003566BActive Publication Date: 2026-09-18TSINGHUA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210971835.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-12
Publication Date
2026-09-18
Estimated Expiration
2042-08-12

AI Technical Summary

Technical Problem

[0004]然而,CREPT具体如何参与细胞周期的调控作用尚不清楚

Benefits of technology

[0014] In a fifth aspect of the invention, a method is provided for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein, wherein the inhibitor maintains the S134 site of the CREPT protein in a persistently non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID No:4, and the method comprises: S1) treating eukaryotic cells expressing the CREPT protein with the substance to be identified; S2) performing immunoprecipitation with an antiphosphorylation antibody to examine the phosphorylation level of the S134 site of the CREPT protein in the cells treated in step S1; if the phosphorylation level of the S134 site of the CREPT protein in the cells treated with the substance decreases, for example, by more than 10%, more than 20%, more than 30%, or more than 40%, compared with the phosphorylation level of the S134 site of the CREPT protein in control cells not treated with the substance, then the substance is identified as a phosphorylation inhibitor of the S134 site of the CREPT protein; otherwise, the substance is identified as not a phosphorylation inhibitor of the S134 site of the CREPT protein. In one embodiment, prior to step S1, the method includes: designing the substance to be identified using the prediction tools SwissTargetPrediction and SEA targeting CREPT. In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cells under phosphorylation-allowing conditions. In one embodiment, step S2 includes performing immunoprecipitation with an anti-CREPT antibody that recognizes the CREPT protein and an anti-phosphorylation antibody that recognizes phosphorylation at site 134 of the CREPT protein, thereby quantifying the phosphorylation level at site 134 of the CREPT protein. In one embodiment, the phosphorylation level is a relative value of the amount of protein phosphorylated at site 134 to the total amount of CREPT protein.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to a CREPT mutant and its use in inhibiting tumor growth. Specifically, the present application relates to a protein obtained by replacing the 134th residue of SEQ ID NO: 4 with a non-phosphorylatable residue, a nucleic acid encoding the protein, a vector and a cell comprising the nucleic acid, and use of the protein, the nucleic acid or the vector in preparing an agent for inhibiting proliferation and / or migration of eukaryotic cells and an anticancer drug. The present application also relates to a method for treating cancer and a method for identifying whether a substance is a phosphorylation inhibitor of the S134 site of a CREPT protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically, to the S134A mutant of the CREPT protein and its application in inhibiting tumor growth. Background Technology

[0002] The transition between different phases of the cell cycle is the result of regulation by multiple proteins, among which the most important regulatory proteins are CDKs (cyclin-dependent kinases), a class of serine / threonine protein kinases that are in different active states at different stages of cell division. When these kinases are activated, they can phosphorylate downstream substrates to regulate the cell cycle. Different stages of cell division require different levels of cyclin expression. The formation of the Cyclin D1 / 2 / 3 and CDK4 / 6 complex is essential for cells to enter the G1 phase. The formation of the Cyclin E and CDK2 complex determines whether cells can enter the S phase through the G1 phase. The binding of Cyclin A to CDK2 is essential for cells to be in the S phase. At the end of the G2 phase and the beginning of the M phase, the binding of Cyclin A to CDK1 is essential for promoting the completion of the G2-M phase transition. After cells enter the M phase, the binding of Cyclin B1 to CDK1 is also essential. In the late M phase, the degradation of Cyclin B1 is essential for cells to leave the M phase and enter the next G1 phase.

[0003] Cell cycle is closely related to tumorigenesis. Researchers have discovered a novel tumor-related gene, CREPT (cell-cycle related and expression-elevated protein intumor, patent number ZL200510135513.4), in their search for tumor-related genes. This gene can bind to the cyclin D1 gene, a key enzyme in transcription—RNA polymerase II—and cause the Cyclin D1 gene to form a loop structure. This loop structure may promote gene transcription. CREPT is a positive regulator of the cell cycle, present and highly conserved in various eukaryotes (e.g., humans, yeast, mice, chickens, toads, zebrafish, fruit flies, nematodes, or Arabidopsis thaliana); moreover, researchers have confirmed that CREPT protein is highly expressed in various tumor cells and tumor tissues (Li et al., 2021; Lu et al., 2012).

[0004] However, the specific role of CREPT in cell cycle regulation remains unclear. Summary of the Invention

[0005] The inventors discovered that the phosphorylation state of residue 134 of the human CREPT protein plays a very important role in cell growth and cell cycle regulation. Furthermore, they found that the S134A mutant of the CREPT protein is non-phosphorylated, which can inhibit eukaryotic cell proliferation and migration, inhibit tumor growth and metastasis, and induce cancer cell death, thus completing this invention.

[0006] In a first aspect of the invention, a protein is provided by replacing residue 134 of the amino acid sequence (SEQ ID NO:4) of wild-type human CREPT with a non-phosphorylated residue. In one embodiment, the non-phosphorylated residue is alanine or glutamine. In one embodiment, the amino acid sequence of the protein is SEQ ID NO:2 (hereinafter referred to as "CREPT S134A"). In one embodiment, the protein is obtained by replacing serine at position 134 of human CREPT with alanine.

[0007] The present invention also provides a protein having more than 75% sequence identity with any of the above-mentioned proteins, and wherein the residue at the position corresponding to the 134th position of SEQ ID NO:4 is the non-phosphorylated residue.

[0008] The present invention also provides a protein having a tag sequence or guide sequence attached to the N-terminus and / or C-terminus of the protein described in any of the above embodiments.

[0009] The present invention also provides a nucleic acid encoding any of the proteins described above. In one embodiment, the sequence of the nucleic acid is SEQ ID NO:1.

[0010] The present invention also provides a vector containing the nucleic acid and a cell containing the vector.

