Use of miRNA in exosome in preparation of differential diagnosis and early screening kit for neurodegenerative diseases

Abstract

The application discloses use of miRNA in exosomes in preparation of a reagent kit for differential diagnosis and early screening of a neurodegenerative disease. The application provides use of a substance for detecting expression of miR-24-3p, miR-423-5p and / or miR-151a-3p genes in exosomes in preparation of a product for identifying or assisting in identifying or diagnosing or assisting in diagnosing a neurodegenerative disease. The early screening reagent kit for the neurodegenerative disease developed by the application has high sensitivity and high specificity, and the indicators of hsa-miR-24-3p, hsa-miR-423-5p and hsa-miR-151a-3p. Therefore, the extraction method and the detection indicators are combined, and due to the minimally invasive, easy detection, repeated sampling and real-time dynamic detection, the application is helpful for reflecting the differential diagnosis and disease state of Alzheimer and vascular dementia patients in real time, so that more individualized treatment measures can be timely made.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the use of exosome miRNA in the preparation of kits for the differential diagnosis and early screening of neurodegenerative diseases. Background Technology

[0002] The 2021 World Alzheimer's Report indicates that there are at least 60 million people worldwide suffering from Alzheimer's disease and other dementias, a number projected to reach 152 million by 2050. Of these, approximately 60-70% are Alzheimer's patients. Globally, about 75% of dementia cases remain undiagnosed, reaching as high as 90% in low- and middle-income countries. According to my country's 2021 census, the population aged 60 and above is 260 million, accounting for 13.50% of the total population. The prevalence of Alzheimer's disease among those aged 65 and above in my country is 7%, exceeding 10 million, nearly a quarter of the global total, ranking first in the world. This number is projected to surpass 40 million by 2050. The incidence of vascular dementia is approximately 3%, with 5.92 million patients. Early diagnosis and intervention of a series of dementia-related diseases, including vascular dementia and Alzheimer's disease, pose a huge public health problem among the middle-aged and elderly population and are also an important direction of my country's Healthy China strategy.

[0003] Given the large number of Alzheimer's patients, cost-effective and convenient screening and differential diagnostic methods are particularly important. To implement the "Healthy China Action (2019-2030)" plan, the General Office of the National Health Commission issued the "Work Plan for Exploring Characteristic Services for the Prevention and Treatment of Alzheimer's Disease" on August 31, 2020, marking the official launch of my country's first national-level Alzheimer's disease prevention and control plan. Universal screening, early identification of high-risk and diseased populations, and accurate early diagnosis and differential diagnosis are crucial for precise prevention and control strategies for both Alzheimer's and vascular dementia.

[0004] Correspondingly, research into simple, convenient, and accurate diagnostic methods is crucial. Scale-based neuropsychological examinations are highly subjective and heavily influenced by the physician's skill level, are time-consuming, and difficult to popularize. The clinical application of cerebrospinal fluid biomarker testing is also challenging. Imaging techniques, such as transcranial Doppler ultrasound (TCD), head X-ray computed tomography (CT), magnetic resonance imaging (MRI), and positron emission tomography (PET), can be used for the auxiliary diagnosis of Alzheimer's and vascular dementia. However, these methods are expensive, require costly equipment, are difficult to popularize, and cannot reflect early-stage disease. Blood tests yield a limited number of biomarkers. In summary, the disadvantages of these technologies are: 1) difficulty in early diagnosis and differential diagnosis of Alzheimer's and vascular dementia; 2) lack of universal screening applicability due to various reasons; 3) insufficient sensitivity and specificity of the test results; and 4) high skill requirements for physicians.

[0005] Liquid biopsy technology can solve this problem by detecting and analyzing molecules in bodily fluids, allowing for non-invasive and repeated sampling. Exosomes are extracellular vesicles with a diameter ranging from 30 to 150 nm, possessing a lipid bilayer structure. They can transfer bioactive molecules such as proteins, lipids, and nucleic acids (miRNA, lncRNA, circRNA) to recipient cells and are widely distributed in bodily fluids such as blood, saliva, breast milk, and urine. Exosomes have the ability to cross the blood-brain barrier, thus they can be used to screen for biomarkers related to neurodegenerative diseases. Unlike other liquid biopsy methods such as circulating tumor cells (CTCs), which require fresh samples for research, exosomes remain morphologically stable in well-preserved old samples.

[0006] Therefore, developing rapid and effective methods for the isolation and detection of exosomes miRNAs is crucial for clinical applications. Summary of the Invention

[0007] One object of the present invention is to provide a substance for detecting the expression levels of the miR-24-3p, miR-423-5p and / or miR-151a-3p genes in exosomes.

[0008] This invention provides the application of substances for detecting the expression levels of miR-24-3p, miR-423-5p, and / or miR-151a-3p genes in exosomes in the preparation of products for identifying or assisting in the identification or diagnosis of neurodegenerative diseases.

