Primer compositions, kits and design methods for human cyp2d6 genotyping

Abstract

This invention discloses a primer composition, kit, and design method for human CYP2D6 gene genotyping. The primer composition is used to specifically amplify SNP sites of the CYP2D6 gene. The primer composition includes wild-type primers, mutant primers, and common primers. The common primers are used to distinguish the CYP2D7 and CYP2D8P genes, which are highly homologous to the CYP2D6 gene. This invention modifies the primers based on AMS-PCR. The primer composition can avoid the problem of high homology among the CYP2D6, CYP2D7, and CYP2D8P gene sequences, while meeting the requirements of ARMS-PCR primer design. It can accurately genotype the SNP sites of the CYP2D6 gene. Based on this, the resulting detection kit has low operational intensity, low detection cost, and can produce results in 1 hour, providing clinicians with more patient genetic information.

Description

Technical Field

[0001] This invention relates to the field of gene detection, and in particular to a primer composition, kit, and design method for human CYP2D6 genotyping. Background Technology

[0002] Mental illnesses have become prevalent in my country, with statistics showing that over 17% of adults suffer from mental disorders such as depression and schizophrenia. Psychotropic medications are currently the primary clinical treatment for mental illnesses. Common psychotropic medications include tricyclic antidepressants (TCAs), antipsychotics, selective serotonin reuptake inhibitors (SSRIs), and sedatives. Research data shows significant individual differences in the efficacy and adverse reactions of psychotropic medications, which is related to gene polymorphisms in enzymes, transport proteins, and drug target receptors involved in drug metabolism.

[0003] The cytochrome P450 superfamily (CYP) is an important enzyme system among phase I drug-metabolizing enzymes, responsible for the metabolism of endogenous substances and various drugs in the body. CYP2D6 is an important member of the second subfamily of CYP450 enzymes, participating in the metabolism of various psychotropic drugs, such as selective serotonin reuptake inhibitors (SSRIs), tricyclic antidepressants (TCAs), and venlafaxine. Significant individual differences exist in CYP2D6 enzyme activity, manifesting as increased, decreased, or complete inactivation. Based on these differences, individuals can be classified into four metabolic phenotypes. Different metabolic phenotypes exhibit significant differences in drug metabolism capabilities, directly affecting individual drug efficacy or drug toxicity. A mutation at the c.1846G>A site, unique to the CYP2D6*4 allele, can lead to a splicing defect in the CYP2D6 gene, resulting in the loss of enzyme activity. The most important mutation site in the CYP2D6*10 allele, c.100C>T, can lead to the intermediate metabolite (IM) of the CYP2D6 gene. The CYP2D6*14 allele has a more significant impact on CYP2D6 enzyme activity in East Asian populations; detection of the specific site c.1758G>A helps determine whether an individual carries this allele. The specific site c.2988G>A in the CYP2D6*41 allele has been shown to be associated with aberrant CYP2D6 splicing; this splicing defect leads to the deletion of exon 6 in some transcribed RNAs, resulting in reduced enzyme activity. These alleles can cause varying degrees of reduction or loss of CYP2D6 enzyme activity, making patients more susceptible to adverse reactions when taking medications (such as serotonin reuptake inhibitors).

[0004] Currently, there are many methods for detecting gene polymorphisms, such as direct sequencing, microarray analysis, and restriction endonuclease length polymorphism polymerase chain reaction (PCR-RFLP) analysis. Direct sequencing is the most common method for gene polymorphism detection and is considered the gold standard for detecting polymorphic sites. Although it offers advantages such as high throughput and multi-site detection, it also suffers from cumbersome procedures, long experimental cycles, high costs, low sensitivity, and susceptibility to sample contamination, hindering its widespread clinical application. Microarray analysis requires PCR amplification first, followed by hybridization of the PCR product containing the target SNP site with mutant and wild-type probes. The genotype of the sample is determined by comparing the hybridization signal intensity of the two probes. This method is cumbersome, difficult to scale up and automate, and the results are difficult to interpret with a high false-positive rate. PCR-RFLP analysis: This technique relies on changes in the recognition sites of restriction endonucleases caused by gene mutations, such as the loss or creation of new sites. A specific fragment is amplified by PCR, and then the restriction endonuclease is used for enzyme digestion. The size of the fragment is observed by electrophoresis. However, it has limitations in terms of enzyme digestion sites and is difficult to perform high-throughput parallel analysis, often resulting in misinterpretation of results, which affects the accuracy of its detection. It is also not suitable for rapid screening of large populations. Summary of the Invention

[0005] The purpose of this invention is to provide a primer composition, kit, and design method for human CYP2D6 genotyping, addressing the aforementioned problems and overcoming the shortcomings of existing technologies.

[0006] The technical solution adopted in this invention is as follows: a primer composition for human CYP2D6 gene typing, wherein the primer composition is used to specifically amplify the SNP site (single nucleotide polymorphism site) of the CYP2D6 gene, the primer composition includes wild-type primers, mutant primers and common primers, wherein the common primers are used to distinguish the CYP2D7 and CYP2D8P genes that are highly homologous to the CYP2D6 gene.

[0007] Furthermore, the SNP sites of the CYP2D6 gene include c.1846G>A, c.100C>T, c.1758G>A, and c.2988G>A.

[0008] Furthermore, the sequence of the common primer is as follows:

[0009] CYP2D6 gene c.1846G>A site:

[0010] Reverse common primer: TCCAGCCCCGGCACCTCACG;

[0011] CYP2D6 gene c.100C>T site:

[0012] Forward common primer: GGTGTGTCCAGAGGAGCCCGT;

[0013] CYP2D6 gene c.1758G>A site:

[0014] Reverse common primer: TCCAGCCCCGGCACCTCACG;

[0015] CYP2D6 gene c.2988G>A site:

[0016] Reverse common primer: GGCTTACAGGATCCTGGT.

[0017] Furthermore, the mismatch rate between the wild-type primers and the mutant primers is 5%-12%.