[0011] In a second aspect of the invention, the use of the aforementioned protein, nucleic acid, or carrier in the preparation of reagents that inhibit the proliferation and / or migration of eukaryotic cells is provided. In one embodiment, the eukaryotic cells are cells of humans, yeast, mice, chickens, toads, zebrafish, fruit flies, nematodes, or Arabidopsis thaliana, preferably human cells, and more preferably human cancer cells.

[0012] In a third aspect of the invention, the use of the aforementioned protein, nucleic acid, or carrier in the preparation of an anticancer drug is provided. In one embodiment, the anticancer drug includes a drug that inhibits the proliferation of cancer cells, a drug that inhibits the metastasis of cancer cells, or a drug that kills cancer cells. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, stomach cancer, or colorectal cancer (e.g., colon cancer). In one embodiment, the anticancer drug further includes small molecule anticancer agents and / or antibody anticancer agents.

[0013] In a fourth aspect of the invention, a method for treating cancer is provided, the method comprising administering an effective amount of the aforementioned protein, nucleic acid, or vector to a subject; or, the method comprising editing the CRPET gene in the genome of a subject's cancer cells using CRISPR / Cas9-based gene editing technology to cause the cancer cells to express any of the aforementioned proteins. In one embodiment, the subject is a mammal, preferably a human. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer. In one embodiment, the method further comprises administering a small molecule anticancer agent and / or an antibody anticancer agent to the subject. In one embodiment, the method further comprises subjecting the subject to radiotherapy and / or chemotherapy. In one embodiment, the method further comprises reducing or eliminating the expression of wild-type CREPT in the subject's cancer cells before, during, or after administering an effective amount of the protein, nucleic acid, or vector to the subject.

[0014] In a fifth aspect of the invention, a method is provided for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein, wherein the inhibitor maintains the S134 site of the CREPT protein in a persistently non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID No:4, and the method comprises: S1) treating eukaryotic cells expressing the CREPT protein with the substance to be identified; S2) performing immunoprecipitation with an antiphosphorylation antibody to examine the phosphorylation level of the S134 site of the CREPT protein in the cells treated in step S1; if the phosphorylation level of the S134 site of the CREPT protein in the cells treated with the substance decreases, for example, by more than 10%, more than 20%, more than 30%, or more than 40%, compared with the phosphorylation level of the S134 site of the CREPT protein in control cells not treated with the substance, then the substance is identified as a phosphorylation inhibitor of the S134 site of the CREPT protein; otherwise, the substance is identified as not a phosphorylation inhibitor of the S134 site of the CREPT protein. In one embodiment, prior to step S1, the method includes: designing the substance to be identified using the prediction tools SwissTargetPrediction and SEA targeting CREPT. In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cells under phosphorylation-allowing conditions. In one embodiment, step S2 includes performing immunoprecipitation with an anti-CREPT antibody that recognizes the CREPT protein and an anti-phosphorylation antibody that recognizes phosphorylation at site 134 of the CREPT protein, thereby quantifying the phosphorylation level at site 134 of the CREPT protein. In one embodiment, the phosphorylation level is a relative value of the amount of protein phosphorylated at site 134 to the total amount of CREPT protein. Attached Figure Description

[0015] Specific embodiments of the present invention will now be described with reference to the accompanying drawings, but neither the drawings nor the following detailed description should be construed as limiting the scope of the invention. In the drawings:

[0016] Figure 1 The effect of CREPT S134A on tumor cell growth. Figure 1 A and C are cell migration experiments. Figure 1 B and D are clonogenic assays. MOCK is a normal cell blank control; CREPT(WT) is a cell line that stably expresses wild-type CREPT; CREPT(S134A) is a cell line that stably expresses CREPT S134A protein.

[0017] Figure 2 The study investigated the effect of CREPT S134A on lung metastases in melanoma. MOCK was a normal cell control; CREPT(WT) was a cell line stably expressing wild-type CREPT; and CREPT(S134A) was a cell line stably expressing CREPT S134A protein.

[0018] Figure 3 This study investigated the effect of transfecting wild-type CREPT into B16 cell lines with the CREPT gene knocked out on lung metastasis in mice. CREPT(KO) was a control line transfected with the pcDNA3.1-HA empty vector in B16 cells with the CREPT gene knocked out; KO-CREPT(WT) was a cell line transfected with the pcDNA3.1-HA-CREPT plasmid in B16 cells with the CREPT gene knocked out to stably express wild-type CREPT; and KO-CREPT(S134E) was a cell line transfected with the pcDNA3.1-HA-CREPT(S134E) plasmid in B16 cells with the CREPT gene knocked out to stably express the CREPT S134E mutant protein.

[0019] Figure 4 This study investigated the effect of transfecting wild-type CREPT into DLD1 cell lines with the CREPT gene knocked out on tumor cell growth. CREPT(KO) was a control line in which the pcDNA3.1-HA empty vector was transfected into DLD1 cells with the CREPT gene knocked out; KO-CREPT(WT) was a cell line in which the pcDNA3.1-HA-CREPT plasmid was transfected into DLD1 cells with the CREPT gene knocked out to stably express wild-type CREPT; and KO-CREPT(S134E) was a cell line in which the pcDNA3.1-HA-CREPT(S134E) plasmid was transfected into DLD1 cells with the CREPT gene knocked out to stably express the CREPT S134E mutant protein.

[0020] Figure 5 This is the screening result for CREPT phosphorylation inhibitors. The numbers #1 to #5 at the top indicate that the cells were treated with candidate compounds #1 to #5, and the numbers in the middle (0 to 1.1) are the relative phosphorylation levels of each sample relative to the background.

[0021] Figure 6 The effects of CREPT phosphorylation inhibitor candidate compounds #1 to #5 on the proliferation of DLD1 cells (A) and MGC803 cells (B) were shown. Detailed Implementation

[0022] definition

[0023] As used herein, the terms “human CREPT protein” or “CREPT protein” or “human CREPT” refer to human wild-type CREPT protein, whose amino acid sequence is shown in SEQ ID NO:4, unless otherwise specified.

