A method and application for real-time fluorescence isothermal amplification detection of m6A

Abstract

This invention provides a method and application for real-time fluorescence isothermal amplification detection of m6A, belonging to the field of biodetection technology. The method is simple and easy to operate, allowing the amplification step to be completed in a single reaction system with easily achievable amplification conditions. It boasts high accuracy, significant differences, and no false positives, enabling the fluorescence value of m6A-modified RNA in the analyte to be significantly higher than that of unmodified RNA, with a fluorescence value difference exceeding 10 times. Furthermore, this method has a wide range of applications, suitable for detecting m6A modifications in various RNAs, including mRNA, lncRNA, and rRNA, and for screening m6A-related enzyme inhibitors.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a method and application of real-time fluorescence isothermal amplification detection of m6A. Background Technology

[0002] m6A modification is a common type of modification in eukaryotic mRNA, participating in various key processes of RNA metabolism. Currently, commonly used methods for detecting m6A include MeRIP-seq, PA-m6A-seq, miCLIP-seq, SCARLET, and SELECT. MeRIP-seq relies on m6A antibodies to enrich RNA fragments containing m6A modifications, followed by high-throughput sequencing for approximate m6A localization. However, it can only provide approximate localization of hypermethylation, not precise single-base localization. PA-m6A-seq and miCLIP-seq use UV crosslinking technology for immunoprecipitation, enabling single-base recognition. Currently, only SCARLET and SELECT can be used for single-site m6A modification detection. SCARLET uses RNase H and a specific sequence to cleave the target sequence, then labels it with phosphorus-32, specifically ligates it to a DNA segment, and then uses RNase to cleave all RNA fragments, leaving the DNA ligated with the adenosine to be detected. The fragment is then separated by gel electrophoresis, cleaved into individual nucleotides by nuclease P1, and the presence of m6A at the site can be determined by TLC based on the difference in polarity between normal adenine and m6A. SELECT is a qPCR amplification method based on single-base extension and ligation. This method utilizes the ability of m6A to inhibit the single-base extension activity of DNA polymerase and the nick ligation efficiency of ligase. Finally, the m6A modification is determined by the difference in cycle values ​​after PCR amplification, enabling single-base recognition.

[0003] MeRIP-seq, PA-m6A-seq, and miCLIP-seq all rely on m6A antibodies, resulting in complex detection processes, low reproducibility, and high costs. SCARLET is time-consuming, requires radioactive labeling, is expensive, and is difficult to operate. SELECT has relatively small differences in cycle values ​​between control and detection sites, and the self-ligation of unpaired primers during enzyme ligation can lead to widespread false positives. Summary of the Invention

[0004] To address the aforementioned problems, the present invention aims to provide a method and application for real-time fluorescence isothermal amplification detection of m6A that is simple to operate, highly practical, accurate, and sensitive.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: a method for real-time fluorescence isothermal amplification detection of m6A, comprising the following steps:

[0006] (1) Extract RNA from the sample and perform enzyme digestion to obtain enzyme fragments;

[0007] (2) Design specific probes for detection sites; one end of the specific probe contains a fluorescent group and the other end contains a quenching group; the base sequence of the specific probe is the same as part of the sequence of the RNA fragment to be tested; it is complementary to the sequence of the amplification product; the sequences of the two arms of the specific probe are not less than 4 bases and the sequences of the two arms are complementary.

[0008] (3) Design specific primers for the RNA fragment to be tested;

[0009] (4) Design control probes and control primers for non-m6A modified sites;

[0010] (5) The specific probe and specific primer, control probe and control primer, divided into two groups, were added to the amplification detection solution along with the enzyme digestion fragment, T7 RNA polymerase and M-MuLv reverse transcriptase to perform real-time fluorescence quantitative amplification reaction. The presence of m6A modification was determined by comparing the fluorescence values ​​of the two groups of amplification reactions.

[0011] This invention designs probes and primers based on the target sequence for amplification and uses a real-time quantitative PCR instrument for real-time monitoring of the amplification. If the target site is modified with m6A, after a period of amplification, the fluorescence value of the m6A-modified site will be much higher than that of the control site. The real-time fluorescence isothermal amplification detection method of this invention for m6A is simple and easy to operate, and the amplification steps can be completed in a single reaction system, with easily achievable amplification conditions.

