Application of OsMKK1 gene in rice disease resistance

Abstract

This invention discloses the application of the OsMKK1 gene in rice disease resistance. The application of the OsMKK1 gene, shown in SEQ ID NO.1, in improving rice resistance to rice blast and / or bacterial blight. Overexpression of the OsMKK1 gene enhances rice resistance to rice blast and / or bacterial blight. Knockout or silencing of the OsMKK1 gene enhances rice resistance to rice blast and / or bacterial blight. This invention, through studying loss-of-function and gain-of-function mutants of the OsMKK1 gene, found that the OsMKK1 gene can affect the rice's resistance to rice blast fungus and bacterial blight fungus. Compared with the wild-type control, both loss-of-function and gain-of-function mutants can improve the rice's resistance to rice blast fungus and bacterial blight fungus. This invention can be applied to disease-resistant breeding of rice.

Description

Technical Field

[0001] This invention relates to the application of the OsMKK1 protein and its encoding gene in improving resistance to bacterial blight and rice blast in rice. Background Technology

[0002] Rice is a vital food crop worldwide, feeding more than half the world's population. In my country, over 60% of the population relies on rice as their staple food. Since modern times, my country has made continuous breakthroughs in rice breeding technology, achieving the world's highest yield per unit area and total output. However, plants in nature are always susceptible to various pathogens (such as bacteria, fungi, and viruses), severely restricting the high, stable, and high-quality production of rice. Rice blast and bacterial blight are representative fungal and bacterial diseases that have the most serious impact on rice production. Therefore, resistance is an indispensable key condition in rice variety approval. Discovering resistance genes to cultivate broad-spectrum, durable resistant varieties is currently the most economical, effective, and environmentally friendly strategy for controlling disease occurrence. Therefore, discovering and identifying rice's own disease-resistant genes and deeply studying and elucidating their disease-resistant mechanisms is not only of significant theoretical importance for studying the interaction mechanisms between rice and pathogens, but also provides important guidance for cultivating new disease-resistant rice varieties.

[0003] Rice blast is a fungal disease caused by *Magnaporthe oryzae*, which can occur at any stage of rice growth, damaging leaves, panicles, and nodes, severely impacting yield. Rice bacterial blight is a bacterial disease caused by *Xanthomonas oryzae pv. oryzae*, primarily affecting leaves but also infecting leaf sheaths. It spreads rapidly and can cause widespread death of rice plants, resulting in significant losses. Currently, prevention is the most effective control method; therefore, breeding resistant varieties and identifying disease-resistant genes are crucial.

[0004] The MAPK signaling cascade is a highly conserved mitogen-activated protein kinase (MAPK, or MPK) in eukaryotes. Its signaling cascade system is a phosphorylation signaling pathway composed of three protein kinases. First, MAPK kinase (MAPKKK, or MEKK) is activated by a cell receptor signal. MAPKKK then phosphorylates and activates downstream MAPK kinases (MAPKK, MKK, or MEK). The phosphorylated and activated MAPK then phosphorylates target proteins in the cytoplasm or nucleus and transmits the signal, or regulates gene expression in the nucleus by phosphorylating specific transcription factors, participating in numerous physiological processes such as plant cell differentiation, growth and development, hormone responses, stress responses, and plant disease resistance (Zhang, M et al., 2018). Summary of the Invention

[0005] This invention aims to reveal the biological function of OsMKK1 loss-of-function mutants and gain-of-function mutants in rice disease resistance, and to achieve precision breeding through gene editing, thereby providing new genetic resources and material support for improving rice disease resistance.

[0006] The technical solution adopted in this invention is as follows:

[0007] This invention confirms that the OsMKK1 gene plays a crucial dual regulatory role in rice resistance to bacterial blight and rice blast. Both deletion and overexpression of the OsMKK1 gene in rice can enhance its resistance to bacterial bacterial blight and rice blast. Through research, the applicant discovered that the OsMKK1 gene influences the broad-spectrum resistance of rice to bacterial blight and rice blast.

