Adeno-associated virus mutants and uses thereof

CN116063403BActive Publication Date: 2026-08-21INST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210824628.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-05-22
Publication Date
2026-08-21
Estimated Expiration
2040-05-22

AI Technical Summary

Technical Problem

但是研究发现,AAV空壳蛋白更容易被抗原提呈细胞提呈,激发强烈的T细胞免疫反应,增强了T细胞对AAV的清除效果,最终导致AAV的转导效率变低

Benefits of technology

[0064] (1) This invention constructs an adeno-associated virus library by splicing and recombinating the gene encoding the capsid protein of wild-type adeno-associated virus. Five adeno-associated virus mutants are obtained by screening with neutralizing antibodies against the capsid protein of AAV. These mutants have the ability to evade neutralizing antibodies against AAV and have a highly efficient and specific ability to infect human liver cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116063403B_ABST
    Figure CN116063403B_ABST
Patent Text Reader

Abstract

The application provides an adeno-associated virus mutant and application thereof, and the coat protein of the adeno-associated virus mutant comprises an amino acid sequence shown in SEQ ID NO: 1-5, or an amino acid sequence with more than 98% identity with SEQ ID NO: 1-5 and having the same or similar biological function. The application constructs an adeno-associated virus library by splicing and recombining a coat protein coding gene of a wild type adeno-associated virus, and obtains the adeno-associated virus mutant by screening with neutralizing antibodies against AAV coat proteins, the adeno-associated virus mutant has strong infection ability on human liver cells and can avoid the neutralization of neutralizing antibodies, and thus the technical obstacles existing in the field of hemophilia treatment are solved in a targeted manner.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of patent application number 202010442092.4 (the original application was filed on May 22, 2020, and the invention was entitled Adeno-associated Virus Mutant and Its Application). Technical Field

[0002] This invention belongs to the fields of genetic engineering and bioengineering technology, and relates to adeno-associated virus mutants and their applications. Background Technology

[0003] In recent years, adeno-associated virus (AAV) has been used as a gene therapy vector in the clinical treatment of various genetic defects, such as hemophilia B, DMD (diphthous muscular dystrophy), and SMA (semi-motor dyskinesia), achieving encouraging results. In particular, the successful application of AAV in the treatment of hemophilia holds promise for saving thousands of patients who do not respond to conventional treatments. Literature reports that after injection of AAV carrying the factor 9 gene, hemophilia patients did not experience severe immune responses, and the liver damage caused by AAV was transient. After AAV injection, the level of factor 9 in the peripheral blood of patients recovered to about 10% of the normal level and remained stable for a long period, essentially eliminating dependence on recombinant factor 9 proteins. Preliminary clinical trials are underway for hemophilia A caused by factor 8 deficiency. However, the gene encoding coagulation factor 8 is quite long, approximately 4.5 kbp. Including the promoter and terminator sequences, the total gene length exceeds the packaging range of AAV. This is the main obstacle encountered by AAV gene therapy in the treatment of hemophilia A and is currently a research hotspot.

[0004] However, AAV gene therapy also has some limitations in treating hemophilia. One of these limitations is that a certain proportion of neutralizing antibodies against the AAV coat protein exist in the peripheral blood of both healthy individuals and hemophiliac patients. Therefore, before assessing a patient's eligibility for AAV gene therapy, it is necessary to first detect the presence of neutralizing antibodies in the peripheral blood. If neutralizing antibodies against AAV are present in the patient's body, AAV gene therapy is not suitable. Considering that AAV gene therapy is a promising treatment for hemophilia, helping AAV evade the clearance effect of neutralizing antibodies in the body is particularly important.