[0012] In a preferred embodiment of the real-time fluorescence isothermal amplification detection method for m6A described in this invention, the enzyme digestion process uses MazF enzyme. The universal motif of m6A is "GGAC", and MazF enzyme can specifically cleave the "ACA" sequence without cleaving the "m6ACA" sequence. This method uses MazF enzyme to digest the extracted RNA.

[0013] In a preferred embodiment of the real-time fluorescence isothermal amplification detection method for m6A described in this invention, the sequence length of the specific probe or control probe is not less than 20 bases. The 5' end sequence CCAG and the 3' end sequence CUGG of the probe in this invention are inversely complementary. When the probe is not bound to the target RNA, the complementary pairing at both ends results in the fluorescent group FAM and the quencher group DABCYL being too close to emit fluorescence. When the probe binds to the target RNA, the probe arms unfold, thereby emitting fluorescence.

[0014] In a preferred embodiment of the real-time fluorescence isothermal amplification detection method for m6A described in this invention, the upstream 5' end of the specific primer or control primer contains a T7 promoter sequence and has a complementary pairing sequence of at least 15 bases with the target RNA. In the primers of this invention, the upstream primer corresponds to the 3' end of the detection site, and the 5' end of the upstream primer carries a T7 promoter sequence, enabling T7 RNA polymerase to recognize this sequence and function. The downstream primer is located at the 5' end of the detection site.

[0015] As a preferred embodiment of the real-time fluorescence isothermal amplification detection method for m6A described in this invention, the amplification detection solution includes Tris-HCl, MgCl2, NaCl, spermidine, dithiothreitol, and bovine serum albumin.

[0016] In a preferred embodiment of the real-time fluorescence isothermal amplification detection method for m6A described in this invention, the reaction temperature of the real-time fluorescence isothermal amplification reaction is 42°C.

[0017] In a preferred embodiment of the real-time fluorescence isothermal amplification detection method for m6A described in this invention, the sample includes cells, biological tissues, blood, or urine samples.

[0018] The present invention also provides the application of the real-time fluorescence isothermal amplification detection method for m6A in the detection and analysis of RNA m6A modification.

[0019] The beneficial effects of this invention are as follows: This invention provides a method for real-time fluorescence isothermal amplification detection of m6A. This method is simple and easy to operate, allowing the amplification step to be completed in a single reaction system with easily achievable amplification conditions. The method exhibits high accuracy and significant differences, with no false positive results. It enables the fluorescence value of m6A-modified RNA in the analyte to be much higher than that of RNA without m6A modification, with a fluorescence value difference of more than 10 times. Furthermore, this method has a wide range of applications, including the detection of m6A modification in various RNAs such as mRNA, lncRNA, and rRNA, and can also be used for screening m6A-related enzyme inhibitors. Attached Figure Description

[0020] Figure 1 A flowchart illustrating the method for real-time fluorescence isothermal amplification detection of m6A.

[0021] Figure 2 A graph showing the difference in fluorescence values ​​between the A site and the m6A site when using artificially synthesized short-chain RNA;

[0022] Figure 3The figure shows the results of verifying the feasibility of the real-time fluorescence isothermal amplification detection method of the present invention for detecting m6A using artificially synthesized short-chain RNA, where 0%, 50%, and 100% represent m6A:A = 0 / 0.5 / 1;

[0023] Figure 4 Figure showing the experimental results of validating the m6A site on 18S rRNA using 50ng total RNA;

[0024] Figure 5 The figure shows the experimental results of screening FTO inhibitors and their effective concentrations using the real-time fluorescence isothermal amplification detection method for m6A of this invention.

[0025] Figure 6 The figure shows the experimental results of detecting the m6A site on 18S rRNA in mouse exogenous tumor tissue using the real-time fluorescence isothermal amplification detection method of the present invention. Detailed Implementation

[0026] To more concisely and clearly demonstrate the technical solution, purpose, and advantages of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments and accompanying drawings.