[0009] In the above applications, the neurodegenerative diseases are Alzheimer's disease, vascular dementia, and / or frontotemporal dementia.

[0010] Alternatively, this invention provides the use of substances for detecting the expression levels of miR-24-3p, miR-423-5p, and / or miR-151a-3p genes in exosomes in the preparation of products for screening or assisting in the screening of Alzheimer's patients, vascular dementia patients, and / or frontotemporal dementia patients.

[0011] Alternatively, this invention provides the use of substances for detecting the expression levels of miR-24-3p, miR-423-5p, and / or miR-151a-3p genes in exosomes in the preparation of products that differentiate or assist in differentiating Alzheimer's patients, vascular dementia patients, and / or frontotemporal dementia patients.

[0012] In the above applications, the exosomes are derived from the subject's bodily fluids.

[0013] Furthermore, the aforementioned bodily fluids specifically refer to the subject's saliva, blood, or urine.

[0014] In the above applications, the substances used to detect the expression levels of miR-24-3p, miR-423-5p, and / or miR-151a-3p genes in exosomes include antibodies or probes that specifically bind to each gene, or primer pairs that specifically amplify each gene.

[0015] In the above applications, the primer pair for specifically amplifying the miR-24-3p gene consists of a single-stranded DNA molecule as shown in sequence 4 and a single-stranded DNA molecule as shown in sequence 7;

[0016] The primer pair for specifically amplifying the miR-423-5p gene consists of a single-stranded DNA molecule as shown in sequence 5 and a single-stranded DNA molecule as shown in sequence 7;

[0017] The primer pair for specifically amplifying the miR-151a-3p gene consists of single-stranded DNA molecules shown in sequence 6 and sequence 7.

[0018] The substances mentioned above for detecting the expression levels of various genes in exosomes also include primers for specifically amplifying internal reference genes;

[0019] The aforementioned internal reference genes are miR181a-5p or miR-378a-3p.

[0020] hsa-miR181a-5p miRNA forward primer (5-3): ACATTCAACGCTGTCGGTGAGT;

[0021] hsa-miR-378a-3p miRNA forward primer (5-3): AACACGCTGAGATGAAGCACTG;

[0022] Universal reverse (downstream) primer (5'-->3'): CAGTGCAGGGTCCGAGGT (sequence 7).

[0023] The primers for the specific amplification of the hsa-miR181a-5p gene consist of a forward primer for hsa-miR181a-5p miRNA and a universal reverse (downstream) primer.

[0024] The primers for the specific amplification of the hsa-miR-378a-3p gene consist of a forward primer for hsa-miR-378a-3p miRNA and a universal reverse (downstream) primer.

[0025] The use of miR-24-3p, miR-423-5p, and / or miR-151a-3p as markers in the development or design of any of the following products is also within the scope of protection of this invention:

[0026] 1) Products for identifying or assisting in the identification or diagnosis of neurodegenerative diseases;

[0027] 2) Products for screening or assisting in the screening of Alzheimer's patients, vascular dementia patients and / or frontotemporal dementia patients;

[0028] 3) Products that differentiate or help differentiate between Alzheimer's patients, vascular dementia patients, and / or frontotemporal dementia patients.

[0029] Another object of the present invention is to provide a product.

[0030] The product provided by this invention includes the substance mentioned in the first objective above for detecting the expression levels of miR-24-3p, miR-423-5p, and / or miR-151a-3p genes in exosomes;

[0031] The product has any of the following functions:

[0032] 1) Products for identifying or assisting in the identification or diagnosis of neurodegenerative diseases;

[0033] 2) Products for screening or assisting in the screening of Alzheimer's patients, vascular dementia patients and / or frontotemporal dementia patients;

[0034] 3) Products that differentiate or help differentiate between Alzheimer's patients, vascular dementia patients, and / or frontotemporal dementia patients.

[0035] In the above text, the groups identified or assisted in the identification or diagnosis are patients with neurodegenerative diseases or suspected patients with neurodegenerative diseases.

[0036] The aforementioned screening or auxiliary screening targets patients with neurodegenerative diseases or suspected patients with neurodegenerative diseases.

[0037] The aforementioned products also include reagents for extracting exosomes from body fluids and reagents for lysing exosomes to obtain RNA.

[0038] In the above text, the reagents used to extract exosomes from body fluids include iron(II) tetroxide-titanium dioxide magnetic beads; the extraction method is described in the examples.

[0039] Reagents for obtaining RNA from exosomes by lysis include RNA-capturing magnetic beads; extraction methods are described in the examples.

[0040] The aforementioned bodily fluids specifically refer to saliva and urine or serum.