[0024] As used in this article, the term "CREPT protein mutant" or "CREPT variant" refers to a protein variant obtained by mutating amino acids from the wild-type CREPT protein.

[0025] The term “non-phosphorylated residue” as used in this article refers to protein residues that remain in a non-phosphorylated state in eukaryotic cells and cannot be phosphorylated by kinase systems in eukaryotic cells.

[0026] The following will describe in detail the specific embodiments of the present invention.

[0027] Phosphorylation at specific sites on proteins (typically serine, threonine, or tyrosine) is known in the art to be a key step in cell signaling, and the essence of phosphorylation signaling lies in the charge state of the corresponding residues. Therefore, by simulating the phosphorylation state of the corresponding sites (i.e., carrying a negative charge), the effect of phosphorylation can often be achieved. The simulation of phosphorylation / non-phosphorylation states is usually achieved by amino acid mutations or chemical modifications. For example, persistent activating mutations (i.e., mutations that simulate phosphorylation states) include mutating residues to aspartic acid (D) or glutamic acid (E), because these two amino acids are the only two negatively charged amino acids; while persistent repressive mutations (i.e., mutations that simulate non-phosphorylation states) most commonly mutate serine to alanine (A), because alanine carries a positive charge and can persistently inhibit the activity of this residue site; in other cases, repressive mutations can also be mutations to glutamine (Q) or phenylalanine (F). On the other hand, activating chemical modifiers (i.e., chemical modifiers that mimic phosphorylation) can include phosphate donors such as acetyl phosphate, phosphoramide salts, carbamoyl phosphate, and sodium pyrophosphate, as well as beryllium trifluoride. Furthermore, some CDK4 / 6-specific small molecule inhibitors, such as palbociclib, ribociclib, or abemaciclib, can also achieve the effect of keeping proteins non-phosphorylated (Maiani et al., 2021; Simoneschi et al., 2021).

[0028] Sequence analysis of CREPT revealed that multiple amino acid sites on the CREPT protein are serine residues, suggesting that the regulatory role of CREPT in tumorigenesis may be related to the phosphorylation of these serine residues. Using an online phosphorylation site analysis tool (http: / / kinasephos.mbc.nctu.edu.tw / predict.php), the inventors predicted the phosphorylation sites of the CREPT protein, finding that site S134 is a potential phosphorylation site, and its corresponding protein kinase belongs to the CDK family.

[0029] The inventors mutated the serine residue at position 134 of the CREPT protein to alanine, obtaining the S134A mutation to mimic the non-phosphorylation state at that site. The results showed that, compared to the control, the S134A mutation in the CREPT protein inhibited the proliferation and migration of mouse embryonic fibroblasts. Figure 1 It can effectively inhibit the metastasis of mouse tumor cells. Figure 2 It can also cause tumor cell death in mice. Figure 3 ).

[0030] In view of this, the present invention provides a protein obtained by replacing residue 134 of the amino acid sequence (SEQ ID NO:4) of human CREPT with a non-phosphorylated residue. In one embodiment, the non-phosphorylated residue is alanine or glutamine. In one embodiment, the amino acid sequence of the protein is SEQ ID NO:2. In a preferred embodiment, the protein is obtained by replacing serine at position 134 of human CREPT with alanine; this means that, except for the amino acid at position 134, the protein retains the post-translational modifications of human CREPT.

[0031] The present invention also provides a protein having 75% or more, 80% or more, 90% or more, preferably 95% or more, more preferably 98% or more, or 99% or more sequence identity with any of the above-mentioned proteins, and wherein the residue at the site corresponding to the 134th position of SEQ ID NO:4 is the non-phosphorylated residue.

[0032] The present invention also provides proteins with a tag sequence or guide sequence attached to the N-terminus and / or C-terminus of the aforementioned proteins. In one embodiment, the protein is a fusion protein. In one embodiment, the tag sequence may be, for example, a purification tag, a fluorescent tag, a solubilization tag, an affinity tag, or an antigenic epitope tag. In one embodiment, the guide sequence may be a polypeptide sequence that guides the protein across the cell membrane into the cell, including, for example, cell-penetrating peptides not based on endocytosis, and peptide or protein sequences that are readily accessible to the cell via endocytosis.

[0033] The present invention also provides a nucleic acid encoding the above-mentioned protein. In one embodiment, the sequence of the nucleic acid is SEQ ID NO:1, but the present invention is not limited thereto. Those skilled in the art will know that the sequence of the nucleic acid can be optimized for different expression environments according to codon degeneracy rules.

[0034] The present invention also provides a vector containing the nucleic acid. In one embodiment, the vector may be a plasmid or a viral vector.

[0035] The present invention also provides cells comprising the carrier. In one embodiment, the cells are capable of stably expressing the aforementioned protein.

[0036] Methods for introducing a target protein (e.g., CREPT S134A of the present invention) into target cells (e.g., cancer cells) may include introducing a vector expressing the target protein into the target cells via transfection, infection, or other means, or may employ chemically modified mRNA (modRNA) to achieve expression of the target protein in the target cells. Furthermore, the target protein may be directly introduced into cells using, for example, the guide sequence described above. However, the present invention is not limited thereto. For example, precise gene editing technologies (e.g., prime editors) may be used to directly mutate target sites in the tumor genome (Anzalone, et al., 2019), for example, by mutating the corresponding bases of the CREPT genome to induce cell expression of CREPT S134A.

[0037] The present invention also provides the use of the above-mentioned proteins, nucleic acids, or carriers in the preparation of reagents that inhibit the proliferation and / or migration of eukaryotic cells. In one embodiment, the eukaryotic cells are cells of humans, yeast, mice, chickens, toads, zebrafish, fruit flies, nematodes, or Arabidopsis thaliana, preferably human cells, and more preferably human cancer cells.