[0027] Example 1

[0028] This embodiment provides a method for real-time fluorescence isothermal amplification detection of m6A, with specific steps as follows: Figure 1 As shown, specifically:

[0029] (1) The RNA sequence to be tested is: Oligo2:GTGTATATAAGCGCAGAAGGCTTGGAATGAGTAG A CAATTGGAGCCTGATATAGAAGCTATGTTATTCCAAGG(m6 A) CATGTCAAGGAAGTAATATCAGA where m6 A It is m6A; A As a control site, 3.75 pmol (3.75 μl) of RNA Oligo2 (1 μM) was added, along with 5 U of MazF enzyme, 3 μl of 5×MazF buffer, and DEPC water to a final volume of 15 μl. The enzyme digestion reaction was carried out at 37 °C for 30 min, followed by inactivation at 80 °C for 10 min.

[0030] (2) Based on the RNA sequence to be tested in step (1), a specific m6A site probe was designed as follows: 5′-FAM-CCAGGCUAUGUUAUUCCCUGG-DABCYL-3′ (SEQ ID NO:1); the specific m6A site primers were as follows: upstream primer: 5′-AATTTAATACGACTCACTATAGGGAGATCTGATATT (SEQ ID NO:2); downstream primer: 5′-CAATTGGAGCCTGATATA-3′ (SEQ ID NO:3); control A site probe: 5′-FAM-CCAGUUGGAAUGAGUACUGG-DABCYL-3′ (SEQ ID NO:4); control primer: upstream primer: 5′-AATTTAATACGACTCACTATAGGGAGAGCTTCTATATCAGGCTCCAA-3′

[0031] (SEQ ID NO:5); Downstream primer: 5′-TGTATATAAGCGCAGAAG-3′ (SEQ ID NO:6);

[0032] (3) Prepare the following SAT reaction system: 40mM Tris-HCl, 8mM MgCl2, 25mM NaCl, 2mM spermidine, 5mM MTT, 80μg / ml bovine serum albumin, 200μM dNTP, 1mM NTP, 500nM primer, 125nM probe. Add 13.5μl of the enzyme digested product from step (1) to each system, heat at 60℃ for 10min, and then heat at 42℃ for 5min.

[0033] (3) Each sample was replicated in 3 wells, and 4 μL of amplification enzyme mixture was added to each well, which contained 10 μM-MuLV reverse transcriptase and 10 U T7 RNA polymerase;

[0034] (4) React at 42℃ and monitor the fluorescence value, or react in a water bath for 2 hours and then detect the fluorescence value.

[0035] Experimental results: Figure 2 It can be seen that the amplification efficiency and fluorescence value of the primer at Oligo2 control site A are much lower than those at the Oligo2-m6A site. This proves that MazF can effectively cleave the ACA sequence but not the m6ACA sequence. After the ACA sequence is cleaved, the RNA cannot be effectively amplified, while the RNA fragment near the uncleaved m6A site can still be effectively amplified. The probe binds to the RNA and emits fluorescence. In artificially synthesized RNA, this method can accurately detect the m6A site.

[0036] Example 2

[0037] This embodiment experimentally verifies that the real-time fluorescence isothermal amplification method for detecting m6A in Example 1 can accurately detect the m6A site in a mixed system. The specific experimental method is as follows:

[0038] (1) The company synthesized the following sequence:

[0039] Oligo-1-m6A:

[0040] AGACAATTGGAGCCTGATATAGAAGCTATGTTATTCCAAGG(m6A)CATGTCAAGGAAGTAATATCAGATT;

[0041] Oligo-1-A:

[0042] AGACAATTGGAGCCTGATATAGAAGCTATGTTATTCCAAGGACATGTCAAGGAAGTAATATCAGATT;

[0043] Oligo-1-A and Oligo-1-m6A were mixed in different proportions (0, 0.5, 1): 0: 0 pmol Oligo-1-m6A + 3.75 pmol Oligo-1-A; 50%: 1.875 pmol Oligo-1-A + 1.875 pmol Oligo-1-m6A; 100%: 0 pmol Oligo-1-A + 3.75 pmol Oligo-1-m6A. 5 U MazF enzyme and 3 μl 5×MazF buffer were added, and DEPC water was added to bring the total volume to 15 μl. The enzyme digestion reaction was carried out at 37°C for 30 min, and then inactivated by heating at 80°C for 10 min.