[0041] This invention relates to the rapid extraction and amplification of miRNA target markers contained in exosomes based on saliva, urine, and serum. Specifically, it includes (1) enriching exosomes from diluted serum matrix, urine stock solution, or saliva stock solution using magnetic iron tetroxide-oxide nanoparticle enrichment method; (2) enriching and purifying the miRNA targets contained in exosomes using RNA magnetic beads method; (3) using the A-addition method to perform reverse transcription-quantitative polymerase chain amplification experiment to realize the detection of target miRNAs; (4) locking a set of key targets through disease correspondence and detecting them in urine and saliva, which has good performance in early screening and differential diagnosis of neurodegenerative diseases.

[0042] The beneficial effects of this invention are as follows:

[0043] (1) Exosomes exist in complex matrices. Their separation techniques mainly include ultracentrifugation, ultrafiltration, immunoaffinity capture, polymer precipitation, size exclusion chromatography, and microfluidics, each with its own advantages and disadvantages, but all are time-consuming and laborious. Human peripheral blood contains a large amount of serum lipoproteins, glycoproteins, and ferritin, whose size is similar to that of exosomes. In addition, saliva contains a large amount of mucin, which can interfere with subsequent extraction and detection. The present invention relates to a convenient extraction method for exosomes and their contained miRNAs. Through dilution and enrichment, it can reduce interfering factors, increase the concentration of exosome target substances, and reach the detection limit, thereby overcoming the shortcomings of traditional exosome extraction methods. The extraction process of this invention is simple and easy to operate, suitable for non-invasive collection of body fluids, and can improve the detection sensitivity for biomarkers with low concentrations in exosomes. It can obtain exosomes and their contained stable miRNA biomarkers better and faster, and is suitable for liquid diagnostic monitoring technology in large-sample surveys and screenings.

[0044] (2) This invention addresses the urgent needs and pain points in the clinical and healthcare markets, primarily resolving the problems and bottlenecks of traditional imaging and neuropsychological examinations based on anatomical structures currently used in clinical practice. The neurodegenerative disease early screening kit developed in this invention uses hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p as indicators, exhibiting high sensitivity and specificity. Therefore, the extraction method of this invention, combined with the detection indicators, is minimally invasive, easy to detect, and allows for repeated sampling, facilitating real-time dynamic monitoring of the differential diagnosis and disease status of Alzheimer's and vascular dementia patients, thereby enabling timely development of more individualized treatment measures. Attached Figure Description

[0045] Figure 1 This is an image showing the results of electron microscopy of exosomes.

[0046] Figure 2 The image shows the results of Western blot detection of marker proteins in exosomes.

[0047] Figure 3 The results of miRNA microarray screening are shown in the top and bottom graphs. The top graph shows the expression levels of miRNAs in urine, and the bottom graph shows the expression levels in saliva. The horizontal axis represents the expression level in the normal control group, and the vertical axis represents the expression level in the AD / VaD group. Each point represents a miRNA. The points between the two lines represent miRNAs with no significant difference in expression levels between the two groups. Points above the lines represent miRNAs with higher expression levels in the AD / VaD group than in the normal control group, and points below the lines represent miRNAs with lower expression levels in the AD / VaD group than in the normal control group.

[0048] Figure 4 This diagram illustrates the expression levels of the internal reference gene in extracellular vesicles of different tissues and cells.

[0049] Figure 5 Melting curves of target genes hsa-miR-24-3p, hsa-miR-423-5p, hsa-miR-151a-3p, and internal reference genes hsa-miR-181a-5p and hsa-miR-378a-3p.

[0050] Figure 6 This diagram illustrates the batch-to-batch differences in amplification of target genes hsa-miR-24-3p, hsa-miR-423-5p, hsa-miR-151a-3p and internal reference genes hsa-miR-181a-5p and hsa-miR-378a-3p within exosomes.

[0051] Figure 7A comparison of the expression levels of target genes hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p in salivary and urinary exosomes in Alzheimer's disease patients and normal individuals.

[0052] Figure 8 The graph shows the relative expression results of hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p miRNAs in salivary exosomes of normal individuals, Alzheimer's disease (AD), vascular dementia (VaD), and frontotemporal dementia (FTD).

[0053] Figure 9 ROC curves were plotted to differentiate normal controls (30 cases) and AD (30 cases), VaD (20 cases) and FTD (5 cases) in saliva hsa-miR-24-3p miRNA.

[0054] Figure 10 ROC curves for differentiating hsa-miR-151a-3pmiRNA in saliva from normal controls (30 cases) and AD (30 cases), VaD (20 cases) and FTD (5 cases).

[0055] Figure 11 ROC curves for differentiating hsa-miR-423-5p miRNA in saliva from normal controls (30 cases) and AD (30 cases), VaD (20 cases) and FTD (5 cases). Detailed Implementation

[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0057] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0058] Example 1: Screening of miRNAs to differentiate between Alzheimer's patients, vascular dementia patients, and healthy volunteers.

[0059] The samples used in this embodiment consisted of saliva, urine, and blood from 10 Alzheimer's patients, 10 patients with vascular dementia, and 10 healthy volunteers. Age, sex, and history of complications were matched between different groups.