[0038] This invention also provides the use of the above-mentioned proteins, nucleic acids, or carriers in the preparation of anticancer drugs. In one embodiment, the anticancer drug includes drugs that inhibit cancer cell proliferation, drugs that inhibit cancer cell metastasis, and / or drugs that kill cancer cells. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer. In one embodiment, the anticancer drug further includes other small molecule anticancer agents and / or antibody anticancer agents. These small molecule anticancer agents and / or antibody anticancer agents may be known in the art.

[0039] The present invention also provides a method for treating cancer, the method comprising administering an effective amount of the aforementioned protein, nucleic acid, or vector to a subject; or, the method comprising editing the CRPET gene in the genome of cancer cells of a subject using CRISPR / Cas9-based gene editing technology to cause the cancer cells to express any of the aforementioned proteins. In one embodiment, the subject is a mammal, preferably a human. In one embodiment, the method further comprises administering a small molecule anticancer agent and / or an antibody anticancer agent to the subject. These small molecule anticancer agents and / or antibody anticancer agents may be known in the art. In one embodiment, the method further comprises subjecting the subject to radiotherapy and / or chemotherapy. In one embodiment, the method further comprises: reducing or eliminating the expression of wild-type CREPT in target cancer cells before, during, or after administering an effective amount of the aforementioned protein, nucleic acid, or vector to the subject, for example by knocking out or downgrading wild-type CREPT in target cancer cells using siRNA or gene editing technology.

[0040] Furthermore, this invention also relates to a method for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein, wherein the inhibitor maintains the S134 site of the CREPT protein in a persistently non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID. No. 4, the method includes: S1) treating eukaryotic cells expressing CREPT protein with a substance to be identified; S2) performing immunoprecipitation with an antiphosphorylation antibody to examine the phosphorylation level of the S134 site of CREPT protein in the treated cells in step S1; wherein, compared with the phosphorylation level of the S134 site of CREPT protein in control cells not treated with the substance, if the phosphorylation level of the S134 site of CREPT protein in the cells treated with the substance decreases, for example, by more than 10%, more than 20%, more than 30%, or more than 40%, more preferably by more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more than 95%, then the substance is identified as a phosphorylation inhibitor of the S134 site of CREPT protein; otherwise, the substance is identified as not a phosphorylation inhibitor of the S134 site of CREPT protein.

[0041] In one embodiment, prior to step S1, the method includes designing the substance to be identified using the prediction tools SwissTargetPrediction and SEA against CREPT. The substance can then be synthesized artificially.

[0042] In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cells under phosphorylation-permissible conditions. These "phosphorylation-permissible conditions" include, but are not limited to, the presence of a kinase system sufficient to phosphorylate CREPT S134 at suitable ambient temperature, pH, and ionic strength, such that CREPT S134 can be phosphorylated in the absence of phosphorylation inhibitors or kinase inhibitors (e.g., in the normal eukaryotic intracellular environment).

[0043] In one embodiment, step S2 includes performing immunoprecipitation using an anti-CREPT antibody that recognizes the CREPT protein and an anti-phosphorylation antibody that recognizes phosphorylation at site S134 of the CREPT protein, thereby quantifying the phosphorylation level at site S134 of the CREPT protein. Specifically, the CREPT protein can be precipitated using an anti-CREPT antibody, and the total amount of CREPT protein can be measured as a background level. For the protein precipitated with the anti-CREPT antibody, the phosphorylated protein is detected and quantified using an anti-phosphorylation antibody that specifically recognizes phosphorylation at site S134 of the CREPT protein. In this case, the phosphorylation level can be the ratio of the amount of phosphorylated protein to the background amount of CREPT protein.

[0044] In one embodiment, the eukaryotic cell expressing the CREPT protein is a cell containing a kinase system that phosphorylates the S134 of wild-type CREPT, such as cells of humans, yeast, mice, chickens, toads, zebrafish, fruit flies, nematodes, or Arabidopsis thaliana that are capable of naturally expressing the CREPT protein, or cells that have been genetically modified to express or overexpress a kinase system with the same function.

[0045] This invention also relates to the following compounds:

[0046]

[0047] The use of the above-mentioned compounds in the preparation of phosphorylation inhibitors at the CREPT 134 site and in the preparation of medicaments for treating cancer is also described. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer. In one embodiment, the hydroxyl group (-OH) in compound #3 can be replaced with other leaving groups, such as halogens, -OCOR, -OTs, -ONO2, etc., where R can be C. 1-6 Alkyl or C 1-4 alkyl.

[0048] Sequence description:

[0049] SEQ ID NO:1 encodes the nucleic acid sequence of the CREPT S134A mutant protein;

[0050] The amino acid sequence of the SEQ ID NO:2CREPT S134A mutant protein;

[0051] The coding nucleic acid sequence of SEQ ID NO:3 wild-type CREPT;

[0052] The amino acid sequence of wild-type CREPT (SEQ ID NO:4).

[0053] Example

[0054] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available or can be prepared by conventional methods unless otherwise specified; all quantitative experiments were performed in triplicate and the results were averaged.

[0055] Example 1. CREPT Obtaining the S134A mutant protein and its encoding gene

[0056] 1. Selection of mutation sites

[0057] Based on tool predictions and the interaction between the cell cycle regulator protein CREPT and cyclin kinase CDK6, the inventors selected a conserved sequence site that matches the downstream substrate phosphorylation of CDK6 as the mutation site. The mutation site selected in this invention is amino acid 134 of the cell cycle regulator protein CREPT.