[0044] (2) Based on the RNA sequence to be tested in step (1), the specific probe was designed as follows: 5′-FAM-CCAGGCUAUGUUAUUCCCUGG-DABCYL-3′ (SEQ ID NO:7); the specific primers were as follows: upstream primer: 5-AATTTAATACGACTCACTATAGGGAGATCTGATATTACTTCCTTGAC-3′ (SEQ ID NO:8); downstream primer: 5′-CAATTGGAGCCTGATATA-3′ (SEQ ID NO:9);

[0045] (3) Prepare the following SAT reaction system: 40mM Tris-HCl, 8mM MgCl2, 25mM NaCl, 2mM spermidine, 5mM MTT, 80μg / ml bovine serum albumin, 200μM dNTP, 1mM NTP, 500nM primer, 125nM probe. Add 13.5μl of the enzyme digested product from step (1) to each system, heat at 60℃ for 10min, and then heat at 42℃ for 5min.

[0046] (4) Each sample was divided into 3 replicates. 4 μl of amplification enzyme mixture was added to each well, which contained 10 U M-MuLV reverse transcriptase and 10 U T7 RNA polymerase.

[0047] (5) React at 42℃ and monitor the fluorescence value, or react in a water bath for 2 hours and then detect the fluorescence value.

[0048] Experimental results: such as Figure 3 As shown, in a mixed system containing RNA with both m6A and A sites, the amplification efficiency and fluorescence intensity were both proportional to the amount of m6A, demonstrating that this method can still accurately identify the m6A site and relatively quantify the overall abundance of m6A in relatively complex systems.

[0049] Example 3

[0050] This embodiment experimentally verifies that the real-time fluorescence isothermal amplification method for detecting m6A in Example 1 can detect the m6A site on 18S rRNA in RNA extracted from cells. The specific experimental method is as follows:

[0051] (1) The specific probe was designed as: 5′-FAM-CCAGTTGACTATCTAGACUGG-DABCYL-3′ (SEQ ID NO:10); Specific primers: upstream primer:

[0052] 5′-AATTTAATACGACTCACTATAGGGAGATAATGATCCTTCCGCAGGTTCACCT-3′ (SEQ ID NO:11); Downstream primer: 5′-CTGGCGGAGCGCTGAGAAGA-3′ (SEQ ID NO:12); Control probe: 5′-FAM-CCAGTAAGCTTGCGTTGACUGG-DABCYL-3′ (SEQ ID NO:13); Control primer: Upstream primer:

[0053] 5′-AATTTAATACGACTCACTATAGGGAGACTAAACCATCCAATCGGTAGTAGCG-3′ (SEQ ID NO:14); Downstream primer: 5′-ACGAGGAATTCCCAGTAAGT-3′ (SEQ ID NO:15);

[0054] (2) Total RNA was extracted from cells. After determining the RNA concentration using nanodrop, 50 ng of RNA was used for subsequent experiments. 5× MazF buffer was diluted to 1× with DEPC water, and 50 ng of total RNA and 5 U of MazF enzyme were added. The mixture was reacted at 30℃ for 30 min and then inactivated at 80℃ for 10 min. The control group did not add MazF enzyme. The amplification of the A site and m6A site was detected when MazF enzyme was not added.

[0055] (3) Prepare the subsequent SAT reaction system: Each system requires: 40mM Tris-HCl, 8mM MgCl2, 25mM NaCl, 2mM spermidine, 5mM DTT, 80μg / ml bovine serum albumin, 200μM dNTP, 1mM NTP, 500nM primer, 125nM probe, add the enzyme digested product from step (1), the total system is generally 36μl, heat at 60℃ for 10min, and heat at 42℃ for 5min;

[0056] (4) Each sample was divided into 3 replicates. 4 μl of amplification enzyme mixture was added to each well, which contained 10 U M-MuLV reverse transcriptase and 10 U T7 RNA polymerase.