[0060] I. Oxide enrichment method for exosome enrichment and RNA extraction

[0061] 1. Experimental reagents

[0062] ① Washing buffer: 20mM Tris-HCl, 150mM NaCl, 10mM CaCl2, with the remainder being water;

[0063] ② Washing and collection solution: 0.01mM PBS, pH 7.2

[0064] Zirconia-coated magnetite beads were prepared by chemical coprecipitation as follows: FeSO4·7H2O (final concentration 0.18 mol / L) and FeCl3·6H2O (final concentration 0.12 mol / L) were dissolved in a water-anhydrous ethanol mixture (volume ratio = 5:1), and the mixture was stirred at 800 rpm while purging with nitrogen for 30 min. The temperature was then raised to 70 °C, and 25% (v / v) ammonia solution was added while stirring to adjust the pH of the mixture to 10–11. Stirring was continued for 15 min, and then 8.5% (w / v) zirconium oxychloride octahydrate (final concentration) was slowly added dropwise. The mixture was heated to 80 °C and reacted at this temperature for 90 min. After the reaction solution was allowed to stand and cool to 30℃, magnetic particles were adsorbed using an external magnetic field (3000 Gauss). The supernatant was removed, and the solution was washed three times with deionized water. The mixture was then freeze-dried under vacuum to obtain zirconium dioxide-coated magnetite beads (particle size 80-120 nm, bulk density 0.8-1.0 g / cm³). 3 ).

[0065] ③ Pretreatment solution: 70% ethanol aqueous solution;

[0066] ④ Loading buffer / equilibration buffer: 10mM citric acid (pH=6) buffer (solvent is water);

[0067] ⑤ Elution buffer: 0.01% (volume percentage) ammonia water, pH=10.

[0068] 2. Experimental steps for extracting miRNAs from exosomes in saliva, urine, and blood:

[0069] Recommended sample size range: 1-2 mL of saliva, 1-2 mL of urine; 500 μL of serum (diluted twice with washing buffer before loading).

[0070] (1) Magnetic bead suspension: The self-made iron tetroxide-titanium dioxide magnetic beads in step 1 above were prepared into a magnetic bead suspension of 50 mg / ml using 20% ​​ethanol aqueous solution (volume percentage).

[0071] (2) Balanced magnetic beads:

[0072] ① Take 500 μl (25 mg) of magnetic bead suspension for each sample, place the centrifuge tube on a magnetic separator, let it stand for 30 s, and discard the supernatant. Gently wash the magnetic beads with 500 μl of 70% ethanol aqueous solution (pretreatment solution) for 5 min, place the centrifuge tube on a magnetic separator, let it stand for 30 s, and discard the supernatant. Repeat the washing once.

[0073] ② Wash the magnetic beads with 500 μl of elution buffer for 10 min, place the centrifuge tube on the magnetic separator, let it stand for 30 s, and discard the supernatant.

[0074] ③ Equilibrate the magnetic beads with 500 μl of loading buffer for 60 seconds, place the centrifuge tube on the magnetic separator, let it stand for 30 seconds, and discard the supernatant. Repeat the equilibration process three times.

[0075] (3) Capture exosomes

[0076] ① Add the sample to the equilibrated magnetic beads, suspend, and incubate at room temperature for 20 minutes. Place the centrifuge tube on the magnetic separator, let stand for 30 seconds, and discard the supernatant.

[0077] ②Incubate with 100 μl of elution buffer for 40 min, perform magnetic separation, transfer the supernatant to a new centrifuge tube to obtain the exosome solution.

[0078] (4) Capture RNA

[0079] ① Add 200 μl of RNA capture magnetic beads (Novizan Biotechnology Co., Ltd., N412-01) to the exosome solution obtained in the previous step, mix well by pipetting, and incubate at room temperature for 5 min. Place the centrifuge tube on a magnetic separator, let it stand for 30 seconds, discard the supernatant, and retain the RNA capture magnetic beads.

[0080] ② Add 500 μl of freshly prepared 80% ethanol aqueous solution to rinse the magnetic beads, incubate at room temperature for 30 seconds, carefully remove the supernatant, and repeat the rinsing once.

[0081] ③ After the magnetic beads are exposed to air and dried naturally, add an appropriate volume of Nuclease-free H2O, mix well by blowing and incubating at room temperature for 5 minutes to obtain a magnetic bead suspension.

[0082] After placing the magnetic bead suspension on a magnetic rack for 5 minutes, the supernatant was transferred to a new centrifuge tube to obtain exosomal RNA.

[0083] II. Identification of exosomes and their contained miRNAs in saliva, urine, and blood.