[0058] 2. Design of site-directed mutagenesis primers

[0059] Site-directed mutagenesis primers were designed based on the mutation sites. The designed site-directed mutagenesis primer sequences are as follows:

[0060] Forward primer: GCCCCTCCCCCCAAAGCAACA;

[0061] Reverse primer: CTTGGAGTCCTCCATAGACAG.

[0062] 3. PCR amplification

[0063] Using the pcDNA3.1-HA-CREPT(WT) plasmid as a template, PCR amplification was performed using the primers designed in step 2 to obtain the PCR amplification product.

[0064] 4. Sequencing

[0065] The PCR product obtained in step 3 was sequenced. Sequencing results showed that the nucleotide sequence shown in SEQ ID NO:1 was obtained by PCR amplification. The gene shown in SEQ ID NO:1 was named the CREPT S134A gene. The amino acid sequence of the protein encoded by the CREPT S134A gene is shown in SEQ ID NO:2. The protein shown in SEQ ID NO:2 was named the CREPT S134A protein.

[0066] The CREPT S134A protein is obtained by mutating serine (Ser) at position 134 of the cell cycle regulator CREPT to alanine (Ala), while keeping the other sequences of the CREPT protein unchanged. The CREPT S134A gene is obtained by mutating the codon AGC encoding serine at position 134 of the CREPT protein to GCC encoding alanine, while keeping the other sequences of the CREPT protein coding gene unchanged. The amino acid sequence of wild-type CREPT is shown in SEQ ID NO:4, and its coding sequence is shown in SEQ ID NO:3.

[0067] Example 2. CREPT Preparation of S134A mutant

[0068] 1. Construction of recombinant plasmids

[0069] The small fragment between the kpnI and EcoRV restriction sites in the pcDNA3.1-HA plasmid (purchased from Clontech) was replaced with the CREPT S134A gene shown in SEQ ID NO:1 to obtain the pcDNA3.1-HA-CREPT(S134A) expression plasmid S134A.

[0070] The small fragment between the kpnI and EcoRV restriction sites in the pcDNA3.1-HA plasmid was replaced with the CREPT gene shown in SEQ ID NO:3 to obtain the pcDNA3.1-HA-CREPT expression plasmid WT.

[0071] 2. Packaging of recombinant plasmids

[0072] The pcDNA3.1-HA-CREPT(S134A) expression plasmid S134A and the pcDNA3.1-HA-CREPT expression plasmid WT were packaged separately to obtain supernatants containing lentiviral particles pcDNA3.1-HA-CREPT(S134A) and pcDNA3.1-HA-CREPT, respectively. The specific steps are as follows (taking one well of a six-well plate as an example):

[0073] 1) One day before transfection, seed an appropriate amount of HEK293T cells (ATCC, CRL-3216) until the cell density is 60-80% at the time of transfection.

[0074] 2) Take 5 μg of plasmid (the packaging virus is a 3-plasmid system, pMD2G: PSApX2: target plasmid = 1:1.5:2.5) and add it to 100 μL of 0.9% NaCl, and mix by pipetting.

[0075] 3) Take 2 μL of Vigofect transfection reagent, add it to 100 μL of 0.9% NaCl, mix gently, and let stand at room temperature for 5 min.

[0076] 4) Add the plasmid diluted in step 2) to the transfection reagent diluted in step 3), gently mix by pipetting, and let stand at room temperature for 15 minutes.

[0077] 5) Add the transfection working solution dropwise to the cell culture medium, gently mix the medium, and place it in a cell culture incubator.

[0078] 6) Replace with 2 mL of fresh culture medium after 4-6 hours.

[0079] 7) Replace with fresh culture medium after 24 hours, and collect the supernatant containing the virus after 72 hours.

[0080] 3. Infection of target cells

[0081] Supernatants containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT (WT) were added to mouse melanoma cells B16 (ATCC, CRL-6475), respectively, to obtain the following mutants: a B16 cell line stably expressing CREPTS134A protein and a B16 cell line stably expressing wild-type CREPT protein. The specific steps are as follows:

[0082] (1) B16 cells were seeded into six-well cell culture plates and cultured at 37°C and 5% CO2. The culture medium was RPMI 1640 (Gibco, 11875093).

[0083] (2) When the density reaches 30-50% on the second day of culture, lentivirus transfection is performed. Four wells out of five are selected as the experimental group, and the remaining well is selected as the control group.

[0084] Experimental group: Aspirate 1 mL of culture medium, add 1 mL of virus supernatant and 2 μL of polybrene (Sigma-Aldrich, 107689) to each well, so that the final concentration of polybrene in the system is 5 ng / μL. Gently mix by drawing an "8" on the work surface.

[0085] Control group: Remove 1 mL of culture medium and add 1 mL of complete culture medium to each well.

[0086] (3) 24 hours after transfection, the cells were transferred to a 100 mm culture dish. 24 hours later, the appropriate antibiotic (neomycin 1 mg / ml) was added and cultured for 7-10 days. Clones were picked up with pipette tips and transferred to 24-well plates. Positive clones were detected after further culture.

[0087] Following the above method, the supernatant containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT (WT) was added to the mouse embryonic fibroblast cell line NIH3T3 (ATCC, CRL-1658) and the mouse melanoma cell line B16 (ATCC, CRL-6322), respectively, to obtain the following mutants: NIH3T3 and B16 cell lines stably expressing CREPT S134A, and NIH3T3 and B16 cell lines stably expressing wild-type CREPT.

[0088] Example 3. CREPT Effects of S134A mutant on cell migration ability

[0089] 1) Using a ruler and marker, draw evenly spaced horizontal lines on the back of the 6-hole board, approximately every 0.5-1 cm, passing through each hole. Each hole should have at least 5 lines. Add approximately 5 x 10 mm of filler. 5The NIH3T3 or B16 cell lines are: NIH3T3 or B16 cell lines that stably express CREPT S134A, NIH3T3 or B16 cell lines that stably express wild-type CREPT, and NIH3T3 or B16 cell lines that stably express pcDNA3.1-HA.