[0018] Furthermore, the sequence of the primer composition is as follows:

[0019] CYP2D6 gene c.1846G>A site:

[0020] Forward wild-type primer: CCGTATCTCCCACCCCTAG,

[0021] Forward mutant primer: CCGTATCTCCCACCCTCAA,

[0022] Reverse common primer: TCCAGCCCCGGCACCTCACG;

[0023] CYP2D6 gene c.100C>T site:

[0024] Reverse wild-type primer: GTGGCAGTGGGCCTGTTGG,

[0025] Reverse mutant primers: GGCAGTGGGCCTGGTGAGA

[0026] Forward common primer: GGTGTGTCCAGAGGAGCCCGT;

[0027] CYP2D6 gene c.1758G>A site:

[0028] Forward wild-type primer: CGCCTTCGCCAACCACTCAG,

[0029] Forward mutant primers: CCACCTTCGCCAACCACTACA,

[0030] Reverse common primer: TCCAGCCCCGGCACCTCACG;

[0031] CYP2D6 gene c.2988G>A site:

[0032] Forward wild-type primer: GCAGAGGCCGAGGAAGG,

[0033] Forward mutant primers: TGCAGTGGCCGAGGGTGA

[0034] Reverse common primer: GGCTTACAGGATCCTGGT.

[0035] Furthermore, the present invention also includes a kit for human CYP2D6 genotyping detection, the kit comprising the above-described primer composition.

[0036] Furthermore, the kit also includes a Taqman probe targeting the SNP site of the CYP2D6 gene, primers and probes for the internal control gene, Taq enzyme, dNTPs, and buffer solution.

[0037] Furthermore, the Taq enzyme is a thermostable Taq DNA polymerase.

[0038] Furthermore, the Taqman probe sequence is as follows:

[0039] c.1846G>A site:

[0040] Probe: ACGCCCCTTTCGCCCCAACG

[0041] c. 100C>T site:

[0042] Probe: TTGGCGCCGGTGCATCAGGTC

[0043] c.1758G>A site:

[0044] Probe: CTTTGTGCCCTTCTGCCCATCACC

[0045] c.2988G>A site:

[0046] Probe: TACAGGCGGGGGCCCATGAACTTT.

[0047] Furthermore, the internal control gene is RPPH, and the primer and probe sequences for RPPH are as follows:

[0048] Forward primer: TCATCAGTGGGGCCACGA

[0049] Reverse primer: CTGTTAGGGCCGCCTCTGGC

[0050] Probe: TGCGTCCTGTCACTCCACTCCCATGT.

[0051] Furthermore, the kit also includes a sample processing solution.

[0052] Furthermore, the kit also includes a positive control and a negative control. The positive control is a recombinant DNA plasmid containing all target gene polymorphic sites, and the negative control is physiological saline.

[0053] Furthermore, as one embodiment, the detection kit of the present invention comprises the following components:

[0054] The first type: primer pair composition for the c.1846G>A site of the CYP2D6 gene, with a concentration range of 100nM-1500nM in the amplification system;

[0055] Primer pair composition for the c.100C>T site of the CYP2D6 gene, with a concentration range of 100nM-1500nM in the amplification system;

[0056] Primer pair composition for the c.1758G>A site of the CYP2D6 gene, with a concentration range of 100nM-1500nM in the amplification system;

[0057] Primer pair composition for the c.2988G>A site of the CYP2D6 gene, with a concentration range of 100 nM-1500 nM in the amplification system;

[0058] Taqman probes are available in concentrations ranging from 100 nM to 500 nM in amplification systems.

[0059] The concentration range of the internal standard primers in the amplification system is 100 nM-300 nM;

[0060] The concentration range of the internal standard probe in the amplification system is 100 nM-400 nM;

[0061] The concentration range of Taq enzyme in the amplification system is 1U-20U;

[0062] The concentration range of dNTPs in the amplification system is 0.1 mM-1 mM;

[0063] The concentration of the buffer solution in the amplification system ranges from 1 μL to 10 μL.

[0064] Furthermore, the detection method of the kit of the present invention is as follows: using the above-mentioned kit, the processed sample to be tested is amplified by real-time multiplex fluorescent PCR, and the genotype of the four SNP sites of the CYP2D6 gene of the sample to be tested is determined according to the fluorescence signal detected by the PCR instrument.

[0065] Furthermore, the present invention also includes a method for designing common primers, which design specific bases for recognizing the CYP2D6 gene in base regions different from those of the human CYP2D7 and CYP2D8P genes, and mismatch one or two bases near the specific bases of the CYP2D6 gene in the common primers at the c.1846G>A, c.100C>T, and c.1758G>A sites of the CYP2D6 gene.

[0066] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0067] 1. The primer composition of the present invention uses a specific common primer designed by human intervention to distinguish the CYP2D7 and CYP2D8P genes that are highly homologous to the CYP2D6 gene. Compared with the common primers designed by general design software, the common primers designed by human intervention in the present invention have higher homology specificity and better detection performance.

[0068] 2. The primer composition of the present invention, targeting known mutations at the four SNP sites of the CYP2D6 gene, artificially designed a specific wild-type ARMS primer and a mutant ARMS primer, whose 3' bases are complementary to the bases of the wild-type gene sequence and the mutant gene sequence, respectively. By PCR, the genotypes of the four SNP sites of the CYP2D6 gene, namely c.1846G>A, c.100C>T, c.1758G>A, and c.2988G>A, can be directly and specifically distinguished.

[0069] 3. In order to increase primer specificity, coordinate amplification efficiency, improve amplification curve morphology and facilitate instrument interpretation, the primer composition of the present invention has undergone a series of specific modifications or alterations to each primer. Specifically, mismatches are introduced into different regions of the ARMS primers for the four SNP sites. The mismatch rate of the four SNP sites is 5%-12%. Comparative verification shows that, compared with ARMS primers designed by traditional methods, the artificially designed ARMS primers of the present invention have higher specificity and better detection performance.

[0070] 4. The kit of the present invention has the characteristics of high specificity, high detection sensitivity, high detection resolution, high throughput, simple and easy operation, easy automation, and professional software for result interpretation. It can be used with the fully automated PCR analysis system Gentier 48E and the fully automated medical PCR analysis system Gentier 96E for PCR amplification and detection. The three fluorescence channels can detect multiple targets, and the detection can be completed in about one hour. It covers a wide range of sites, including four common SNP sites of the CYP2D6 gene in the Chinese population that can affect the activity of CYP2D6 enzyme. Furthermore, through primer and system optimization, it can achieve the detection of multiple SNP sites.