[0005] To address this issue, researchers have proposed several methods, including shell protein neutralization, immunosuppressant pretreatment, small DNA fragment neutralization, and AAV shell protein mutation. Shell protein neutralization involves introducing a large amount of AAV shell protein during AAV injection to counteract the pressure of AAV clearance by neutralizing antibodies, thereby increasing infection efficiency. However, studies have found that AAV shell protein is more easily presented by antigen-presenting cells, stimulating a strong T-cell immune response and enhancing T-cell clearance of AAV, ultimately leading to lower AAV transduction efficiency. Immunosuppressant pretreatment involves injecting an appropriate amount of immunosuppressant, such as dexamethasone, into the patient before AAV injection. While this method can improve AAV transduction efficiency to some extent, the improvement is limited because dexamethasone has a broad immunosuppressive effect and cannot specifically clear neutralizing antibodies against AAV or T / B cells that recognize AAV. Small DNA fragment neutralization uses small DNA fragments that can specifically block AAV neutralizing antibodies, showing promising application potential, but no related clinical application reports have yet emerged. The AAV coat protein mutation method involves mutating certain sites in the amino acid sequence of the AAV coat protein that is recognized by neutralizing antibodies, thereby reducing the ability of neutralizing antibodies to recognize AAV and thus evading the clearance effect of neutralizing antibodies. There are currently a large number of research reports on this method, but the reasons and mechanisms for evading neutralizing antibodies are still unclear.

[0006] Therefore, modifying AAV to evade the clearance effect of neutralizing antibodies in the body and expanding the applicability of AAV is of great significance and has broad application prospects in the field of gene defect disease treatment. Summary of the Invention

[0007] To address the shortcomings of existing technologies and practical needs, this invention provides an adeno-associated virus mutant and its applications. The adeno-associated virus mutant has a strong ability to infect human liver cells and can evade the neutralizing effect of neutralizing antibodies, thus specifically solving the obstacles encountered by hemophilia patients with anti-AAV neutralizing antibodies when receiving gene therapy.

[0008] To achieve this objective, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides an adeno-associated virus mutant, wherein the capsid protein of the adeno-associated virus mutant comprises the amino acid sequences shown in SEQ ID NO:1-5;

[0010] SEQ ID NO:1:

[0011] MAADGYLPDWLEDTLSEGIRQWWKLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGGTESVPDPQPLGEPPAAPSGVGPNTMAAGGGAPMADNNEGADGVGSSSGNWHCDSTWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLSFKLFNIQVKEVTQNEGTKTIANNLTSTIQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMATHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL;

[0012] SEQ ID NO:2:

[0013] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDSESVPDPQPLGEPPAAPSGVGPNTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYNLNGRNSLANPGIAMASHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL;

[0014] SEQ ID NO:3:

[0015] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDRQLKAGDNPYLRYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPFGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMASHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPRPIGTRYLTRNL;

[0016] SEQ ID NO:4:

[0017] MAADGYLPDWLEDNLSEGIREWWDLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRVLEPFGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMASHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL;

[0018] SEQ ID NO:5:

[0019] .

[0020] In this invention, an adeno-associated virus (AAV) library was constructed by splicing and recombinating the gene encoding the capsid protein of wild-type AAV. Five AAV mutants were obtained by screening with neutralizing antibodies against the AAV capsid protein. The capsid protein of the AAV mutants includes the amino acid sequences shown in SEQ ID NO:1-5. The obtained AAV mutants have the ability to evade anti-AAV neutralizing antibodies and have a highly efficient and specific ability to infect human liver cells, showing broad application prospects in the field of gene therapy for hemophilia.

[0021] The five adeno-associated virus mutants screened by this invention showed high sequence homology. After sequence alignment with wild-type AAV9, it was found that amino acids from the 100th to the 200th position at the N-terminus of the AAV coat protein amino acid sequence may be the high-frequency recognition region of anti-AAV neutralizing antibodies.

[0022] Preferably, the capsid protein of the adeno-associated virus mutant further includes an amino acid sequence that has more than 98% identity with SEQ ID NO:1-5 and has the same or similar biological function. For example, the capsid protein of the adeno-associated virus mutant may have 98% identity with SEQ ID NO:1-5 and have the ability to evade anti-AAV neutralizing antibodies.

[0023] In a second aspect, the present invention provides a nucleic acid molecule that encodes the adeno-associated virus mutant described in the first aspect, or encodes a protein having the same or similar biological function as the adeno-associated virus mutant described in the first aspect.