[0090] 2) After culturing overnight, use a pipette tip to align with a ruler, making sure it is as perpendicular as possible to the horizontal line on the back of the cell. Keep the pipette tip vertical and not tilted. Wash the cells three times with PBS to remove any cells that float to the surface after culturing, and then add serum-free culture medium.

[0091] 3) Incubate at 37℃ with 5% CO2. Take samples and photographs at 0 and 24 hours after incubation.

[0092] The results are as follows Figure 1 As shown in A and C. The results indicate that the mutation of alanine at position 134 of the CREPT protein inhibits cell migration.

[0093] Example 4. CREPT Effects of S134A mutant on cell proliferation

[0094] 1) Take cells in the logarithmic growth phase (NIH3T3 or B16 cell lines), digest them with 0.25% trypsin and gently pipette to make them into single cells, perform viable cell counting, and adjust the cell density to 1×10⁶ cells using DMEM culture medium containing 20% ​​fetal bovine serum. 6 Cells / L. Then plate the cells according to the experimental requirements.

[0095] 2) Mix 4 mL of culture medium and 4 mL of cell diluent at a 1:1 ratio, then add 2 mL of the mixture to each well of a six-well plate, for a total of 3 replicate wells. Incubate at 37°C in a 5% CO2 incubator for 7–14 days.

[0096] 3) When the clones are of appropriate size, discard the cell clone supernatant, add 0.1% crystal violet solution to stain for 30 minutes, and then wash off the excess stain with running water.

[0097] 4) Place the petri dish on the scanner and observe the number of cell clones.

[0098] The results are as follows Figure 1 As shown in B and D. The results indicate that the mutation of alanine at position 134 of the CREPT protein inhibited the formation of cell clones.

[0099] The above results indicate that the CREPT S134A protein has the function of inhibiting cell migration and proliferation, and the serine site at position 134 of CREPT is crucial for CREPT to maintain its function of promoting colony formation.

[0100] Example 5. CREPT The effect of S134A mutant on tumor cell metastasis ability

[0101] The effect of the CREPT S134A mutant on the metastatic ability of cancer cells was detected using a lung metastasis assay in C57BL / 6J mice. The specific steps were as follows: C57BL / 6J mice (purchased from Vital Rivers, B6J JAX Lab) were injected via tail vein with three cell lines: B16 cell line stably expressing pcDNA3.1-HA (MOCK), B16 cell line stably expressing wild-type CREPT (CREPT-WT), and B16 cell line stably expressing CREPT S134A protein (CREPT-S134A). The injection dose was 1 × 10⁻⁶. 5 Cells / 200μL / mouse. Mice were sacrificed 21 days after inoculation, and their lungs were removed to observe the occurrence of lung tumors.

[0102] The results are as follows Figure 2 As shown in the figure, the MOCK group cells induced lung tumors in mice. When mice were inoculated with the B16 cell line CREPT-WT, which stably expresses wild-type CREPT protein, lung tumors significantly increased. However, when mice were inoculated with the B16 cell line CREPT-S134A, which stably expresses CREPT S134A protein, lung tumors were significantly reduced compared to the other two groups. This indicates that the serine site at position 134 of CREPT is crucial for CREPT to promote tumor metastasis, and the CREPTS134A mutant can effectively inhibit tumor metastasis.

[0103] Example 6. CREPT Effects of S134A mutant protein on CREPT knockout tumor cells

[0104] The effect of the CREPT S134A mutant protein on the metastatic ability of CREPT-knockout tumor cells was investigated using a C57BL / 6J mouse melanoma lung metastasis assay. The specific steps were as follows: First, based on the CREPT-knockout B16 cell line, cell lines stably expressing pcDNA3.1-HA (CREPT-KO), stably expressing wild-type CREPT (KO-CREPT-WT), stably expressing CREPT S134E protein (KO-CREPT-S134E), and stably expressing CREPT-S134A protein (KO-CREPT-S134A) were established. Based on the tumor-suppressive effect of the CREPT S134A mutant protein, an attempt was made to reintroduce CREPT S134A into the CREPT-knockout B16 (KO CREPT) tumor cell line. However, cell death was observed, resulting in the failure to successfully establish a cell line stably expressing CREPT S134A protein (KO-CREPT-S134A).

[0105] Then, the successfully established cell lines CREPT-KO, KO-CREPT-WT, and KO-CREPT-S134E were injected into C57BL / 6J mice (purchased from Vital River Pharmaceuticals, B6J JAX Lab) via tail vein injection at a dose of 1×10⁻⁶. 5 Cells / 200μL / mouse. Mice were sacrificed 21 days after inoculation, and their lungs were removed to observe the occurrence of lung tumors.

[0106] The results are as follows Figure 3 As shown, CREPT-KO cells failed to induce lung tumors in mice, but lung tumors significantly increased when mice were inoculated with KO-CREPT-WT and KO-CREPT-S134E cell lines. This indicates that serine residue position 134 of CREPT is crucial for CREPT to promote tumor metastasis. Furthermore, it was found that the CREPT S134E mutant protein mimics the phosphorylation state of wild-type CREPT at position 134, thus not inhibiting or killing tumor cells; while the CREPT-S134A mutant protein mimics the non-phosphorylation state of wild-type CREPT at position 134, thereby inhibiting or killing tumor cells.

[0107] Example 7. CREPT Effects of S134A mutant protein on CREPT knockout tumor cells

[0108] The effect of the CREPT S134A mutant protein on the growth of CREPT-knockout tumor cells was investigated using a clonogenic assay. The specific steps were as follows: First, based on the CREPT-knockout DLD1 cell line, cell lines stably expressing pcDNA3.1-HA (CREPT-KO), stably expressing wild-type CREPT (KO-CREPT-WT), stably expressing CREPT S134E protein (KO-CREPT-S134E), and stably expressing CREPT-S134A protein (KO-CREPT-S134A) were established. Based on the tumor-suppressive effect of the CREPT S134A mutant protein, an attempt was made to reintroduce CREPT S134A into the CREPT-knockout DLD1 (KO CREPT) tumor cell line. However, cell death was observed, resulting in the failure to successfully establish a cell line stably expressing CREPT S134A protein (KO-CREPT-S134A).

