Escherichia coli expression vector and construction method and application thereof

Abstract

The application discloses an E. coli expression vector and a construction method and application thereof, and belongs to the technical field of genetic engineering. The application solves the problem of low expression efficiency of an existing E. coli vector in a gene expression process, thereby leading to low tryptophan yield when the E. coli vector is applied to the production of tryptophan. The E. coli expression vector contains an artificially synthesized promoter sequence with a function in E. coli, a multiple cloning site sequence for inserting an exogenous gene for expression, an artificial transcription termination sequence, and a resistance screening marker capable of gene cloning and expression in E. coli. The E. coli expression vector can realize efficient transcription and translation of a gene. The E. coli expression vector is suitable for the production of tryptophan.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to an expression vector for bacteria and its construction method. Background Technology

[0002] Escherichia coli has a well-defined genetic background and is frequently used for large-scale fermentation culture. Its main advantages include a short expression cycle, relatively simple operation, and a large number of available expression vectors. However, during gene expression, problems such as low expression efficiency leading to low yields also exist. Factors affecting gene expression efficiency are mainly related to the amount of target gene, mRNA stability, control of fermentation culture conditions, vector selection, promoter strength, and translation initiation efficiency. Summary of the Invention

[0003] This invention solves the problem of low expression efficiency of existing E. coli vectors during gene expression, which leads to low tryptophan yield in tryptophan production.

[0004] Therefore, the present invention proposes the following technical solution:

[0005] Option 1: An Escherichia coli expression vector, wherein the Escherichia coli vector is used for the production of tryptophan, the Escherichia coli expression vector contains a synthetic promoter sequence that functions in Escherichia coli, a multiple cloning site sequence for the insertion and expression of exogenous genes, an artificial transcription termination sequence, and an resistance selection marker that can be used for gene cloning and expression in Escherichia coli.

[0006] Preferably, the artificially synthesized promoter nucleotide sequence is the nucleotide sequence shown in SEQ ID No. 1.

[0007] Preferably, the multiple cloning site sequence for exogenous gene insertion expression is the nucleotide sequence shown in SEQ ID No. 2.

[0008] Preferably, the artificial transcription terminator nucleotide sequence is the nucleotide sequence shown in SEQ ID No. 3.

[0009] Option 2: A method for constructing an Escherichia coli expression vector, preferably:

[0010] (1) Using pTH18kr as the vector backbone, artificially synthesized promoters and terminators are linked to pTH18kr, and the resulting vector sequence is denoted as XYWa0.

[0011] (2) Using wild-type Escherichia coli MG1655 as a template, the gene sequences of trpE, trpD, trpC, trpB and trpA were amplified using the Gibson Assembly method with primers P1 and P2. The target fragment obtained was denoted as P12.

[0012] (3) Using XYWa0 described in step (1) as a template, EcoRⅠ and KpnⅠ are used for enzyme digestion. After enzyme digestion, a fragment with a length of 3088bp is recovered. Using the recovered product as a template, PCR amplification is performed using primers P3 and P4. The obtained target fragment is denoted as P34.

[0013] (4) The fragments P12 and P34 described in steps (2) and (3) are ligated using a Seamless Cloning Kit. The ligation product is transformed into wild-type Escherichia coli MG1655 competent cells and cultured on kanamycin-resistant LB plates. Single colonies are screened out and colony PCR is performed. Primers P5 and P6 are used to sequence the PCR product with a length of 6954 bp. The recombinant bacteria that are correctly identified by sequencing are preserved and recorded as XYWa0717.

[0014] Preferably, the primer sequences used in step (2) are as follows:

[0015] P1: ggtggtgtaggatcctctagaattcatgcaaacacaaaaaccgactctcg;

[0016] P2: ctgtgttctgtattacccgggtaccttaactgcgcgtcgccgc.

[0017] Preferably, the primer sequences used in step (3) are as follows:

[0018] P3: gatgaaagcggcgacgcgcagttaaggtacccgggtaatacag;

[0019] P4: cgagagtcggtttttgtgtttgcatgaattctgaggatcctacac.

[0020] Preferably, the primer sequences used in step (4) are as follows:

[0021] P5: agcgaaagagagactggcc;

[0022] P6:caactgttgggaagggcga.

[0023] Option 3: Application of the above-mentioned E. coli expression vector in the fermentation production of tryptophan.