[0084] 1. Identification of exosomes in saliva, urine, and blood

[0085] Since the serum / plasma (sodium citrate blood collection tube) cannot be eluted after being enriched with oxides after passing through the column, the resulting product is a conjugate of exosomes and oxides. Therefore, we chose to characterize them separately. The first step was to perform an electron microscopy experiment on the exosome solution after removing lipoproteins from the column. The second step was to perform a Western blot experiment using specific markers. The experiment proved that the oxides did indeed effectively enrich the exosomes.

[0086] 1) Electron microscopy experiment: First, the exosome solution obtained in (3) above was fixed with 0.01mM PBS containing 2.5% (volume percentage) glutaraldehyde at pH 7.2. 20μl was dropped onto a 200-mesh copper mesh Formvar carbon support membrane (Zhongjing Keyi, BZ20022a) and left to stand for 10min. The excess solution was blotted dry with filter paper. The membrane was negatively stained with saturated uranium acetate solution at room temperature for 1min. The remaining solution was blotted dry with filter paper and then characterized by transmission electron microscopy.

[0087] All samples were analyzed, and exosomes were obtained from each sample. Electron microscopy results of exosomes from the saliva of one Alzheimer's patient are shown below. Figure 1 As can be seen, exosomes were obtained.

[0088] 2) Western blot assay

[0089] 30 μl of exosome solutions from serum and saliva were added to loading buffer containing reducing agent, separated by 12% SDS-PAGE, and transferred to 0.45 μm PVDF membranes using a semi-dry transfer apparatus. The membranes were blocked for 1 h at room temperature with blocking buffer containing 5% bovine serum albumin. Exosome marker protein antibodies anti-TSG101 (1:1000, Abcamab125011) and anti-CD81 (1:200, Abcamab79559) were added, and the membranes were incubated overnight at 4 °C. After elution with 1×TBST buffer, HRP-labeled secondary antibody goat anti-mouse IgG antibody (1:5000, Zhongshan Jinqiao ZB-5305) was added and incubated for 90 min at room temperature. After washing three times with TBST, the membranes were developed.

[0090] Test results as follows Figure 2 As shown, the expression of the marker proteins TSG101 and CD81 from exosomes in serum and saliva was successfully detected, indicating that exosomes were successfully extracted.

[0091] The same method was used for detection, and exosomes were extracted from all samples using the above method.

[0092] 2. Identification of miRNAs contained in exosomes in saliva and urine

[0093] 1) Reverse transcription

[0094] The exosomal RNAs obtained from saliva and urine were reverse transcribed into cDNA as follows: poly(a)-tailing was performed using poly(a) polymerase and ATP to reverse transcribe the miRNAs. The miRcute enhanced miRNA cDNA first-strand synthesis kit (KR211, Tiangen Biotech) was used to ensure simultaneous and efficient poly(A) modification of the miRNA 3' end and reverse transcription. The miRNA reverse transcription system was prepared as follows: 5 μl of 2X RT buffer, 1 μl of RTmix (enzyme and reverse transcription primers), and 4 μl of RNA template, for a total of 10 μl.

[0095] It contains universal reverse transcription primers: CAGTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTVNVN = V: A, C, G; N: A, C, G, and T;

[0096] The reverse transcription procedure is as follows: miRNA A-tailing reaction and reverse transcription reaction are performed at 42℃ for 60 min; enzyme inactivation reaction is performed at 95℃ for 3 min.

[0097] 2) miRNA microarray screening

[0098] The miRNA array (Agilent Human miRNA (8*60K) array) was analyzed by Shanghai Bio-Tech Co., Ltd.

[0099] The exosomal RNAs obtained from saliva and urine were detected using a miRNA microarray.

[0100] Chip screening results as follows Figure 3 As shown, the chip screening results revealed statistically significant differences in the saliva and urine samples of target genes hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p among 10 Alzheimer's patients, 10 vascular dementia patients, and 10 normal volunteers.

[0101] Therefore, the target genes hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p can serve as biomarkers to distinguish normal volunteers from Alzheimer's patients or patients with vascular dementia.

[0102] Example 2: Establishment of a method for screening Alzheimer's patients, vascular dementia patients, and healthy volunteers.

[0103] I. Selection of Internal Reference Genes

[0104] 5S and U6 were excluded from the recommended reference genes in genomics. Based on their high abundance in exosomes, stable expression, and compatibility with various substrates, miR181a-5p and miR378a-3p were selected as quantitative standards for urine, saliva, and blood exosomes, as well as for subsequent selection of internal reference genes. For specific content details, please refer to [link to relevant documentation]. Figure 4 The top figure shows the expression levels of miR181a-5p in various extracellular vesicles, and the bottom figure shows the expression levels of miR378a-3p in various extracellular vesicles.

[0105] II. Establishment of qPCR detection methods for screening Alzheimer's patients, vascular dementia patients, frontotemporal dementia patients, and normal volunteers.

[0106] 1. Obtain RNA from exosomes

[0107] RNA was obtained according to the method of Example 1.