[0024] Preferably, the nucleic acid molecule comprises the nucleic acid sequences shown in SEQ ID NO:6-10 and / or the complementary sequences of SEQ ID NO:6-10;

[0025] SEQ ID NO:6:

[0026]

[0027] SEQ ID NO:7:

[0028]

[0029] SEQ ID NO:8:

[0030]

[0031] SEQ ID NO:9:

[0032]

[0033] SEQ ID NO:10:

[0034]

[0035] In this invention, the nucleic acid sequence shown in SEQ ID NO:6 is the coding sequence of the amino acid sequence shown in SEQ ID NO:1, the nucleic acid sequence shown in SEQ ID NO:7 is the coding sequence of the amino acid sequence shown in SEQ ID NO:2, the nucleic acid sequence shown in SEQ ID NO:8 is the coding sequence of the amino acid sequence shown in SEQ ID NO:3, the nucleic acid sequence shown in SEQ ID NO:9 is the coding sequence of the amino acid sequence shown in SEQ ID NO:4, and the nucleic acid sequence shown in SEQ ID NO:10 is the coding sequence of the amino acid sequence shown in SEQ ID NO:5.

[0036] Thirdly, the present invention provides an expression vector comprising a wild-type adeno-associated virus vector into which the nucleic acid molecule described in the second aspect is inserted.

[0037] Preferably, the wild-type adeno-associated virus vector includes any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or AAV10, with AAV2 being the most preferred.

[0038] Fourthly, the present invention provides an adeno-associated virus (AAV) library, the AAV library comprising the AAV mutant described in the first aspect.

[0039] Preferably, the adeno-associated virus library also includes wild-type and / or mutant adeno-associated viruses that do not have the ability to evade neutralizing antibodies against the adeno-associated virus capsid protein.

[0040] Fifthly, the present invention provides a method for constructing the adeno-associated virus library as described in the fourth aspect, the method comprising:

[0041] (1) PCR amplification of the capsid protein encoding gene of wild-type adeno-associated virus;

[0042] (2) After digesting the amplification product with DNase, select DNA fragments with a length of 100-300 bp for reassembly;

[0043] (3) Insert the splicing product into the wild-type adeno-associated virus vector to obtain an adeno-associated virus vector library;

[0044] (4) The adeno-associated virus (AAV) library was prepared by co-transfecting the AAV vector library with helper plasmids into lactating cells.

[0045] Preferably, the PCR primers in step (1) comprise the nucleic acid sequences shown in SEQ ID NO: 11-12;

[0046] SEQ ID NO: 11: 5'-ATAAAGCGAGTAGTC-3';

[0047] SEQ ID NO: 12: 5'-GAGGGTATGCGACAT-3'.

[0048] Preferably, the splicing method in step (2) involves mixing a DNA fragment of 100–300 bp in length with DNA polymerase, subjecting it to gradient cooling within a range of 96–41°C, and obtaining the spliced ​​product via Shuffling PCR.

[0049] In this invention, DNA fragments with a length of 100–300 bp are selected as splicing fragments, which not only enriches the sequence diversity of splicing products and increases the viral load in the adeno-associated virus library, but also ensures the splicing efficiency of shuffling PCR, improves the splicing success rate of splicing products, and helps to efficiently screen for adeno-associated virus mutants that can evade the neutralizing effect of neutralizing antibodies.

[0050] Preferably, the wild-type adeno-associated virus vector in step (3) includes any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or AAV10, with AAV2 being the most preferred.

[0051] Sixthly, the present invention provides a method for screening adeno-associated virus mutants as described in the first aspect, the method comprising:

[0052] The adeno-associated virus library described in the fourth aspect was mixed and incubated with human immunoglobulin for intravenous injection, and then introduced into humanized mice with liver cells.

[0053] Adenovirus was introduced, and after feeding the mice for a period of time, human cells were isolated from the livers of mice, and DNA was extracted.