[0071] 5. Compared with existing kits, the technical advantages of the kit of the present invention are that it greatly reduces the intensity of operation, can produce results in about 1 hour, and significantly reduces the detection cost. It covers the detection of multiple sites, provides clinicians with more patient genetic information, and provides a more complete personalized medication reference for the use of psychotropic drugs such as antidepressants, thus benefiting patients. Attached Figure Description

[0072] Figures 1-4 This invention presents a comparison of the homology specificity of artificially designed common primers and software-designed common primers for CYP2D6 normal wild-type samples and CYP2D6*5 / *5 allelic samples; wherein, Figure 1 For homology-specific comparison of the c.1846G>A site in the CYP2D6 genotype, Figure 2 For homology-specific comparison of the c.100C>T site in the CYP2D6 genotype, Figure 3 This is a homology-specific comparison of the c.1758G>A locus in the CYP2D6 genotype. Figure 4 Homology-specific comparison of the c.2988G>A site in the CYP2D6 genotype;

[0073] Figure 5 and 6 The image shows the detection results of normal CYP2D6 genotype samples and CYP2D6*5 / *5 allele samples using the artificially designed common primers of this invention; wherein, Figure 5 This is an amplification diagram of a normal CYP2D6 genotype sample using the artificially designed common primer pair of this invention. Figure 6 Amplification diagram of CYP2D6*5 / *5 genotype samples using the artificially designed common primer pair of this invention;

[0074] Figures 7-10 This is a comparison diagram showing the specificity of ordinary ARMS primers and the improved ARMS primers designed in this invention for detecting the c.1846G>A site in the CYP2D6 genotype; where... Figure 7This is an amplification diagram of the CYP2D6 genotype c.1846G>A wild-type using a standard ARMS primer pair. Figure 8 This is an amplification diagram of the CYP2D6 genotype c.1846G>A wild-type using the improved ARMS primer pair designed in this invention. Figure 9 This is an amplification diagram of the CYP2D6 genotype c.1846G>A mutant genotype using standard ARMS primer pairs. Figure 10 Amplification diagram of the CYP2D6 genotype c.1846G>A mutant genotype using the improved ARMS primer pair designed in this invention;

[0075] Figures 11-14 This is a comparison diagram showing the specificity of ordinary ARMS primers and the improved ARMS primers designed in this invention for detecting the c.100C>T site in the CYP2D6 genotype; where... Figure 11 This is an amplification diagram of the CYP2D6 genotype c.100C>T wild-type using a standard ARMS primer pair. Figure 12 This is an amplification diagram of the CYP2D6 gene c.100C>T wild-type genotype using the improved ARMS primer pair designed in this invention. Figure 13 This is an amplification diagram of the CYP2D6 genotype c.100C>T mutant genotype using standard ARMS primer pairs. Figure 14 Amplification diagram of the CYP2D6 genotype c.100C>T mutant genotype using the improved ARMS primer pair designed in this invention;

[0076] Figures 15-18 This is a comparison diagram showing the specificity of ordinary ARMS primers and the improved ARMS primers designed in this invention for detecting the c.1758G>A site in the CYP2D6 genotype; where... Figure 15 This is an amplification diagram of the CYP2D6 genotype c.1758G>A wild-type using a standard ARMS primer pair. Figure 16 This is an amplification diagram of the CYP2D6 gene c.1758G>A wild-type genotype using the improved ARMS primer pair designed in this invention. Figure 17 This is an amplification diagram of the CYP2D6 genotype c.1758G>A mutant genotype using standard ARMS primer pairs. Figure 18 Amplification diagram of the CYP2D6 genotype c.1758G>A mutant genotype using the improved ARMS primer pair designed for this invention;

[0077] Figures 19-22 This is a comparison diagram showing the specificity of ordinary ARMS primers and the improved ARMS primers designed in this invention for detecting the c.2988G>A site in the CYP2D6 genotype; where... Figure 19 This is an amplification diagram of the CYP2D6 genotype c.2988G>A wild-type using a standard ARMS primer pair. Figure 20This is an amplification diagram of the CYP2D6 gene c.2988G>A wild-type genotype using the improved ARMS primer pair designed in this invention. Figure 21 This is an amplification diagram of the CYP2D6 genotype c.2988G>A mutant genotype using standard ARMS primer pairs. Figure 22 Amplification diagram of the CYP2D6 genotype c.2988G>A mutant genotype using the improved ARMS primer pair designed for this invention.

[0078] Figure label: 1.1 is the amplification curve of the common primers designed by the software for normal genotype samples;

[0079] 1.2 shows the amplification curves of artificially designed common primers for normal genotype samples;

[0080] 1.3 describes the amplification curves of common primers designed by the software for CYP2D6*5 / *5 allele samples;

[0081] 1.4 shows the amplification curves of artificially designed common primers for CYP2D6*5 / *5 allele samples;

[0082] 2.1 describes the amplification curves of common primers designed for normal genotype samples;

[0083] 2.2 shows the amplification curves of artificially designed common primers for normal genotype samples;

[0084] 2.3 describes the amplification curves of common primers designed by the software for CYP2D6*5 / *5 allele samples;

[0085] 2.4 shows the amplification curves of artificially designed common primers for CYP2D6*5 / *5 allele samples;

[0086] 3.1 describes the amplification curves of common primers designed for normal genotype samples;

[0087] 3.2 shows the amplification curves of artificially designed common primers for normal genotype samples;

[0088] 3.3 describes the amplification curves of common primers designed for CYP2D6*5 / *5 allele samples;

[0089] 3.4 shows the amplification curves of artificially designed common primers for CYP2D6*5 / *5 allele samples;

[0090] 4.1 describes the amplification curves of common primers designed for normal genotype samples;

[0091] 4.2 shows the amplification curves of artificially designed common primers for normal genotype samples;

[0092] 4.3 describes the amplification curves of common primers designed for CYP2D6*5 / *5 allele samples;

[0093] 4.4 shows the amplification curves of artificially designed common primers for CYP2D6*5 / *5 allele samples. Detailed Implementation

[0094] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0095] The following terms or definitions are provided merely to aid in understanding the invention. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0096] Unless otherwise defined below, all technical and scientific terms used in the specific embodiments of this invention are intended to have the same meaning as commonly understood by those skilled in the art. While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth to better explain the invention.

[0097] As used in this invention, the terms “comprising,” “including,” “having,” “containing,” or “involving” are inclusive or open-ended and do not exclude other unlisted elements or method steps.

[0098] The term “consisting of” is considered a preferred embodiment of the term “comprising”. If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of these embodiments.

[0099] When referring to a singular noun, the indefinite or definite article used, such as "a" or "a kind of," "the," includes the plural form of the noun.

[0100] The terms "approximately" and "generally" in this invention refer to a range of accuracy that, as would be understood by those skilled in the art, still guarantees the technical effects of the discussed features. This term typically indicates a deviation from the indicated value of ±10%, preferably ±5%.