[0108] 2. Reverse transcription yields cDNA;

[0109] 3. qPCR detection

[0110] Using the above cDNA as a template, qPCR detection was performed using the following primers and detection system:

[0111] To avoid the inhibition of the quantitative PCR reaction by the reverse transcription system and obtain a suitable Ct value (between 15 and 28) when performing downstream quantitative fluorescence detection, the cDNA reaction solution can be diluted 10 to 100 times before use.

[0112] use The principle of Green I chimeric fluorescence assay is used for quantitative detection of miRNA fluorescence.

[0113] Used in R&D qPCR SYBR Green Master Mix (Low ROX Premixed) (Q131, Novozymes).

[0114] The above qPCR detection system is as follows: 2×AceQ qPCR SYBR Green Master Mix 10μl; F (miRNA forward primer) 0.4μl; Rp (universal qPCR reverse primer) 0.4μl; reverse transcription cDNA template 4μl; ddH2O 5.2μl, total 20μl system.

[0115] The primer sequences are as follows:

[0116] The target gene hsa-miR-24-3p miRNA sequence is: UGGCUCAGUUCAGCAGGAACAG (Sequence 1)

[0117] hsa-miR-24-3p miRNA forward primer (5-3): AGTGGCATGGCTCAGTTCAG (Sequence 4)

[0118] The target gene hsa-miR-423-5p miRNA sequence is: UGAGGGGCAGAGAGCGAGACUUU (Sequence 2)

[0119] hsa-miR-423-5p miRNA forward primer (5-3): AACAGTGTGAGGGGCAGAGAG (Sequence 5)

[0120] The target gene hsa-miR-151a-3 pmiRNA sequence is: CUAGACUGAAGCUCCUUGAGG (Sequence 3)

[0121] hsa-miR151a-3p miRNA forward primer: AACCACTCTAGACTGAAGCTCCT (Sequence 6)

[0122] Internal reference gene hsa-miR-181a-5p miRNA sequence: AACAUUCAACGCUGUCGGUGAGU

[0123] hsa-miR181a-5p miRNA forward primer (5-3): ACATTCAACGCTGTCGGTGAGT

[0124] Internal reference gene hsa-miR-378a-3p miRNA sequence: UGAGAUGAAGCACUGUAGCUC

[0125] hsa-miR-378a-3p miRNA forward primer (5-3): AACACGCTGAGATGAAGCACTG

[0126] Universal reverse (downstream) primer (5'-->3'): CAGTGCAGGGTCCGAGGT (Sequence 7)

[0127] Each of the above genes and the universal reverse (downstream) primers are used to form primer pairs for amplification.

[0128] The above qPCR program is as follows: 95℃ for 15 min, 5 pre-amplification cycles (94℃ for 20 s, 63℃ for 30 s, and 72℃ for 34 s), 35 cycles (94℃ for 20 s, and 60℃ for 34 s), plate read; Melting curve analysis; END.

[0129] Real-time quantitative PCR was performed using an Applied Biosystems 7500 Real-Time PCR System. The data were processed using the ΔΔCT method to obtain the expression levels of hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p (relative to the expression level of the hsa-miR181a-5p internal reference gene).

[0130] Data were processed using Prism 9.0 software. Independent samples t-tests were used to compare data between groups, and a p-value < 0.05 was considered statistically significant.

[0131] In saliva and urine, the expression levels of the three indicators hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p all showed varying degrees of increase in Alzheimer's patients, vascular dementia patients, and frontotemporal dementia patients. The expression levels were expressed in folds, with 10-fold as the threshold. A positive result was defined as a fold change of more than 10-fold relative to the normal population (patients without neurodegenerative diseases and other diseases).

[0132] The fold represents the ratio of the expression level of the indicator in patients to the expression level in the normal population.

[0133] Therefore, based on the expression levels of hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p in each subject detected by the above-mentioned QPCR, the ratio of the expression level of each gene in the subject to the corresponding gene expression level in normal individuals is calculated and recorded as the multiple of a certain gene.

[0134] If the fold increase of the hsa-miR-24-3p, hsa-miR-423-5p, or hsa-miR-151a-3p gene in a subject is greater than 10, then the subject is or is a candidate for a neurodegenerative disease; if the fold increase is less than or equal to 10, then the subject is or is not a candidate for a neurodegenerative disease.

[0135] Alternatively, if the fold increase of the hsa-miR-24-3p, hsa-miR-423-5p, or hsa-miR-151a-3p gene in a subject is greater than 10, then the subject is or is a candidate for a neurodegenerative disease; if the fold increase is less than or equal to 10, then the subject is or is not a candidate for a neurodegenerative disease.

[0136] Further investigation was conducted to determine the relative expression of hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p miRNAs in the salivary exosomes of MCI-eAD, VaD, and FTD. The threshold lines for distinguishing the three types of diseases by hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p miRNAs in saliva were shown in Table 1.