[0008] The specific applications provided by this invention are as follows:

[0009] Application of the OsMKK1 gene shown in SEQ ID NO.1 in improving rice resistance to rice blast and / or bacterial blight.

[0010] The OsMKK1 gene sequence is shown below: The deoxyribonucleotides from position 1 to 111 form the upstream non-coding sequence of OsMKK1; positions 112 to 170 form the first exon sequence; positions 171 to 313 form the first intron sequence of the OsMKK1 gene; positions 314 to 398 form the second exon sequence; and positions 399 to 1060 form the... The first deoxyribonucleotide is the second intron sequence of the OsMKK1 gene; positions 1061 to 1198 are the third exon sequence; positions 1199 to 1395 are the third intron sequence; positions 1396 to 1621 are the fourth exon sequence; positions 1622 to 1728 are the fourth intron sequence; positions 1729 to 19... The 10th deoxyribonucleotide is the fifth exon sequence; deoxyribonucleotides from positions 1911 to 2015 are the fifth intron sequence of the OsMKK1 gene; deoxyribonucleotides from positions 2016 to 2221 are the sixth exon sequence of the OsMKK1 gene; deoxyribonucleotides from positions 2222 to 3275 are the sixth intron sequence; and deoxyribonucleotides from positions 3276 to 3321 are the OsMK... The seventh exon sequence of the K1 gene consists of the seventh intron sequence (deoxyribonucleotides from position 3322 to 3423), the eighth exon sequence (deoxyribonucleotides from position 3424 to 3517), the eighth intron sequence (deoxyribonucleotides from position 3518 to 3647), the ninth exon sequence (deoxyribonucleotides from position 3648 to 3670), and the downstream non-coding sequence (positions from position 3671 to 4025).

[0011] Overexpression of the OsMKK1 gene can enhance rice resistance to rice blast and / or bacterial blight.

[0012] Knockout or silence of the OsMKK1 gene can improve rice resistance to rice blast and / or bacterial blight.

[0013] In this invention, the transgenic plant includes not only the first-generation transgenic plant and its progeny obtained by transforming the gene into the recipient plant shown in this invention, but also other varieties or species of the same species into which the gene has been transferred. The transgenic plant may be a seed, callus tissue, whole plant, or cell.

[0014] In the above applications, the plant can be either a monocotyledonous plant or a dicotyledonous plant. In the embodiments of the present invention, the plant is a monocotyledonous grass—rice (specifically, the Nipponbare variety).

[0015] For more detailed technical solutions, please refer to the "Detailed Implementation Methods".

[0016] Effectiveness: This invention utilizes CRISPR-Cas9 technology to knock out the third exon of the OsMKK1 gene, obtaining an OsMKK1 gene knockout rice mutant. Inoculation with bacterial blight and rice blast pathogens revealed that the OsMKK1 mutant rice was more resistant to disease compared to wild-type rice. Furthermore, by mutating both phosphorylation sites T (threonine) and S (serine) of OsMKK1 to D (aspartic acid), gain-of-function transgenic rice OsMKK1 was obtained. DD Through inoculation with bacterial blight and rice blast pathogens, it was found that OsMKK1, compared with wild-type rice, DD It is also more resistant to disease. This invention is of great significance for breeding disease-resistant rice varieties. Attached Figure Description

[0017] Figure 1 CRISPR / Cas9 knockout sites and homozygous mutant genotypes of the OsMKK1 gene in the T1 generation.

[0018] Figure 2 Significant differences were observed in gene expression levels between wild-type (NIP) and knockout mutant (Osmkk1);

[0019] Figure 3 Phenotypic (A), lesion length (B), and pathogen growth (C) of wild-type (NIP) and knockout mutant (Osmkk1) after inoculation with bacterial blight pathogen (PXO99) are statistically analyzed. Figure 3 Figures A and B show the disease development 14 days after inoculation with PXO99, the causal agent of bacterial blight, following the deletion of the OsMKK1 gene. Figures A and B indicate that the lesion length in the Osmkk1 mutant is significantly shorter compared to the wild-type plant. Figure C shows that the bacterial content in the Osmkk1 mutant is significantly lower than that in the wild-type.