[0101] The term "nucleic acid" or "nucleic acid sequence" as used in this invention refers to any molecule, preferably a polymeric molecule, containing units of ribonucleic acid, deoxyribonucleic acid, or similar molecules. The nucleic acid may be single-stranded or double-stranded. A single-stranded nucleic acid may be the nucleic acid of one strand of denatured double-stranded DNA. Alternatively, a single-stranded nucleic acid may be a single-stranded nucleic acid derived from any double-stranded DNA.

[0102] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0103] Example 1

[0104] Preparation of the test kit

[0105] I. Screening of gene loci in the CYP2D6 gene that are significantly associated with CYP2D6 enzyme activity

[0106] The level of CYP2D6 enzyme activity directly affects the metabolism of various psychotropic drugs. According to numerous studies, the CYP2D6*4 (CYP2D6 c.1846G>A), CYP2D6*10 (CYP2D6 c.100C>T), and CYP2D6*41 (CYP2D6 c.2988G>A) sites, as well as the CYP2D6*14 (CYP2D6 c.1758G>A) site, significantly influence CYP2D6 enzyme activity, thereby affecting the metabolism of various psychotropic drugs. The effects of the four SNP sites on enzyme activity are shown in Table 1. Among them, CYP2D6*10 (CYP2D6 c.100C>T) has a distribution frequency of 40%-49.5% in East Asian populations, while CYP2D6*14 (CYP2D6 c.1758G>A) is an allele unique to East Asians, with a distribution frequency of approximately 1%-2%. These two genotypes are the main reasons for the slow and weak metabolism of the CYP2D6 enzyme in East Asians. CYP2D6*4 (CYP2D6 c.1846G>A) has a distribution frequency of 0.54% in East Asian populations, and CYP2D6*41 (CYP2D6 c.2988G>A) has a distribution frequency of 2.27%.

[0107] Therefore, the gene loci finally screened in this embodiment are: CYP2D6*4 (CYP2D6 c.1846G>A), CYP2D6*10 (CYP2D6 c.100C>T), CYP2D6*41 (CYP2D6 c.2988G>A), and CYP2D6*14 (CYP2D6 c.1758G>A).

[0108] Table 1. Frequency and Function of CYP2D6 Gene Loci

[0109]

[0110] Note: 1. *14B: c.1758G>A; *14A: c.1758G>A, c.100C>T;

[0111] 2. *5 / *5: CYP2D6 gene deletion.

[0112] II. Design allele-specific primers based on ARMS-PCR for the selected gene loci.

[0113] CYP2D6 is the first and only uninducible P450 enzyme confirmed to be controlled by a single gene. Located at the CYP2D locus on chromosome 22, CYP2D6 is a fully functional gene capable of expressing functional proteins in the liver and other tissues. Studies have found two highly homologous pseudogenes upstream of the CYP2D6 gene, named CYP2D7 and CYP2D8P. CYP2D7 shares 97% sequence homology with CYP2D6 and carries a TATA box; however, the insertion of a thymine (T) at position 226 in exon 1 alters the reading frame, causing premature transcription termination. CYP2D8P is a mutant pseudogene containing multiple breakpoints. Neither CYP2D7 nor CYP2D8P is expressed in human tissues.

[0114] Therefore, when using conventional primer design software to design primers for SNP site detection of the CYP2D6 gene, it is sometimes impossible to completely distinguish them from the CYP2D7 and CYP2D8P gene sequences, leading to issues with the specificity of SNP genotyping results. In this invention, to avoid homology problems between the CYP2D6 gene and the CYP2D7 and CYP2D8P genes, we compared the sequences of the three genes and customized common primers specific to the CYP2D6 gene in specific base regions. Furthermore, we performed mismatch processing on one or two bases near the CYP2D6 gene-specific bases in the common primers for the c.1846G>A, c.100C>T, and c.1758G>A sites of the CYP2D6 gene, near these common bases, to improve the specificity of the common primers for the detection sites (the c.1846G>A and c.1758G>A common primer sequences are identical).

[0115] Meanwhile, the primers designed in this invention also meet the requirements of ARMS-PCR primer design, namely, each specific primer can only bind to and amplify the DNA template of the genotype corresponding to the CYP2D6 gene locus; in addition, it is also necessary to ensure that the primers and probes at each site do not interfere with each other when multiple sites are combined. In order to increase the specificity of primers, coordinate amplification efficiency, improve the amplification curve morphology, and facilitate instrument interpretation, a series of specific modifications or alterations were made to each primer, namely, mismatches were introduced into different regions of the ARMS primers for the four SNP sites, with a mismatch rate of 5%-12% for the four SNP sites.

[0116] In summary, through individual screening of each primer and optimization of primer combinations, the improved and optimized final primer sequence used in this invention is determined as follows:

[0117] CYP2D6 gene c.1846G>A site:

[0118] Forward wild-type primer: CCG T ATCTCCCACCCC T A'G'

[0119] Forward mutant primer: CCG T ATCTCCCACCC T CA'A'

[0120] Reverse common primer: TCCAGCCCCGGCACCTC A C“G”

[0121] Probe: ACGCCCCTTTCGCCCCAACG

[0122] CYP2D6 gene c.100C>T site:

[0123] Reverse wild-type primer: GTGGCAG T GG“G”CCTG T “T”G'G’

[0124] Reverse mutant primer: GGCAG T GG“G”CCTGG“T”G'A'G A

[0125] Forward common primer: GGTGTGTCCAGAGGAGCCC G “T”

[0126] Probe: TTGGCGCCGGTGCATCAGGTC

[0127] CYP2D6 gene c.1758G>A site:

[0128] Forward wild-type primers: CGCCTTCGCC“A”ACCA“CT”C A 'G'

[0129] Forward mutant primer: CC A CCTTCGCC“A”ACCA“CT” A C'A'

[0130] Reverse common primer: TCCAGCCCCGGCACCTC A C“G”

[0131] Probe: CTTTGTGCCCTTCTGCCCATCACC

[0132] CYP2D6 gene c.2988G>A site:

[0133] Forward wild-type primer: GCAG A GGCCGAGG A AG'G'

[0134] Forward mutant primer: TGCAG T GGCCGAGGG T G'A'

[0135] Reverse common primer: GGCTTACAGGA“T”CCTGG“T”

[0136] Probe: TACAGGCGGGGGCCCATGAACTTT

[0137] Control RPPH site:

[0138] Forward primer: TCATCAGTGGGGCCACGA

[0139] Reverse primer: CTGTTAGGGCCGCCTCTGGC

[0140] Probe: TGCGTCCTGTCACTCCACTCCCATGT

[0141] In this context, 1.- (single underscore) indicates that the sequence of each primer has been modified by 1 to 3 bases at the -4 to +3 base positions at the 3' end of the primer and 3 to 7 bases from the 5' end of the primer.