[0024] The beneficial effects of this invention are:

[0025] The E. coli vector and construction method provided by this invention enable efficient expression of genes in E. coli, thereby achieving high production of tryptophan. Attached Figure Description

[0026] Figure 1 This refers to the XYWa0 carrier in the embodiments of the present invention;

[0027] Figure 2 The XYWa0717 carrier is an example of this invention. Detailed Implementation

[0028] Example 1

[0029] A promoter (as shown in SEQ ID No. 1) and a terminator (as shown in SEQ ID No. 3) were artificially synthesized;

[0030] Using pTH18kr as the vector backbone, artificially synthesized promoter and terminator sequences were ligated to pTH18kr, denoted as XYWa0 (as shown in SEQ ID No. 4), see [link to SEQ ID No. 4]. Figure 1 This step involves sending the gene to a gene synthesis company for artificial synthesis.

[0031] Example 2

[0032] Method for constructing an E. coli vector for tryptophan production: The gene was inserted into the EcoRI and KpnI restriction sites. Using the Gibson Assembly method, wild-type E. coli MG1655 was used as a template to amplify the trpE, trpD, trpC, trpB, and trpA gene sequences. P1: ggtggtgtaggatcctctagaattcatgcaaacacaaaaaccgactctcg (as shown in SEQ ID No. 5) and P2: ctgtgttctgtattacccgggtaccttaactgcgcgtcgccgc (as shown in SEQ ID No. 6) were used as upstream and downstream primers. The amplification length was 6581 bp (this length includes the primer sequence). The PCR reaction was carried out in a total volume of 50 μL. The reaction conditions were: denaturation at 95 °C for 2 min, followed by denaturation at 95 °C for 20 s, annealing at 58 °C for 20 s, extension at 72 °C for 1 min, for a total of 35 cycles, followed by a final extension at 72 °C for 5 min. After PCR, agarose gel electrophoresis was performed, and the target fragment was recovered. The target fragment was designated as P12, with a length of 6531 bp. The sequence information can be found in SEQ ID No. 7.

[0033] Simultaneously, using the synthesized XYWa0 from Example 1 as a template, it was digested with EcoRI and KpnI, and the recovered fragment length was 3088bp. Using the gel-recovered product as a template, polymerase chain reaction (PCR) was performed using primers P3 and P4. P3 was the upstream primer: gatgaaagcggcgacgcgcagttaaggtacccgggtaatacag (as shown in SEQ ID No. 8), and P4 was the downstream primer: cgagagtcggtttttgtgtttgcatgaattc tagaggatcctacac (as shown in SEQ ID No. 9). The amplified length was 3144bp. The reaction conditions were: denaturation at 95℃ for 2 min, followed by denaturation at 95℃ for 20 s, annealing at 58℃ for 20 s, extension at 72℃ for 1 min, for a total of 35 cycles, followed by a final extension at 72℃ for 5 min. After PCR, the fragment was subjected to agarose gel extraction. fat Glycogel electrophoresis was performed to recover the target fragment, which was designated as P34. The sequence information can be found in SEQ ID No. 10.

[0034] The P12 and P34 fragments were ligated using a Seamless Cloning Kit (purchased from Beyotime), and the ligation reaction conditions were adjusted to 50°C for 90 min. The ligation product was then transformed into wild-type *E. coli* MG1655 competent cells and cultured on kanamycin-resistant LB agar plates. Single colonies were screened and identified by colony PCR. The upstream primer was P5: agcgaaagagagactggcc (as shown in SEQ ID No. 11), and the downstream primer was P6: caactgttgggaagggcga (as shown in SEQ ID No. 12). The PCR volume was 20 μL, and the reaction conditions were: denaturation at 95°C for 6 min, followed by denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 3 min 50 s, for a total of 30 cycles. After a final extension at 72°C for 5 min, agarose gel electrophoresis was performed. The fragment with an amplified length of 6954 bp was selected for recovery. The recovered PCR product was sequenced, and the recombinant bacteria that were correctly identified by sequencing were deposited as XYWa0717. Figure 2 The sequence information can be found in SEQ ID No. 13.

[0035] Example 3

[0036] The *E. coli* expression vector XYWa0717 obtained in Example 2 was fermented in a 24-well plate. Simultaneously, XYWa0 obtained in Example 1 was fermented in a 24-well plate as a control. Both were placed in a 24-well plate high-speed shaking incubator with a rotation speed of 880 rpm, humidity of 85%, pH of 7.15, and a fermentation time of 16 hours. The fermentation medium formula was: potassium dihydrogen phosphate 3.5 g / L, dipotassium hydrogen phosphate 3 g / L, disodium hydrogen phosphate 6 g / L, ammonium sulfate 4 g / L, nitrite sulfate 0.1 g / L, citric acid monohydrate 2.5 g / L, yeast extract 3 g / L, propanesulfonic acid 60 g / L, trace element mixture 1 mL, magnesium sulfate 0.6 g / L, and glucose 35 g / L.