[0020] Figure 4 Western blot detection of the overexpression mutant (OsMKK1) DD There is obvious expression of the target protein.

[0021] Figure 5 Wild-type (NIP) and overexpression mutant (OsMKK1) DD Phenotypic (A) and lesion length statistics (B) after inoculation with bacterial blight pathogen (PXO99). The results showed that OsMKK1 DD Overexpression enhances the plant's resistance to bacterial blight.

[0022] Figure 6Phenotypic (A) and lesion area ratio (B) of wild-type (NIP) and knockout mutant (Osmkk1) after inoculation with rice blast pathogen (RB22); indicating that the OsMKK1 gene deletion enhances resistance to rice blast.

[0023] Figure 7 Wild-type (NIP) and overexpression mutant (OsMKK1) DD Phenotypic (A) and lesion length statistics (B) after inoculation with rice blast pathogen (RB22). Results showed that OsMKK1 DD Overexpression enhances the plant's resistance to rice blast pathogen. Detailed Implementation

[0024] Description of the sequence list:

[0025] The sequence listing SED ID NO:1 is the nucleotide sequence of the OsMKK1 gene, with a full length of 4025 bp.

[0026] The present invention will now be described with reference to specific examples, but the limitations of the present invention are not limited thereto;

[0027] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: *Molecular Cloning: A Laboratory Manual* (Sambrook, J., Russell, David W., 3rd edition, 2001, Cold Spring Harbor, NY) or related products. Reagents or instruments whose manufacturers are not specified can be purchased commercially.

[0028] Example 1: Construction of OsMKK1 knockout mutant

[0029] To verify the function of the OsMKK1 gene in disease resistance, the applicant knocked out OsMKK1 using CRISPR / Cas9 technology in the rice variety Nipponbare (Oryza. Sativa L. spp. japonica, var. Nipponbare), and determined the gene's function in disease resistance through phenotypic analysis after disease infection. OsMKK1 is a member of the rice OsMKK family and is located on chromosome 6. Its accession numbers in the Japanese Rice Annotation Project Database (RAP-DB) and the MSU Rice Genome Annotation Project Database (RGAP7) are Os06g0147800 and LOC_Os06g05520, respectively. This gene has nine exons. This invention designs a target sequence for sgRNA in the CRISPR / Cas9 system on the third exon of the gene to knock out OsMKK1. The knockout vector is a TKC vector backbone. For specific construction methods, please refer to the following article (He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free Rice Plants. Mol Plant. 2018 Sep 10;11(9):1210-1213.).

[0030] The sgRNA sequence was designed in the third exon region of OsMKK1, as follows:

[0031] 5'-ATCTAAAGGTTCTATAGGAG GGG -3', where the underlined sequence is a PAM sequence.

[0032] Based on the TKC primer design principles, the forward primer is designed as: KK1-U6-F

[0033] 5'- G ATCTAAAGGTTCTATAGGAGgttttagagctagaaatagcaagtta-3', lowercase indicates the sequence on the plasmid.

[0034] The reverse primer is: KK1-U3-R:

[0035] 5'-CTCCTATAGAACCTTTAGAT Caacctgagcctcagcgcagc-3', lowercase indicates the sequence on the plasmid.

[0036] Using boundary primers, two rounds of PCR were used to amplify the sgRNA transcription element. The recovered PCR product was ligated into the TKC vector, which had been completely digested with Pme I. Positive transformants were obtained by transformation into *E. coli* and then sequenced.

[0037] After transforming the plasmid into Agrobacterium, multiple independent transgenic plants were obtained by transforming Nipponbare rice.