[0142] 2. “” (double quotes) represent bases in the primer sequences that are different from the CYP2D7 and CYP2D8P gene sequences.

[0143] 3. '' (single quote) represents the mutation position of each point.

[0144] III. Validation of the common primers designed in this invention to distinguish highly homologous genes (CYP2D7 gene and CYP2D8P gene)

[0145] This invention involves four loci of the CYP2D6 gene. Samples with the genotype of CYP2D6 normal wild-type determined by first-generation sequencing and samples with the genotype of CYP2D6*5 / *5 (these alleles lack the CYP2D6 gene and only include genomic sequences other than the CYP2D6 gene, as well as highly homologous CYP2D6 gene sequences such as pseudogenes CYP2D8P and CYP2D7) were selected as test samples. Common primers designed by software and common primers designed manually were used to verify the homology specificity of this invention.

[0146] In this validation, two test systems were set up. System 1 used the forward wild-type primers for the CYP2D6 gene c.1846 site and designed reverse common primers and probes using software (Primer 5.0). System 2 used the forward wild-type primers for the CYP2D6 gene c.1846 site and manually designed reverse common primers. The amplification systems of System 1 and System 2 were identical except for the common primer sequences. The aforementioned primer combinations are typically combined with TaqMan probes, internal standard primers and probes, Taq enzyme, dNTPs, and buffer solutions to form the amplification system. Those skilled in the art can refer to relevant literature for their usage methods and dosages to establish the amplification system.

[0147] System 1 and System 2 were used to detect CYP2D6 normal wild-type genotype samples and CYP2D6*5 / *5 allele samples, respectively. The primer set for each locus in System 1 (using reverse common primers designed with Primer 5.0 software) was as follows:

[0148] CYP2D6 gene c.1846G>A site:

[0149] Forward wild-type primer: GCATCTCCCACCCCCAG

[0150] Forward mutant primers: CCGCATCTCCCACCCCCAA,

[0151] Reverse common primer: GGAGGCGATCACGTTGCTCAC,

[0152] Probe: ACGCCCCTTTCGCCCCAACG;

[0153] CYP2D6 gene c.100C>T site:

[0154] Reverse wild-type primer: GTGGCAGGGGGCCTGGTGG

[0155] Reverse mutant primers: GTGGCAGGGGGCCTGGTGA

[0156] Forward common primer: CTGATAGTGGCCATCTTCCTGC,

[0157] Probe: TTGGCGCCGGTGCATCAGGTC;

[0158] CYP2D6 gene c.1758G>A site:

[0159] Forward wild-type primer: CGCCTTCGCCAACCACTCCG,

[0160] Forward mutant primers: CCGCCTTCGCCAACCACTCCA,

[0161] Reverse common primer: GGAGGCGATCACGTTGCTCAC,

[0162] Probe: CTTTGTGCCCTTCTGCCCATCACC;

[0163] CYP2D6 gene c.2988G>A site:

[0164] Forward wild-type primer: GCAGGGGCCGAGGGAGG

[0165] Forward mutant primer: TGCAGGGGCCGAGGGAGA

[0166] Reverse common primer: GTTGAGGAGGTCAGGCTTACAGG

[0167] Probe: TACAGGCGGGGGCCCATGAACTTT.

[0168] System 2 (artificially designed common primers) uses the following primer sets for each site:

[0169] CYP2D6 gene c.1846G>A site:

[0170] Forward wild-type primer: GCATCTCCCACCCCCAG

[0171] Forward mutant primers: CCGCATCTCCCACCCCCAA,

[0172] Reverse common primer: TCCAGCCCCGGCACCTCACG

[0173] Probe: ACGCCCCTTTCGCCCCAACG;

[0174] CYP2D6 gene c.100C>T site:

[0175] Reverse wild-type primer: GTGGCAGGGGGCCTGGTGG

[0176] Reverse mutant primers: GTGGCAGGGGGCCTGGTGA

[0177] Forward common primer: GGTGTGTCCAGAGGAGCCCGT,

[0178] Probe: TTGGCGCCGGTGCATCAGGTC;

[0179] CYP2D6 gene c.1758G>A site:

[0180] Forward wild-type primer: CGCCTTCGCCAACCACTCCG,

[0181] Forward mutant primers: CCGCCTTCGCCAACCACTCCA,

[0182] Reverse common primer: TCCAGCCCCGGCACCTCACG

[0183] Probe: CTTTGTGCCCTTCTGCCCATCACC;

[0184] CYP2D6 gene c.2988G>A site:

[0185] Forward wild-type primer: GCAGGGGCCGAGGGAGG

[0186] Forward mutant primer: TGCAGGGGCCGAGGGAGA

[0187] Reverse common primer: GGCTTACAGGATCCTGGT,

[0188] Probe: TACAGGCGGGGGCCCATGAACTTT.

[0189] Combination Figures 1-4 As shown, Figure 1 This indicates that, for the c.1846G>A site, the artificially designed common primers of this invention have better homology specificity than the software-designed common primers. When using the software-designed common primers to detect CYP2D6*5 / *5 allele samples, normal amplification curves are still observed, while no amplification is observed in the samples using the artificially designed common primers of this invention.

[0190] Figure 2This indicates that, for the c.100C>T site, the artificially designed common primers of this invention have better homology specificity than the software-designed common primers. When using the software-designed common primers to detect CYP2D6*5 / *5 allele samples, normal amplification curves are still observed, while no amplification is observed in the samples using the artificially designed common primers of this invention.

[0191] Figure 3 This indicates that, for the c.1758G>A site, the artificially designed common primers in this invention have better homology specificity than the software-designed common primers. When using the software-designed common primers to detect CYP2D6*5 / *5 allele samples, normal amplification curves are still observed, while no amplification is observed in the samples using the artificially designed common primers in this invention.

[0192] Figure 4 This indicates that, for the c.1758G>A site, the artificially designed common primers in this invention have better homology specificity than the software-designed common primers. When using the software-designed common primers to detect CYP2D6*5 / *5 allele samples, normal amplification curves are still observed, while no amplification is observed in the samples using the artificially designed common primers in this invention.