[0037] The components of the trace element mixture are as follows: CoSO4·7H2O 0.6 g / L, ZnSO4·7H2O 8 g / L, CuSO4·5H2O 6 g / L, Al2(SO4)3·18H2O 2 g / L, MnSO4·H2O 5 g / L, Na2MoO4·2H2O 3 g / L, NiSO4·6H2O 2 g / L, and H3BO3 1.5 g / L.

[0038] After fermentation, the acid production was measured by colorimetry. It was found that the XYWa0 carrier did not produce acid, while the XYWa0717 carrier produced a relatively high amount of acid. The results are shown in Table 1.

[0039] Table 1

[0040]

[0041] Table 1 shows that the E. coli vector XYWa0717 has a high acid production level in 24-well plates, while the XYWa0 vector not connected to the target plate does not produce acid. This indicates that the application of the E. coli expression vector XYWa0717 in the fermentation production of tryptophan can effectively increase the yield of tryptophan.

[0042] Comparative Example 1

[0043] While fermenting and culturing the two vectors mentioned above, this application also placed another E. coli vector in the same 24-well plate for fermentation and culture, under the same conditions as in Example 3. This E. coli vector has a different promoter sequence from XYWa0717, but all other sequence information is the same. The promoter sequence is shown in SEQ ID No. 14. The acid production indicators obtained after fermenting and culturing this E. coli vector in the deep well plate are shown in Table 2.

[0044] Table 2

[0045]

[0046] Comparing the data in this table with those in Table 1, it can be seen that the acid production of the E. coli vector used in this comparative example is significantly lower than that of the E. coli expression vector XYWa0717 in this application, further demonstrating that the XYWa0717 vector has better promoter strength and translation initiation efficiency, and has a significant advantage in acid production.

Claims

1. An Escherichia coli expression vector, characterized in that, The *E. coli* expression vector contains a synthetic promoter sequence that functions in *E. coli*, a multiple cloning site sequence for exogenous gene insertion and expression, an artificial transcription termination sequence, and an resistance selection marker for gene cloning and expression in *E. coli*. The synthetic promoter nucleotide sequence is the nucleotide sequence shown in SEQ ID No. 1; the multiple cloning site sequence for exogenous gene insertion and expression is the nucleotide sequence shown in SEQ ID No. 2; and the artificial transcription termination sequence is the nucleotide sequence shown in SEQ ID No.

3.

2. A method for constructing an Escherichia coli expression vector, characterized in that, The construction method includes the following steps: (1) Using pTH18kr as the vector backbone, artificially synthesized promoters and terminators were linked to pTH18kr, and the resulting vector sequence was denoted as XYWa0; the nucleotide sequence of XYWa0 is shown in SEQ ID No.4; (2) Using wild-type Escherichia coli MG1655 as a template, the gene sequences of trpE, trpD, trpC, trpB, and trpA were amplified using the Gibson Assembly method with primers P1 and P2. The target fragment obtained was denoted as P12. The nucleotide sequence of primer P1 was: ggtggtgtaggatcctctagaattcatgcaaacacaaaaaccgactctcg; the nucleotide sequence of primer P2 was: ctgtgttctgtattacccgggtaccttaactgcgcgtcgccgc. (3) Using XYWa0 described in step (1) as a template, EcoRI and KpnI are used for enzyme digestion. After enzyme digestion, a fragment with a length of 3088bp is recovered. The recovered product is used as a template for PCR amplification using primers P3 and P4. The obtained target fragment is denoted as P34. The nucleotide sequence of primer P3 is: gatgaaagcggcgacgcgcagttaaggtacccgggtaatacag; the nucleotide sequence of primer P4 is: cgagagtcggtttttgtgtttgcatgaattctagaggatcctacac; (4) The fragments P12 and P34 described in steps (2) and (3) are ligated using a Seamless Cloning Kit. The ligation product is transformed into wild-type Escherichia coli MG1655 competent cells and cultured on kanamycin-resistant LB plates. Single colonies are screened and colony PCR is performed. Primers P5 and P6 are used to sequence the 6954bp PCR product. The recombinant bacteria that are correctly identified by sequencing are preserved. The vector in the recombinant bacteria is recorded as the expression vector to be constructed, XYWa0717. The nucleotide sequence of primer P5 is: agcgaaagagagactggcc; the nucleotide sequence of primer P6 is: caactgttgggaagggcga.

3. Application of Escherichia coli containing the recombinant expression vector shown in SEQ ID No. 13 in the fermentation production of tryptophan.

Images