[0057] (5) React at 42°C in a real-time fluorescence PCR instrument or water bath and monitor the fluorescence value.

[0058] Experimental results: such as Figure 4 As shown, comparing the A site with and without MazF, the fluorescence value of the A site is very low after adding MazF enzyme, proving that MazF enzyme can still recognize and cleave the ACA sequence in total RNA, preventing the RNA fragment corresponding to the A site from amplifying and producing fluorescence. However, the fluorescence value of the m6A site is very high regardless of whether MazF enzyme is added or not, further proving that MazF cannot cleave the m6A site. Comparing A and m6A with MazF enzyme, the fluorescence value and amplification rate of m6A are much higher than those of the A site, demonstrating that this method can accurately and sensitively identify the m6A site in 50 ng of total RNA.

[0059] Example 4

[0060] This embodiment uses the real-time fluorescence isothermal amplification method for detecting m6A as described in Example 1. RNA was treated with the demethylase FTO to remove m6A modification. Simultaneously, RNA was treated with different concentrations of the validated FTO inhibitor FB23, and the differences in fluorescence values ​​were detected using this method to determine whether this method can identify changes in m6A abundance after in vitro demethylation. The specific experimental method is as follows:

[0061] (1) First, extract 50 ng of total RNA, add 2.5 μM FTO or FTO inactivated by heating at 95 °C, and add six concentrations of FTO inhibitor FB23 from 0.625 μM to 40 μM. In a 10 μl reaction system of 50 mM Tris-HCl, 280 μM (NH4)2Fe(SO4)2, 300 μM 2-OG, and 2 mM L-VC, react at 25 °C for 2 h, and then stop the reaction at 95 °C for 5 min.

[0062] (2) After in vitro demethylation, add 3 μl of 5×MazF buffer and 5 μMazF enzyme to the system of step (1), react at 30℃ for 30 min, and inactivate at 80℃ for 10 min.

[0063] (3) Prepare the subsequent SAT reaction system: 40mM Tris-HCl, 8mM MgCl2, 25mM NaCl, 2mM spermidine, 5mM MTT, 80μg / ml bovine serum albumin, 200μM dNTP, 1mM NTP, 500nM primer, 125nM probe, add the enzyme digestion product from step (1), the total system is generally 36μl, heat at 60℃ for 10min, then heat at 42℃ for 5min;

[0064] (4) Each sample was divided into 3 replicates. 4 μl of amplification enzyme mixture was added to each well, which contained 10 U M-MuLV reverse transcriptase and 10 U T7 RNA polymerase.

[0065] (5) React at 42°C in a real-time fluorescence PCR instrument or water bath and monitor the fluorescence value.

[0066] Experimental results: such as Figure 5 As shown, the heat-inactivated FTO group amplified the fastest and had the highest fluorescence value. Since FTO cannot exert demethylation activity after inactivation, the FTO-inactivated group had the highest m6A abundance. Treating FTO with different concentrations of FB23 could inhibit its demethylation activity to varying degrees. The results showed that the amplification rate and fluorescence value were directly proportional to the concentration of the FTO inhibitor FB23, proving that the inhibitory effect of FB23 on FTO is concentration-dependent. This method can be used to screen the concentration of FTO inhibitors.

[0067] Example 5

[0068] This embodiment uses the real-time fluorescence isothermal amplification detection method for m6A from Example 1 to detect the m6A site on 18S rRNA in mouse exogenous tumor tissue. It aims to determine whether this method can be used for the detection of m6A in tissue samples. The specific experimental methods are as follows:

[0069] (1) The specific probe was designed as follows: 5′-FAM-CCAGTTGACTATCTAGACUGG-DABCYL-3′ (SEQ ID NO:16); Specific primers: upstream primer: 5′-AATTTAATACGACTCACTATAGGGAGATAATGATCCTTCCGCAGGTTCACCT-3′ (SEQ ID NO:17); downstream primer: 5′-CTGGCGGAGCGCTGAGAAGA-3′ (SEQ ID NO:18); control probe: 5′-FAM-CCAGTAAGCTTGCGTTGACUGG-DABCYL-3′ (SEQ ID NO:19); control primers: upstream primer: 5′-AATTTAATACGACTCACTATAGGGAGACTAAACCATCCAATCGGTAGTAGCG-3′ (SEQ ID NO:20); downstream primer: 5′-ACGAGGAATTCCCAGTAAGT-3′ (SEQ ID NO:21);

[0070] (2) Using 1×10 6 HCT116 cells were subcutaneously implanted into nude mice, and the mice were sacrificed about two weeks later to separate the tumor tissue.