[0054] PCR amplification was performed using the primer pairs shown in SEQ ID NO:13-14. The amplification product was inserted into the wild-type adeno-associated virus vector and co-transfected with helper plasmids into mammalian cells. After culturing, the mammalian cells were lysed to obtain the adeno-associated virus mutant.

[0055] SEQ ID NO:13: CAACTCCATCACTAGGGGTTC;

[0056] SEQ ID NO: 14: CATGGGAAAGGTGCCAGA.

[0057] In this invention, the upstream primer SEQ ID NO:13 is designed based on the AAV2-rep gene, and the downstream primer SEQ ID NO:14 is designed based on the downstream common sequence of the AAV2-ITR plasmid.

[0058] In a seventh aspect, the present invention provides a method for preparing an adeno-associated virus mutant, the method comprising co-transfecting mammalian cells with the expression vector and helper plasmid described in the third aspect; lysing the mammalian cells after culturing to obtain the adeno-associated virus mutant.

[0059] Eighthly, the present invention provides a pharmaceutical composition comprising any one or a combination of at least two of the adeno-associated virus mutant described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, or the adeno-associated virus library described in the fourth aspect;

[0060] Preferably, the pharmaceutical composition further includes any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient, or diluent.

[0061] In a ninth aspect, the present invention provides the use of the adeno-associated virus mutant described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, the adeno-associated virus library described in the fourth aspect, or the pharmaceutical composition described in the eighth aspect in the preparation of a therapeutic drug for gene defect diseases.

[0062] Preferably, the genetic defect includes hemophilia.

[0063] Compared with the prior art, the present invention has the following beneficial effects:

[0064] (1) This invention constructs an adeno-associated virus library by splicing and recombinating the gene encoding the capsid protein of wild-type adeno-associated virus. Five adeno-associated virus mutants are obtained by screening with neutralizing antibodies against the capsid protein of AAV. These mutants have the ability to evade neutralizing antibodies against AAV and have a highly efficient and specific ability to infect human liver cells.

[0065] (2) The five adeno-associated virus mutants screened by this invention have high sequence homology. After sequence comparison with wild-type AAV9, it was found that the amino acids from the 100th to the 200th position at the N-terminus of the AAV capsid protein amino acid sequence may be the high-frequency recognition region of anti-AAV neutralizing antibodies.

[0066] (3) The adeno-associated virus mutant of the present invention has broad application prospects and huge market value in the field of gene therapy for hemophilia. Attached Figure Description

[0067] Figure 1 This study aims to determine the origin of the coat protein gene sequence in the AAV mutant and the point mutations present in the sequence.

[0068] Figure 2 The evolutionary relationship between AAV mutants and wild types;

[0069] Figure 3 Packaging efficiency of wild-type and mutant AAVs in HEK293 cell line;

[0070] Figure 4 The in vitro infection efficiency of AAV wild-type and mutant strains on Huh7 cells;

[0071] Figure 5 The ability of AAV wild-type and mutant types to evade IVIG neutralizing antibodies in vitro;

[0072] Figure 6(A) shows the ability of wild-type and mutant AAV to evade neutralizing antibodies in normal human peripheral blood serum in vitro, and Figure 6(B) shows the ability of wild-type and mutant AAV to evade neutralizing antibodies in peripheral blood serum of hemophilia patients in vitro.

[0073] Figure 7 The in vivo infection efficiency of mutant 2-10 on human liver cells;

[0074] Figure 8(A) is a schematic diagram of the gene therapy process, and Figure 8(B) shows the treatment effect. Detailed Implementation

[0075] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0076] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0077] Example 1: Obtaining Adeno-Associated Virus Mutants

[0078] This embodiment first uses PCR primers (SEQ ID NO: 11-12) containing specific sequences and restriction enzyme sites to perform conventional PCR, amplifying the capsid protein encoding genes of wild-type adeno-associated virus (AAV) 1-10 purchased from BioAsk, USA, so that the mass of the PCR product reaches more than 1 μg; then the obtained PCR products are mixed and processed using a shuffling PCR kit to obtain an AAV capsid protein mutant library, the specific steps of which are as follows:

[0079] 10 μg of wild-type AAV coat protein gene amplification mixture was incubated with 1 U DNase at 37°C for 5 min, the reaction was terminated with 1 μL of 100 mM EDTA, and the DNA was inactivated at 75°C for 10 min. Fragments of 100–300 bp in length from the DNase digestion product were purified using a DNA purification kit. The purified DNA fragments were reassembled using a high-fidelity enzyme PFU, and the specific splicing conditions are shown in Table 1. The obtained spliced ​​product was recombinantly inserted into the AAV2-ITR plasmid to obtain the AAV vector library.