[0038] Example 2: Screening and identification of OsMKK1 gene knockout mutants

[0039] (1) Genotyping of Osmkk1 mutant

[0040] DNA was extracted from the OsMKK1 gene knockout mutant plants obtained above, and primers were designed upstream and downstream of the target site for sequencing detection to obtain the results. Figure 1 The homozygous mutant plant is shown. Sixteen bases were knocked out and one base was added to the third exon, respectively. Gene segregation was then performed on the progeny of this mutant, ultimately yielding Osmkk1 mutant plants without the exogenous inserted gene. Identification primers were:

[0041] Osmkk1-seq-F:-TGGTAGCTCTGTTCCTGGTG

[0042] Osmkk1-seq-R:-TGGTAAGGGGAGAGTGGAAG

[0043] (2) The RNA expression level of the OsMKK1 gene knockout mutant Osmkk1 was detected. Total RNA was extracted from rice leaves at 14 days of age, reverse transcribed, and identified using the following primers:

[0044] The OsMKK1 primers are:

[0045] OsMKK1-RT-F:CTTCTGCTCCATCAGACCAG

[0046] OsMKK1-RT-R:ATTGAAGGTGGCAAGCGGA

[0047] The internal reference gene is OsUBQ5, and the internal reference primers are:

[0048] OsUBQ5-F:CTCGCCGACTACAACATCCA

[0049] OsUBQ5-R:TCTTGGGCTTGGGTGACGTCTT

[0050] The results are as follows Figure 2 As shown, the OsMKK1 gene in the OsMKK1 knockout mutant (Osmkk1) is significantly downregulated compared to NIP.

[0051] Example 3: Obtaining OsMKK1 Functional Acquisition Material

[0052] (1) Construction of OsMKK1 functional gain carrier

[0053] The S / T residues in the conserved region S / TxxxS / T of MAPKK can be phosphorylated by upstream MAPKKK. When we mutate S / T to aspartic acid (D), MAPKK can mimic the activated state and continuously activate downstream MAPKs. Based on this principle, we mutated serine at position 215 and threonine at position 219 of OsMKK1 to aspartic acid, naming it OsMKK1. DD And drive OsMKK1 with a 35S starter. DD Expression was performed to achieve overexpression. This study used cDNA from the rice variety Nipponbare as a template and employed overlap PCR to amplify the mutant OsMKK1. DD (Full-length gene is 1059 bp). When designing primers, the F-terminal primer is fused with the Flag sequence, and high-fidelity DNA polymerase OsMKK1 is used. DD Using the PCR product as a template, Flag-OsMAPKK1 was amplified. DD The full length of the pCambia vector was determined. PCR products were recovered by electrophoresis, digested with restriction endonucleases BamHI and KpnI, and the digested products were recovered by electrophoresis. Simultaneously, the modified pCambia vector backbone was digested and recovered with BamHI and KpnI. The recovered digested products and the vector fragment were ligated overnight at a molar ratio of approximately 3:1 using T4 ligation. The next day, the ligation product was transformed into *E. coli* DH5α and cultured overnight at 37°C to obtain single clones. Single clones were then selected and cultured overnight in LB medium containing kanamycin. Plasmids were extracted, identified by restriction enzyme digestion, and sequenced for verification. The correct plasmid was transformed into *Agrobacterium* for rice transgenication, yielding 35Spro:OsMKK1. DD Positive plants showed significant protein expression as detected by Western blot. Figure 4 Primers used for construction:

[0054] OsMKK1-CDS-F:

[0055] 5'-NNN GGATCC ATGgactacaaggacgacgatgacaagGGGAAGCCGGGGAAGCTA-3'

[0056] OsMKK1-CDS-R: 5'-TCGAGCTAAGCTTGCATGC CTGCAG NNN-3'

[0057] Example 4: Functional analysis of the OsMKK1 gene.

[0058] (1) Wild-type (NIP), knockout mutant (Osmkk1) and overexpression line (OsMKK1) DD Resistance analysis after inoculation with bacterial blight pathogen.

[0059] Rice seedlings were cultured in a rice greenhouse at 28℃, with 14 hours of light, 8 hours of darkness, and 70% humidity for approximately 3 weeks. Leaf cuttings were then used to inoculate the bacterial blight pathogen (PXO99), with the pathogen's OD adjusted to approximately 0.5. The second-to-last leaf was used for inoculation, cut 2-3 cm from the leaf tip. Thirty plants were inoculated at a time, including mutants, overexpressing strains, and wild-type plants. After inoculation, the plants were placed in a 90% humidity incubator for disease observation. Statistical results after 14 days showed that, compared to the wild-type (NIP), the knockout mutant and overexpressing lines of this invention had significantly shorter lesion lengths (P<0.01, three biological replicates). Osmkk1 mutant and OsMKK1... DD Overexpression of this gene can improve the resistance of rice to bacterial blight pathogen. Figure 3 A, B, Figure 5 ).