[0193] Figure 5 and 6 The figure shows the detection results of the artificially designed common primers of this invention on normal CYP2D6 genotype samples and CYP2D6*5 / *5 allele samples. As can be seen from the figure, the artificially designed common primers of this invention produce normal amplification curves for normal CYP2D6 genotype samples, but no normal amplification curves are produced for CYP2D6*5 / *5 allele samples.

[0194] In summary, the artificially designed common primers in this invention have higher homology specificity and better detection performance than software-designed common primers.

[0195] IV. Verification of the specificity of the ARMS primers designed in this invention:

[0196] To investigate the specificity of the improved ARMS primers designed in this invention, mutations at four SNP sites in CYP2D6 were detected using both the ARMS primers designed in this invention and ordinary ARMS primers. The sequences of the ordinary ARMS primers used as a comparative example are as follows:

[0197] CYP2D6 gene c.1846G>A site:

[0198] Forward wild-type primer: GCATCTCCCACCCCCAG

[0199] Forward mutant primers: CCGCATCTCCCACCCCCAA,

[0200] Reverse common primer: TCCAGCCCCGGCACCTCACG

[0201] Probe: ACGCCCCTTTCGCCCCAACG;

[0202] CYP2D6 gene c.100C>T site:

[0203] Reverse wild-type primer: GTGGCAGGGGGCCTGGTGG

[0204] Reverse mutant primers: GTGGCAGGGGGCCTGGTGA

[0205] Forward common primer: GGTGTGTCCAGAGGAGCCCGT,

[0206] Probe: TTGGCGCCGGTGCATCAGGTC;

[0207] CYP2D6 gene c.1758G>A site:

[0208] Forward wild-type primer: CGCCTTCGCCAACCACTCCG,

[0209] Forward mutant primers: CCGCCTTCGCCAACCACTCCA,

[0210] Reverse common primer: CGGGTAAGGGGTCGCCTTCC

[0211] Probe: CTTTGTGCCCTTCTGCCCATCACC;

[0212] CYP2D6 gene c.2988G>A site:

[0213] Forward wild-type primer: GCAGGGGCCGAGGGAGG

[0214] Forward mutant primer: TGCAGGGGCCGAGGGAGA

[0215] Reverse common primer: GGCTTACAGGATCCTGGT,

[0216] Probe: TACAGGCGGGGGCCCATGAACTTT.

[0217] This invention involves four loci of the CYP2D6 gene. Since the mutation frequency at some loci is low, we used custom plasmids containing both wild-type and mutant genes at each locus, with a concentration of 1.0 × 10⁻⁶. -4A plasmid solution of ng / μL was used as a template to test the specificity of ARMS primers.

[0218] Taking the CYP2D6 gene c.1846G>A site as an example, this invention sets up two test systems. System one consists of forward wild-type primers, reverse common primers, probes, and other components including reaction solutions for the CYP2D6 gene c.1846 site amplification reaction system. System two consists of forward mutant primers, reverse common primers, probes, and other components including reaction solutions for the CYP2D6 gene c.1846 site amplification reaction system. The detection concentration using System one is 1.0 × 10⁻⁶. -4 ng / μL of CYP2D6c.1846 wild-type plasmid solution (detection result: Ct(1)) and a concentration of 1.0×10 -4 A solution of CYP2D6 c.1846 mutant plasmid in ng / μL (detection result: Ct(2)); the concentration of 1.0×10⁻⁶ was detected using system two. -4 ng / μL of CYP2D6 c.1846 wild-type plasmid solution (detection result: Ct(3)) and a concentration of 1.0×10 -4 ng / μL of CYP2D6 c.1846 mutant plasmid solution (detection result: Ct(4)).

[0219] Test results as follows Figures 7-10 As shown, the difference between Ct(2) and Ct(1) represents the specificity of the forward wild-type primer at the c.1846 site of the CYP2D6 gene; the difference between Ct(3) and Ct(4) represents the specificity of the forward mutant primer at the c.1846 site of the CYP2D6 gene; and the difference between Ct(3) and Ct(4) represents the specificity of the forward mutant primer at the c.1846 site of the CYP2D6 gene. Figures 7-10 It is evident that the ARMS primers designed in this invention have superior specificity compared to ordinary ARMS primers. The ΔCt value of ordinary ARMS primers is approximately 1-3, while the ΔCt value of the ARMS primers designed in this invention can reach over 10.

[0220] Meanwhile, the specificity verification of the ARMS primers designed for the three sites of the CYP2D6 gene c.100C>T, c.1758G>A, and c.2988G>A in this invention, compared with ordinary ARMS primers, is similar to that described above and will not be repeated here. The comparison results are as follows: Figures 11-14 , Figures 15-18 , Figures 19-22 As shown.

[0221] like Figures 11-14 The results show that the ARMS primers designed in this invention have better specificity than ordinary ARMS primers for the c.100C>T site. The ΔCt value of ordinary ARMS primers is about 2-4, while the ΔCt value of the ARMS primers designed in this invention can reach more than 10.

[0222] like Figures 15-18 The results show that the ARMS primers designed in this invention have better specificity than ordinary ARMS primers for the c.1758G>A site. The ΔCt value of ordinary ARMS primers is about 3-6, while the ΔCt value of the ARMS primers designed in this invention can reach more than 10.

[0223] like Figures 19-22 The results show that the ARMS primers designed in this invention have better specificity than ordinary ARMS primers for the c.1758G>A site. The ΔCt value of ordinary ARMS primers is about 1-3, while the ΔCt value of the ARMS primers designed in this invention can reach more than 10.

[0224] In summary, the ARMS primers designed in this invention have higher specificity and better detection performance than ordinary ARMS primers.

[0225] V. Components of the Reagent Kit

[0226] The kit in this embodiment contains the components shown in Table 2 below:

[0227] Table 2. Reagent Kit Components

[0228]

[0229]

[0230] The total volume of reaction solutions 1-4 in Table 2 is 5 μL. H2O can be added to each reaction solution to bring the total volume to 5 μL.

[0231] In this embodiment, the TaqMan probe used in reaction solutions 1-4 is a hydrolytic probe, an oligonucleotide with a fluorescent group (e.g., FAM, TET, VIC, HEX) at its 5' end and a quencher group (e.g., TAMRA, BHQ) at its 3' end. It can bind to the binding regions of the forward and reverse PCR primers. When the TaqMan probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. During PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter and quencher fluorescent groups. This allows the fluorescence monitoring system to receive the fluorescent signal; that is, one fluorescent molecule is formed for each amplified DNA strand, achieving complete synchronization between the accumulation of the fluorescence signal and the formation of the PCR product. The Taq enzyme used is a thermostable Taq DNA polymerase. The internal control gene is RPPH, and the internal control primers and probes are as follows:

[0232] Forward primer: TCATCAGTGGGGCCACGA

[0233] Reverse primer: CTGTTAGGGCCGCCTCTGGC

[0234] Probe: TGCGTCCTGTCACTCCACTCCCATGT.