[0071] (3) Take a portion of tumor tissue and add Trizol to extract total RNA from the tumor tissue. After measuring the RNA concentration using nanodrop, take 50 ng of RNA for subsequent experiments.

[0072] (4) Dilute 5×MazF buffer with DEPC water to 1×, add 50ng total RNA and 5U MazF enzyme, react at 30℃ for 30min, and inactivate at 80℃ for 10min.

[0073] (5) Prepare the subsequent SAT reaction system: 40mM Tris-HCl, 8mM MgCl2, 25mM NaCl, 2mM spermidine, 5mM DTT, 80μg / ml bovine serum albumin, 200μM dNTP, 1mM NTP, 500nM primer, 125nM probe, add the enzyme digested product from step (4), the total system is generally 36μl, heat at 60℃ for 10min, then heat at 42℃ for 5min;

[0074] (6) Each sample was divided into 3 replicates. 4 μl of amplification enzyme mixture was added to each well, which contained 10 U M-MuLV reverse transcriptase and 10 U T7 RNA polymerase.

[0075] (7) React at 42°C in a real-time fluorescence PCR instrument or water bath and monitor the fluorescence value.

[0076] Experimental results: such as Figure 6 As shown, after extracting RNA from tumor tissue, the m6A site on 18S rRNA was detected using this method. Compared with the control site A, the fluorescence value of the m6A site was much higher than that of the A site, confirming that this method can be used to detect the m6A site in tumor and other biological tissue samples.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for detecting m6A based on SAT real-time fluorescence isothermal amplification, characterized in that, Includes the following steps: (1) Extract RNA from the sample and perform enzyme digestion to obtain enzyme fragments; (2) Design specific probes for the m6A detection site; The specific probe contains a fluorescent group at one end and a quenching group at the other end; the base sequence of the specific probe is shown in SEQ ID NO:

1. (3) Design specific primers for the RNA fragment to be tested; The base sequence of the upstream primer of the specific primer is shown in SEQ ID NO:2; The base sequence of the downstream primer of the specific primer is shown in SEQ ID NO:3; (4) Design control probes and control primers for non-m6A modified sites; The base sequence of the control probe is shown in SEQ ID NO:4; The base sequence of the upstream primer of the control primer is shown in SEQ ID NO:5; The base sequence of the downstream primer of the control primer is shown in SEQ ID NO:6; (5) The specific probe and specific primer, control probe and control primer are divided into two groups and added to the amplification detection solution along with the enzyme digestion fragment, T7 RNA polymerase and M-MuLv reverse transcriptase to perform SAT real-time fluorescence isothermal amplification detection reaction. The presence of m6A modification is determined by comparing the fluorescence values ​​of the two amplification reactions. The 5' end of the upstream primer of the specific primer or control primer contains the T7 promoter sequence. The enzyme digestion process used was MazF enzyme.

2. The method for real-time fluorescence isothermal amplification detection of m6A according to claim 1, characterized in that, The amplification detection solution includes Tris-HCl, MgCl2, NaCl, spermidine, dithiothreitol, and bovine serum albumin.

3. The method for real-time fluorescence isothermal amplification detection of m6A according to claim 1, characterized in that, The reaction temperature of the real-time fluorescence isothermal amplification reaction is 42℃.

4. The method for real-time fluorescence isothermal amplification detection of m6A according to claim 1, characterized in that, The samples include cell, biological tissue, blood, or urine samples.

5. The application of the SAT real-time fluorescence isothermal amplification detection method for m6A according to any one of claims 1 to 4 in the detection and analysis of RNA m6A modification.

Images