[0109] Then, using the cell lines CREPT-KO, KO-CREPT-WT, and KO-CREPT-S134E that were successfully established above, a clone formation experiment was performed according to the steps in Example 4.

[0110] The results are as follows Figure 4As shown, the number of clones produced by the KO-CREPT-WT and KO-CREPT-S134E cell lines was significantly higher than that of the CREPT-KO group. This indicates that the serine site at position 134 of CREPT is crucial for CREPT to promote tumor cell growth.

[0111] The technical concept and specific embodiments of the present invention have been described above. However, it should be understood that the above specific embodiments do not limit the scope of the present invention in any way. Those skilled in the art will understand that various modifications and / or changes can be made to the invention shown in the specific embodiments without departing from the spirit of the present invention, and the modified and / or changed embodiments are also covered within the scope of the present invention. Therefore, the embodiments of the present invention are merely illustrative and not restrictive.

[0112] Example 8. Screening of phosphorylation inhibitors of CREPT

[0113] 8.1 Prediction of small molecule compounds as potential inhibitors of CREPT phosphorylation

[0114] Small molecule phosphorylation inhibitors of CREPT were predicted using the prediction tools SwissTargetPrediction (http: / / www.swisstargetprediction.ch / ) and SEA (Similarity ensemble approach; https: / / sea.bkslab.org / ), and five candidate small molecule compounds #1 to #5 were obtained and synthesized.

[0115] 8.2 Effect of candidate small molecule compounds on CREPT phosphorylation

[0116] 1) First, HEK293T cells with CREPT knocked out were passaged into culture dishes. On the second day, when the cells reached a density of 60%-80%, the cells were transfected with HA-CREPT(S134A) and HA-CREPT(WT) plasmids. One copy of HA-CREPT(S134A) was transfected as a negative control, and seven copies of HA-CREPT(WT) were transfected to verify the effect of different candidate small molecules and controls on phosphorylation at the CREPT 134 site.

[0117] 2) Four hours after transfection, the transfected cells were changed in medium. Except for one cell transfected with HA-CREPT(S134A) and one transfected with HA-CREPT(WT) which were changed to normal medium, the other six cells transfected with HA-CREPT(WT) were changed to normal medium containing DMSO or small molecules #1, #2, #3, #4, and #5, respectively. The working concentration of all small molecules was uniformly set to 5 μM.

[0118] 3) After drug treatment for 24 hours, cells were lysed and proteins were harvested. Immunoprecipitation experiments were performed using HA-tagged protein antibodies. The immunoprecipitated tagged proteins were detected using antibodies that specifically recognize phosphorylation at the CREPT134 site. At the same time, the background level of CREPT protein was detected using the tagged antibody, and then grayscale analysis was performed to obtain the amount of phosphorylated protein relative to the background level, thereby quantifying the phosphorylation level.

[0119] The results are as follows Figure 5 As shown, no phosphorylation signal was detected in HA-CREPT(S134A) as a negative control, while a significant phosphorylation signal was detected in the DMSO control of HA-CREPT(WT). Gray-scale analysis confirmed that candidate small molecule compounds #1, #2, and #5 did not affect the phosphorylation at site 134 of HA-CREPT(WT), while #3 and #4 significantly reduced the phosphorylation level at site 134 of HA-CREPT(WT). The structural formulas of compounds #3 and #4 are as follows:

[0120]

[0121]

[0122] 8.3 Effects of candidate small molecule compounds on cell proliferation

[0123] 1) Take DLD1 (human colorectal adenocarcinoma epithelial cells) or MGC803 (human gastric cancer cells) in logarithmic growth phase, digest them with 0.25% trypsin and gently pipette to make them into single cells. Count the viable cells and adjust the cell density to 1×10⁻⁶ cells using DMEM culture medium containing 10% fetal bovine serum. 4 Cells / L.

[0124] 2) Mix 10 mL of culture medium and 10 mL of cell diluent at a 1:1 ratio, then add 0.2 mL of the mixture to each well of a 96-well plate, for a total of 3 replicate wells. Incubate at 37°C in a 5% CO2 incubator for 12 hours.

[0125] 3) Dissolve the above five candidate small molecule compounds #1 to #5 in DMSO. The initial screening concentration for each compound is 10 μM (DLD1 cells) or 5 μM (MGC803 cells). Perform three replicates for each compound; incubate each compound at a concentration of 10 μM (DLD1 cells) or 5 μM (MGC803 cells) for 3 days, then use CCK to measure cell proliferation. Before measurement, replace each well with 10 μl of well-mixed CCK-8 solution and 90 μl of complete culture medium (wells with the corresponding amounts of CCK-8 solution and cell culture medium serve as blank controls). Incubate at 37°C for 3 hours. Measure the absorbance at 450 nm. Calculate and statistically analyze the results and plot them as shown below. Figure 6 The cells A (DLD1 cells) and B (MGC803 cells) are shown in the figure.

[0126] As can be seen, compound #4, as a CREPT phosphorylation inhibitor, significantly inhibited cell proliferation. This indicates that the inhibition of CREPT S134 phosphorylation at the tested concentration of compound #4 led to the inhibition of cell proliferation, which is consistent with the results of Example 4. That is, compound #4 can exhibit an effect similar to the CREPT S134A mutation.

[0127] References

[0128] Anzalone,AV,Randolph,PB,Davis,JRet al.(2019)Search-and-replacegenome editing without double-strand breaks or donor DNA.Nature 576,149–157.