[0235] VI. The manufacturing process of the test kit strips in this embodiment is as follows:

[0236] According to Table 3 below, add 5 μL of the corresponding detection reaction solution to the PCR tube, cap the tube to make a test strip, and four tubes together constitute one test.

[0237] Table 3. Dosage Table for Reagent Kit Detection System

[0238] 1 Human CYP2D6 detection reaction solution 1 5μL 2 Human CYP2D6 detection reaction solution 2 5μL 3 Human CYP2D6 detection reaction solution 3 5μL 4 Human CYP2D6 detection reaction solution 4 5μL

[0239] This invention's kit is suitable for multiplex PCR reactions and can achieve multi-well, multi-site detection. In this embodiment, each reaction solution can achieve detection of two primer-probe sets and one internal control primer-probe set, wherein:

[0240] Human CYP2D6 detection reaction solution 1 includes wild-type primer and probe sets for the c.1846G>A and c.100C>T sites of the CYP2D6 gene, an RPPH internal control primer and probe set, as well as TaqMan probes, thermostable Taq DNA polymerase, dNTPs, and buffer solution.

[0241] Human CYP2D6 detection reaction solution 2 includes a set of mutant primers and probes for two sites of the CYP2D6 gene, c.1846G>A and c.100C>T, and an RPPH internal control primer and probe set, as well as TaqMan probes, thermostable Taq DNA polymerase, dNTPs, and buffer solution.

[0242] Human CYP2D6 detection reaction solution 3 includes wild-type primer and probe sets for two sites of the CYP2D6 gene c.1758G>A and c.2988G>A, as well as RPPH internal control primer and probe sets, TaqMan probe, thermostable Taq DNA polymerase, dNTPs, and buffer solution.

[0243] Human CYP2D6 detection reaction solution 4 includes a set of mutant primers and probes for two sites of the CYP2D6 gene, c.1758G>A and c.2988G>A, and an RPPH internal control primer and probe set, as well as TaqMan probes, thermostable Taq DNA polymerase, dNTPs, and buffer solution.

[0244] Furthermore, in one scenario, the kit can be configured to simultaneously analyze the genotypes of the CYP2D6 gene c.1846G>A, c.100C>T, c.1758G>A, and c.2988G>A sites. For example, the kit can be designed as a group of four independent wells (where the first and second wells can be for detecting the CYP2D6 gene c.1846G>A and c.100C>T sites, and the third and fourth wells can be for detecting the CYP2D6 gene c.1758G>A and c.2988G>A sites). The first well can contain the forward wild-type primer, reverse common primer, and probe for c.1846, the reverse wild-type primer, the forward common primer, the probe, and the internal standard probe for c.100. The amplification reaction system consists of primer sets, reaction solutions, etc. The second well may contain the forward mutant primer, reverse common primer, probe for c.1846, the reverse mutant primer, forward common primer, probe for c.100, internal standard probe primer set, and reaction solutions, etc., constituting the amplification reaction system. The third well may contain the forward wild-type primer, reverse common primer, probe for c.1758, the forward wild-type primer, reverse common primer, probe for c.2988, internal standard probe primer set, and reaction solutions, etc., constituting the amplification reaction system. The fourth well may contain the forward mutant primer, reverse common primer, probe for c.1758, the forward mutant primer, reverse common primer, probe for c.2988, internal standard probe primer set, and reaction solutions, etc., constituting the amplification reaction system. This allows for accurate identification of genotypes at different sites on the CYP2D6 gene using a kit formed by four sets of wells. Of course, in other implementations, the fluorescence wavelength can be changed to achieve more multiple detections, thus requiring less physical separation of wells. The actual implementation order is not limited to the above scheme. The focus here is to illustrate that the specific primers of this invention can efficiently and quickly identify the target genotype through different combinations.

[0245] Example 2

[0246] The present invention provides a method for amplifying and detecting DNA samples using a kit.

[0247] 1. Reagent strip preparation [Reagent preparation area]

[0248] Calculate the required number of reagent strip reaction tubes as (n tests * 4 + 8). Take the corresponding number of reagent strips from the test kit, thaw them at room temperature and mix by shaking, then centrifuge at 2000 rpm for 10 seconds. Label and transfer to the sample processing area.

[0249] 2. Sample Processing [Sample Processing Area]

[0250] Remove one human CYP2D6 sample processing solution (n+2 test) from the kit, thaw at room temperature, and vortex to mix. Add 5 μL of the well-mixed whole blood sample to the sample processing solution, label the sample number, and vortex to mix. After thawing, vortex to mix for 5 seconds for the negative control and positive control, centrifuge briefly for 5 seconds, and add 5 μL of each to the sample processing solution, label, and vortex to mix.

[0251] 3. Sample Addition [Sample Processing Area]

[0252] Add 15 μL of the processed sample, negative control, and positive control to the prepared reagent strip reaction tubes, tighten the caps, vortex the 8-tube strips for 3 seconds to mix, then centrifuge at 6000 rpm for 5 seconds and transfer the 8-tube strips to the detection area.

[0253] 4. PCR Amplification and Fluorescence Detection [PCR Amplification Area]

[0254] Place the reaction tubes into the fluorescence PCR amplification instrument in a specific order, set the reaction volume to 20 μL, and perform PCR amplification according to the following procedure:

[0255] Pre-denaturation reaction: react at 95℃ for 3 min;

[0256] Amplification reaction: 95℃ for 15s, 63.5℃ for 45s, 45 cycles.

[0257] Fluorescence detection selection: System 1 / System 2: HEX channel of CYP2D6 c.1846G>A site, FAM channel of CYP2D6c.100C>T site, and CY5 channel of internal control gene; System 3 / System 4: HEX channel of CYP2D6 c.1758G>A site, FAM channel of CYP2D6c.2988G>A site, and CY5 channel of internal control gene.

[0258] 5. Data Analysis

[0259] 1) Determination of reagent kit validity

[0260] Positive control: Ct value of FAM and HEX channels ≤36.5, and the amplification curve shows a clear exponential growth phase.

[0261] Negative control: No amplification in any channel, Ct > 36.5 or no Ct value.