[0060] (2) Analysis of the number of pathogens causing bacterial blight in the OsMKK1 knockout mutant (Osmkk1)

[0061] Rice seedlings were cultured in a rice greenhouse at 28℃ with 14 hours of light, 8 hours of darkness, and 70% humidity for approximately 3 weeks. Leaf cuttings were then used to inoculate the bacterial blight pathogen (PXO99) to analyze the growth of the pathogen. Rice leaves were harvested at 4 and 12 days after inoculation, with three leaves per replicate for a total of three replicates. First, leaves from both the NIP and knockout mutant (Osmkk1) were cut to the same length and soaked in 75% alcohol for 1 minute, followed by immersion in sterile water for 1 minute to remove excess alcohol. Then, 1 ml of sterile water was added to a sterile mortar to homogenize the mixture. The homogenate was then transferred to EP tubes and shaken at 1500 rpm for 10 minutes. Finally, the homogenate was serially diluted on a clean bench and spread onto NA+Kan medium. The mixture was then incubated in the dark at 28℃ for 2-3 days, after which bacterial colony counts were recorded. A curve was plotted using the logarithmic value of the bacterial blight colony count per leaf. The results showed that after inoculation with the pathogenic race PXO99 of bacterial blight pathogen, the number of bacterial blight pathogens in Osmkk1 was significantly lower than that in NIP ( Figure 3 C).

[0062] (3) Wild-type (NIP), knockout mutant (Osmkk1), and overexpression line (OsMKK1) DD Resistance analysis after inoculation with rice blast fungus.

[0063] Place the bacterial-containing paper discs, preserved at -80℃, onto a universal culture medium and incubate at 28℃ for 5 days. On a clean bench, use a sterilized knife to cut a small piece of the outermost layer of mycelium from the medium and place it upside down on a sporulation plate. Incubate at 28℃ for 3-5 days. Then, scrape off the surface mycelium with a freshly sterilized pipette tip or knife. Finally, place the plate under black light for sporulation for 4-5 days. After 4-5 days, add an appropriate amount of water (2-3 ml) to the sporulation medium. Scrape off the spore mycelium using a 1.5 ml centrifuge tube, transfer the solution to special filter paper, filter it into a centrifuge tube, and then take 10 μL of the bacterial solution. Count the bacterial cells on a hemocytometer and adjust the concentration to 1 x 10⁻⁶. 5 -2x10 5 Add 4% gelatin mother liquor (4g / ml water) to a suitable concentration of spore solution, i.e., add 200μl of gelatin mother liquor to 4ml of spore solution, and complete the spray inoculation within 2 hours. The rice seedlings were grown in a greenhouse at 28℃, with 14 hours of light, 8 hours of darkness, and 70% humidity, and were 10-14 days old. Before spray inoculation, the dark box was moistened. After evenly spraying the prepared bacterial solution onto the rice leaves (4ml of bacterial solution per seedling), the seedlings were carefully transferred to the dark box and kept in darkness and moist for 24 hours. Afterward, the rice seedlings were transferred to a light box, where sufficient moisture was maintained, and the leaves were sprayed at least 3 times a day. Disease statistics were collected after 2-3 days. The results showed that compared with the wild type (NIP), the lesion area of ​​the Osmkk1 knockout mutant and the overexpression line was significantly reduced (P<0.01), and the resistance to rice blast pathogen was enhanced. Figure 6 ,7).

Claims

1. The application of the OsMKK1 gene shown in SEQ ID NO.1 in improving rice resistance to bacterial blight, characterized in that, The target sequence for gene knockout was designed on the third exon from positions 1061 to 1198 of SEQ ID NO.1 using the CRISPR-Cas9 system. The target sequence is 5'-ATCTAAAGGTTCTATAGGAG. GGG -3'.

Images