[0129] Li,MD,Ma,DH,and Chang,ZJ(2021).Current understanding of CREPTand p15RS,carboxyterminal domain(CTD)-interacting proteins,in humancancers.Oncogene 40,705-716.

[0130] Lu, D., Wu, Y., Wang, Y., Ren, F., Wang, D., Su, F., Zhang, Y., Yang, X., Jin, G., Hao, X., et al. (2012). CREPT accelerates tumorigenesis by regulating thetranscription of cell-cycle-related genes. Cancer Cell 21, 92-104.

[0131] Maiani, E., Milletti, G., Nazio, F., Holdgaard, SG, Bartkova, J., Rizza, S., Cianfanelli, V., Lorente, M., Simoneschi, D., Di Marco, M., et al 592,799-+.

[0132] Simoneschi, D., Rona, G., Zhou, N., Jeong, YT, Jiang, SW, Milletti, G., Arbini, AA, O'Sullivan, A., Wang, AA, Nithikasem, S., et al.(2021).CRL4(AMBRA1)isa master regulator of D-type cyclins.Nature 592,789-+.

Claims

1. A protein obtained by replacing the 134th residue of SEQ ID NO: 4 with a non-phosphorylated residue; in, The non-phosphorylated residue is alanine.

2. The protein of claim 1, wherein it is obtained by changing serine at position 134 of the human CREPT protein to alanine.

3. A protein obtained by attaching a tag sequence or guide sequence to the N-terminus and / or C-terminus of the protein according to claim 1 or 2.

4. A nucleic acid encoding the protein of any one of claims 1 to 3.

5. The nucleic acid as described in claim 4, wherein the sequence is SEQ ID NO:

1.

6. An expression vector comprising the nucleic acid of claim 4 or 5.

7. Cells comprising the carrier of claim 6.

8. The use of the protein of any one of claims 1 to 3, the nucleic acid of claim 4 or 5, or the vector of claim 6 in the preparation of a reagent for inhibiting the proliferation and / or migration of eukaryotic cells in vitro, wherein, The eukaryotic cells are human or mouse cells.

9. The application as described in claim 8, wherein, The eukaryotic cells mentioned are human cancer cells.

10. The use of the protein of any one of claims 1 to 3, the nucleic acid of claim 4 or 5, or the carrier of claim 6 in the preparation of an anticancer drug, wherein, The cancer in question is melanoma or colorectal cancer.

11. The application as described in claim 10, wherein, The anticancer drugs include drugs that inhibit the proliferation of cancer cells, drugs that inhibit the metastasis of cancer cells, or drugs that kill cancer cells, wherein the cancer cells are melanoma cells or colorectal cancer cells.

12. The application of CRISPR / Cas9-based gene editing systems in the preparation of drugs for treating cancer in subjects, wherein, The CRISPR / Cas9-based gene editing system is capable of editing the CREPT gene in the genome of a subject's cancer cells to cause the cancer cells to express the protein of claim 1 or 2; wherein the cancer is melanoma or colorectal cancer, the cancer cells are melanoma cells or colorectal cancer cells, and the subject is a human or a mouse.

13. A method for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein, wherein, The inhibitor maintains the S134 site of the CREPT protein in a non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID No: 4, and the method includes: S1. Treat eukaryotic cells expressing CREPT protein with the substance to be identified. S2. Immunoprecipitation with an antiphosphorylation antibody was used to examine the phosphorylation level of the S134 site of the CREPT protein in the cells treated in step S1. If the phosphorylation level of the S134 site of the CREPT protein is decreased in cells treated with the substance compared to the phosphorylation level at the S134 site of the CREPT protein, then the substance is identified as an inhibitor of phosphorylation at the S134 site of the CREPT protein; otherwise, the substance is identified as not an inhibitor of phosphorylation at the S134 site of the CREPT protein.

14. The method of claim 13, wherein, The decrease in phosphorylation level refers to a decrease of more than 10% in the phosphorylation level of the S134 site of the CREPT protein in cells treated with the substance, compared to the phosphorylation level of the S134 site of the CREPT protein in control cells that were not treated with the substance.

15. The method of claim 13, wherein, The decrease in phosphorylation level refers to a decrease of more than 20% in the phosphorylation level of the S134 site of the CREPT protein in cells treated with the substance, compared with the phosphorylation level of the S134 site of the CREPT protein in control cells that were not treated with the substance.

16. The method of claim 13, wherein, The decrease in phosphorylation level refers to a decrease of more than 30% in the phosphorylation level of the S134 site of the CREPT protein in cells treated with the substance, compared to the phosphorylation level of the S134 site of the CREPT protein in control cells that were not treated with the substance.

17. The method of claim 13, wherein, The decrease in phosphorylation level refers to a decrease of more than 40% in the phosphorylation level of the S134 site of the CREPT protein in cells treated with the substance, compared to the phosphorylation level of the S134 site of the CREPT protein in control cells that were not treated with the substance.

18. The method of claim 13, wherein, Prior to step S1, the method further includes: using the prediction tools SwissTargetPrediction and SEA to design the substance to be identified for CREPT.

19. The method of claim 13, wherein, Step S1 is performed by incubating the substance to be identified and the eukaryotic cells under conditions that allow phosphorylation.

20. The method of claim 13, wherein, Step S2 involves immunoprecipitation using an anti-CREPT antibody that recognizes the CREPT protein and an anti-phosphorylation antibody that recognizes phosphorylation at site S134 of the CREPT protein, thereby quantifying the phosphorylation level at site S134 of the CREPT protein.

Citation Information

Patent Citations

  • Positive regulation gene for cell cycle and its coded protein and uses

    CN1807623A

  • CREPT (S145A) mutant and application thereof in inhibition of tumor growth

    CN108949718A