[0137] Table 1 shows the threshold ranges (in folds) of three miRNAs in saliva for different diseases.

[0138]

[0139] In the table above, the range determination method is as follows: numbers on the left are not included in the range, while numbers on the right are included. For example, 45~80 means greater than 45 and less than or equal to 80, excluding 45 and including 80.

[0140] Therefore, the fold increase of hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p miRNAs in salivary exosomes can be used to distinguish between MCI-eAD, VaD, and FTD.

[0141] If the fold increase of the hsa-miR-24-3p gene in the salivary exosomes of a subject is 10-20, then the subject is or is a candidate for AD.

[0142] Alternatively, if the fold increase of the hsa-miR-24-3p gene in the salivary exosomes of a subject is 30-60, then the subject is or is a candidate for VaD.

[0143] Alternatively, if the fold increase of the hsa-miR-24-3p gene in the salivary exosomes to be tested is 60-100, then the subject is or is a candidate for FTD;

[0144] Alternatively, if the fold increase of the hsa-miR-423-5p gene in the salivary exosomes of a subject is 80-120, then the subject is or is a candidate for AD.

[0145] Alternatively, if the fold increase of the hsa-miR-423-5p gene in the salivary exosomes of a subject is 60-80, then the subject is or is a candidate for VaD.

[0146] Alternatively, if the fold increase of the hsa-miR-423-5p gene in the salivary exosomes of a subject is 10-60, then the subject is or is a candidate for FTD.

[0147] Alternatively, if the fold increase of the hsa-miR-151a-3p gene in the salivary exosomes of a subject is 10-45, then the subject is or is a candidate for AD.

[0148] Alternatively, if the fold increase of the hsa-miR-151a-3p gene in the salivary exosomes of a subject is 45-80, then the subject is or is a candidate for VaD.

[0149] Alternatively, if the fold increase of the hsa-miR-151a-3p gene in the subject's salivary exosomes is 80-120, then the subject is or is a candidate for FTD.

[0150] The above numerical range indicates that the numbers on the left are not included in the range, while the numbers on the right are included.

[0151] III. Stability Testing of qPCR Detection Method

[0152] Following the method described in Example 2, multiple batches of exosomes and their containing miRNAs were extracted from the same sample (e.g., from the saliva of a normal volunteer), and amplification was performed between different batches using the method described in Example 2. Each experiment was repeated 6 times.

[0153] The specificity of the amplification method was demonstrated by melting curves. Figure 5 This indicates that the negative control (cDNA template replaced with water) did not amplify during qPCR amplification to demonstrate primer amplification specificity.

[0154] Repeatability is expressed as the difference between batches within different amplification days. A good qPCR system should have a batch-to-batch variability of less than 8%. For example, the batch-to-batch variability of target genes hsa-miR-24-3p, hsa-miR-423-5p, hsa-miR-151a-3p, and internal reference genes hsa-miR-181a-5p and hsa-miR-378a-3p can be found in [link to relevant documentation]. Figure 6 .

[0155] IV. Sensitivity and Specificity of Clinical Sample Testing for Diagnosing Mild Cognitive Impairment (MCI) to Early-Mid-Stage Alzheimer's Disease (eAD) using Saliva and Urine Samples

[0156] The samples to be tested were saliva and urine samples from 20 patients with mild cognitive impairment (MCI) - early-mid Alzheimer's disease (eAD) (also known as MCI-eAD) and 20 normal volunteers.

[0157] The detection was performed according to the method in Example 2.

[0158] The results are as follows Figure 7As shown, based on the RT-qPCR method, the relative expression levels of the target genes hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p in saliva and urine were increased to varying degrees compared with healthy individuals in MCI-eAD (sample size n=20 per group, *** indicates statistical difference P<0.001, ** indicates statistical difference P<0.01), with expression levels ranging from 10 to 70-fold. Therefore, it is demonstrated that the expression level of these genes can be used to effectively diagnose Alzheimer's disease.

[0159] V. Sensitivity and specificity of saliva samples in the auxiliary differential diagnosis of MCI-eAD, vascular dementia (VaD), and other types of dementia (such as frontotemporal dementia, FTD).

[0160] The samples to be tested were saliva samples from 30 normal volunteers and 55 patients with neurodegenerative diseases. Among the 55 patients with neurodegenerative diseases, there were 30 saliva samples from patients with mild cognitive impairment (MCI)-early-mid Alzheimer's disease (eAD, also known as MCI-eAD, denoted as AD in the figure), 20 saliva samples from patients with vascular dementia (VaD), and 5 saliva samples from patients with frontotemporal dementia (FTD).

[0161] The detection was performed according to the method in Example 2.

[0162] The results are as follows Figure 8 As shown in the figure, the relative expression results of hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p miRNAs in salivary exosomes of normal individuals (n=30), MCI-eAD (n=30), VaD (n=20), and FTD (n=5) can be distinguished from patients with other types of neurodegenerative diseases and normal individuals, with statistically significant differences compared to normal individuals (*P<0.05; **P<0.01).