[0080] Table 1 Shuffling PCR conditions

[0081]

[0082]

[0083] The helper plasmid pXX6-80 and the AAV vector library were transfected into the HEK293 cell line at a ratio of 1:2. After 48 hours, the cells were collected and repeatedly frozen and thawed and sonicated. The cells were then ultracentrifuged overnight in a cesium chloride solution of a certain density. Different layers of cesium chloride solution were collected from the centrifuge tubes. The cesium chloride solution containing AAV was placed in a dialysis bag and dialyzed in PBS to obtain the final PBS solution containing AAV, which is the AAV library.

[0084] Will contain 1×10 13 A 100 μL AAV library of one virus was co-incubated with 100 μL of 1 mg / mL human intravenous immunoglobulin (IVIG) at 4°C for 2 h. Subsequently, the AAV and IVIG mixture was injected into humanized hepatocyte mice via the medial canthal vein. On the third day, 1 × 10⁶ AAV and IVIG were injected via the medial canthal vein. 7 μg adenovirus dl309; On the fifth day, human cells were isolated from mouse livers and DNA was extracted. The capsid protein gene was amplified using primer pair F1 (SEQ ID NO:13): CAACTCCATCACTAGGGGTTC and R1 (SEQ ID NO:14): CATGGGAAAGGTGCCAGA and high-fidelity PFU enzyme, and then re-ligated and integrated into the AAVrep-cap packaging plasmid.

[0085] The above steps are repeated three times to obtain an adeno-associated virus mutant. The mutant can evade the neutralizing effect of neutralizing antibodies against the AAV capsid protein in vivo. The amino acid sequence of the capsid protein of the mutant is shown in SEQ ID NO:1-5, and the nucleic acid sequence is shown in SEQ ID NO:6-10.

[0086] Figure 1The diagram shows the origin of the coat protein gene sequences in each mutant and the point mutations present in the sequences. Further, Clustal W evolutionary analysis was used to calculate the evolutionary relationship between each AAV mutant and wild-type AAV, and the results are shown below. Figure 2 As shown in Table 2, the homology matrix of the five sequences was analyzed using the Alignment function of DNAMAN software for mutants 2-10 (SEQ ID NO:1), 2-19 (SEQ ID NO:2), 4-24 (SEQ ID NO:3), 1-1 (SEQ ID NO:4), and 1-18 (SEQ ID NO:5). The homology matrix of the five sequences is shown in Table 2. It was found that the homology of SEQ ID NO:1 to 5 was 98.02%, which indicates that sequences with more than 98% homology with SEQ ID NO:1 to 5 have the ability to evade neutralizing antibodies.

[0087] Table 2

[0088] LP1-11.seq 96.7% 100% LP2-10.seq 97.0% 96.5% 100% LP3-19.seq 95.2% 97.0% 94.8% 100% LP4-24.seq 97.8% 98.4% 95.7% 97.1% 100%

[0089] Example 2 Packaging of adeno-associated virus mutants

[0090] Large-scale plasmid extraction was performed to obtain Cap-Rep plasmid, luciferase plasmid pTR-CBh-luc, and helper plasmid pXX6-80 for each mutant. Among them, pTR-CBh-luc was digested with Sma1 to detect whether the palindromic ITRs at both ends of the AAV genome were intact. All plasmids were pre-examined by DNA agarose gel electrophoresis to check whether the bands were single and whether they had supercoiled structures, and to ensure that the plasmid solution was not contaminated by a large amount of soluble protein.