[0262] If the above conditions are not met, the experiment is considered invalid, and the instruments, reagents, amplification conditions, and experimental procedures should be checked.

[0263] 2) Determination of sample validity

[0264] Internal control gene: The Ct value of the CY5 channel in all samples must be ≤36.5, and the amplification curve must show a clear exponential growth phase. If this condition is not met, the sample is considered invalid.

[0265] The genotype determination method is shown in Table 4 below:

[0266] Table 4. Schematic diagram of genotype structure determination method.

[0267]

[0268]

[0269] Note: 1. Ct(1) represents the Ct value of system 1, Ct(2) represents the Ct value of system 2, Ct(3) represents the Ct value of system 3, and Ct(4) represents the Ct value of system 4.

[0270] 2. When there is no Ct value or Ct > 36.5, the ΔCt calculation method is not used to determine the genotype.

[0271] 3. When Ct(1), Ct(2), Ct(3) and Ct(4) are all >36.5 or there is no Ct value, if the Ct value of the internal standard gene CY5 channel is ≤36.5 and the amplification curve has an obvious exponential growth period, then it is a negative sample - CYP2D6 gene deletion, and the sample is CYP2D6*5 / *5 allele type.

[0272] 4. When both Ct(1) and Ct(2) are >36.5 or there is no Ct value, and at least one of Ct(3) and Ct(4) has a Ct value ≤36.5, the CYP2D6 c.1846G>A and CYP2D6 c.100C>T genotype detection is invalid. The instruments, reagents, amplification conditions, experimental procedures, template quality, etc. should be checked.

[0273] 5. When both Ct(3) and Ct(4) are >36.5 or there is no Ct value, and at least one of Ct(1) and Ct(2) has a Ct value ≤36.5, the CYP2D6 c.1758G>A and CYP2D6 c.2988G>A genotype detection is invalid. The instruments, reagents, amplification conditions, experimental operations, template quality, etc. should be checked.

[0274] 6. Threshold setting principle: The inflection point where the fluorescence signal enters the exponential growth stage from the background is set as the threshold, or the threshold is automatically set by the instrument.

[0275] In this embodiment, to verify the accuracy of the kit of the present invention, seven EDTA anticoagulated whole blood samples were selected, randomly numbered, and genotypic detection was performed on the seven EDTA anticoagulated whole blood samples according to the above detection method. The results were compared with the detection results of the seven samples using the gold standard method (first-generation sequencing). The results of the two methods are shown in Table 5 below.

[0276] Table 5. Comparison of detection results between the reagent kit of this invention and first-generation sequencing.

[0277]

[0278] The comparison results show that the detection results of the kit of the present invention are completely consistent with the detection results of first-generation sequencing, and the accuracy is high.

[0279] Example 3

[0280] Output of CYP2D6 gene locus results and determination of metabolotype

[0281] The metabolotypes corresponding to all genotypes at the four SNP loci of the CYP2D6 gene are shown in Table 6 below:

[0282] Table 6. Schematic diagram of CYP2D6 gene locus results output and metabolotype determination.

[0283]

[0284]

[0285] The metabolotype determination was used to determine the metabolotype of the test samples in Example 2, as shown in Table 7 below:

[0286] Table 7. Metabolic type table of genotypes of samples in Example 2

[0287]

[0288] The medication recommendations based on the CYP2D6 metabolizer are shown in Table 8 below:

[0289] Table 8. Schematic diagram of medication recommendations for CYP2D6 metabolizers.

[0290]

[0291]

[0292] Based on the aforementioned medication recommendations, the medication recommendations for the CYP2D6 metabolizer in Example 2 are shown in Table 9 below:

[0293] Table 9. Medication recommendations for the metabolic types of samples in Example 2.

[0294]

[0295] In summary, based on the test results of this kit, drug use risks can be analyzed from the perspective of pharmacogenomics and drug interactions, providing a reference for clinical drug selection. It is important to note that the test results are for clinicians' reference only and should not be used as the sole basis for developing clinical treatment plans.

[0296] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer composition for human CYP2D6 genotyping, characterized in that, The primer composition is used to specifically amplify the SNP sites of the CYP2D6 gene, and the sequence of the primer composition is as follows: CYP2D6 gene c.1846G>A site: Forward wild-type primer: CCGTATCTCCCACCCCTAG, Forward mutant primer: CCGTATCTCCCACCCTCAA, Reverse common primer: TCCAGCCCCGGCACCTCACG; CYP2D6 gene c.100C>T site: Reverse wild-type primer: GTGGCAGTGGGCCTGTTGG, Reverse mutant primers: GGCAGTGGGCCTGGTGAGA Forward common primer: GGTGTGTCCAGAGGAGCCCGT; CYP2D6 gene c.1758G>A site: Forward wild-type primer: CGCCTTCGCCAACCACTCAG, Forward mutant primers: CCACCTTCGCCAACCACTACA, Reverse common primer: TCCAGCCCCGGCACCTCACG; CYP2D6 gene c.2988G>A site: Forward wild-type primer: GCAGAGGCCGAGGAAGG, Forward mutant primers: TGCAGTGGCCGAGGGTGA Reverse common primer: GGCTTACAGGATCCTGGT.

2. A kit for human CYP2D6 genotyping detection, characterized in that, The kit includes the primer composition for human CYP2D6 genotyping as described in claim 1.

3. The kit for human CYP2D6 genotyping detection as described in claim 2, characterized in that, The kit also includes a TaqMan probe targeting the SNP site of the CYP2D6 gene, primers and probes for the internal control gene, Taq enzyme, dNTPs, and buffer solution. The TaqMan probe sequence is as follows: c.1846G>A site: Probe: ACGCCCCTTTCGCCCCAACG c. 100C>T site: Probe: TTGGCGCCGGTGCATCAGGTC c.1758G>A site: Probe: CTTTGTGCCCTTCTGCCCATCACC c.2988G>A site: Probe: TACAGGCGGGGGCCCATGAACTTT.

4. The kit for human CYP2D6 genotyping detection as described in claim 3, characterized in that, The internal standard is RPPH. The primer and probe sequences for RPPH are as follows: Forward primer: TCATCAGTGGGGCCACGA; Reverse primer: CTGTTAGGGCCGCCTCTGGC; Probe: TGCGTCCTGTCACTCCACTCCCATGT.

5. The kit for human CYP2D6 genotyping detection as described in claim 4, characterized in that, The kit also includes a sample processing solution, a positive control, and a negative control. The positive control is a recombinant DNA plasmid containing all target gene polymorphic sites, and the negative control is physiological saline.

Images