[0163] Example 5: Clinical performance analysis of samples aiding in the differentiation of MCI-eAD, vascular dementia (VaD), and normal samples.

[0164] The samples to be tested were saliva samples from 30 normal volunteers and 55 patients with neurodegenerative diseases, including: 30 patients with mild cognitive impairment (MCI)-early-mid Alzheimer's disease (eAD, also known as MCI-eAD, denoted as AD in the figure), 20 patients with vascular dementia (VaD), and 5 patients with frontotemporal dementia (FTD).

[0165] The detection was performed according to the method in Example 2.

[0166] The results are as follows Figures 9-11 As shown, hsa-miR-24-3p in saliva ROC curves of miRNA distinguishing normal controls (30 cases) from AD (30 cases), VaD (20 cases), or FTD (5 cases), with areas under the curve (AUC) of 0.8011, 0.8683, and 0.7133, respectively; ROC curves of saliva hsa-miR-151a-3pmiRNA distinguishing normal controls (30 cases) from AD (30 cases), VaD (20 cases), and FTD (5 cases), with areas under the curve (AUC) of 0.8956, 0.8033, and 0.9533, respectively; ROC curves of saliva hsa-miR-423-5pmiRNA distinguishing normal controls (30 cases) from AD (30 cases), VaD (20 cases), and FTD (5 cases), with areas under the curve (AUC) of 0.8411, 0.9433, and 0.8933, respectively.

[0167] The above results indicate that the hsa-miR-24-3p, hsa-miR-423-5p, and hsa-miR-151a-3p miRNA markers in salivary exosomes of normal individuals (n=30) and individuals with neurodegenerative diseases such as MCI-eAD (n=30), VaD (n=20), and FTD (n=5) have clinical performance in assisting the differential diagnosis of the two types of diseases.

Claims

1. The application of substances that detect the expression levels of miR-24-3p, miR-423-5p, and miR-151a-3p genes in exosomes in the preparation of products for the identification or auxiliary identification or diagnosis of neurodegenerative diseases, wherein the exosomes are derived from the saliva of a subject; and the neurodegenerative disease is Alzheimer's disease, vascular dementia, and / or frontotemporal dementia; The substances used to detect the expression levels of miR-24-3p, miR-423-5p, and miR-151a-3p genes in exosomes include antibodies or probes that specifically bind to each gene, or primer pairs that specifically amplify each gene. The primer pair for specifically amplifying the miR-24-3p gene consists of a single-stranded DNA molecule as shown in sequence 4 and a single-stranded DNA molecule as shown in sequence 7; The primer pair for specifically amplifying the miR-423-5p gene consists of a single-stranded DNA molecule as shown in sequence 5 and a single-stranded DNA molecule as shown in sequence 7; The primer pair for specifically amplifying the miR-151a-3p gene consists of single-stranded DNA molecules shown in sequence 6 and sequence 7.

2. Application of substances that detect the expression levels of miR-24-3p, miR-423-5p and miR-151a-3p genes in exosomes in the preparation of products for screening or assisting in the screening of Alzheimer's patients, vascular dementia patients and / or frontotemporal dementia patients; Or the use of substances that detect the expression levels of miR-24-3p, miR-423-5p and miR-151a-3p genes in exosomes in the preparation of products that differentiate or assist in differentiating Alzheimer's patients, vascular dementia patients and / or frontotemporal dementia patients; The exosomes were derived from the subject's saliva; The substances used to detect the expression levels of miR-24-3p, miR-423-5p, and miR-151a-3p genes in exosomes include antibodies or probes that specifically bind to each gene, or primer pairs that specifically amplify each gene. The primer pair for specifically amplifying the miR-24-3p gene consists of a single-stranded DNA molecule as shown in sequence 4 and a single-stranded DNA molecule as shown in sequence 7; The primer pair for specifically amplifying the miR-423-5p gene consists of a single-stranded DNA molecule as shown in sequence 5 and a single-stranded DNA molecule as shown in sequence 7; The primer pair for specifically amplifying the miR-151a-3p gene consists of single-stranded DNA molecules shown in sequence 6 and sequence 7.

3. Application of miR-24-3p, miR-423-5p, and miR-151a-3p in exosomes as biomarkers in the development or design of any of the following products: The exosomes were derived from the subject's saliva; 1) Products for identifying or assisting in the identification or diagnosis of neurodegenerative diseases; the neurodegenerative diseases being Alzheimer's disease, vascular dementia, and / or frontotemporal dementia; 2) Products for screening or assisting in the screening of Alzheimer's patients, vascular dementia patients and / or frontotemporal dementia patients; 3) Products that differentiate or help differentiate between Alzheimer's patients, vascular dementia patients, and / or frontotemporal dementia patients.

Images