[0091] Sixteen hours in advance, the cultured HEK293, free from bacteria, viruses and pathogens, was passaged into a new culture dish (15cm in diameter) at a density of about 70% of the saturation density. The culture medium was 10% FBS + DMEM.

[0092] Prepare the transfection solution. For each 15cm culture dish, you need 9μg of pTR-CBh-luc plasmid, 12μg of the mutant Cap-Rep plasmid, and 15μg of pXX6-80 plasmid. Add the three plasmids to 500μL of DMEM medium and mix well. Then, while shaking, add 150μL of 1μg / μL PEI dropwise. Let it stand at room temperature for 10min. Then, add the mixture to the cell culture supernatant.

[0093] 48 hours later, HEK293 cells were pipetted to suspension, centrifuged at 2000 rpm for 5 min to collect the cell pellet, resuspended in 8.7 mL of ultrapure water, and repeatedly frozen and thawed between dry ice and warm water three times. Cells were lysed by sonication for 2 min, 5 g of cesium chloride was added, and the cells were sonicated for 2 min and placed on ice.

[0094] Centrifuge at 4℃ and 12000rpm for 20min. Insoluble cell debris is suspended on the surface of cesium chloride solution. Carefully transfer the lower transparent cesium chloride solution to an ultracentrifuge tube and centrifuge at 65000rpm for 18 hours using a Sorvall WX 80+Ultracentrifuge ultracentrifuge. Then reduce the brake to 5.

[0095] The centrifuged cesium chloride solution was taken out layer by layer, with each layer having a volume of about 1 mL. The volume was measured using a refractometer. The cesium chloride solution with a refractive index of about 1.37 is the cesium chloride solution containing AAV.

[0096] The cesium chloride solution containing AAV was transferred to a dialysis bag and dialyzed in pre-cooled PBS. Dialysis was performed three times, and the PBS solution containing AAV was collected at the end.

[0097] The concentration of AAV was measured by taking 90 μL of PBS solution containing AAV, adding 10 μL of DNase, digesting at 37°C for 1 hour, and then adding 6 μL of 0.5M EDTA to terminate the reaction; then adding 100 μL of protease digestion solution, digesting at 55°C for 2 hours, and inactivating at 95°C for 5 minutes; the AAV solution was diluted 1000 times with ultrapure water and used as a template for real-time quantitative PCR analysis to calculate the concentration of AAV.

[0098] The results are as follows Figure 3 As shown, AAV2 and AAV3 have high packaging efficiency, while the packaging efficiency of other wild-type and mutant AAVs is acceptable.

[0099] Example 3: In vitro infection efficiency of adeno-associated virus mutants

[0100] The concentrations of wild-type and mutant AAV obtained in Example 2 were adjusted to the same level, and the in vitro infection efficiency of AAV was detected using the human liver tumor cell line Huh7.

[0101] First, Huh7 was evenly distributed into 96-well plates, and after culturing for 16 hours, a total volume of 1×10⁻⁶ was added. 8 μg of AAV was added to each well, and 3 duplicate wells were set up;

[0102] After culturing Huh748 for another 48 hours, the expression level of luciferase in each well was detected using the Promega luciferase assay kit.

[0103] The results are as follows Figure 4As shown, wild-type AAV1, AAV2, AAV3, AAV6 and mutants 2-10 and 2-20 had high infection efficiency in Huh7 cells (AAV expression efficiency in huh7_48hour).

[0104] Example 4: Efficiency of adeno-associated virus mutants in evading IVIG neutralizing antibodies

[0105] Previous experiments revealed the presence of neutralizing antibodies against all wild-type AAVs in human IVIG. In this embodiment, IVIG at an initial concentration of 50 μg / μL was first serially diluted at a ratio of 1:2, with a maximum dilution ratio of 1:8192, resulting in a final IVIG dilution volume of 20 μL. Wild-type and mutant AAVs were then adjusted to contain 1 × 10⁻⁶ AAVs per 20 μL. 8 μg virus;

[0106] IVIG gradient dilutions were incubated with different wild-type and mutant AAVs at 4°C for 30 min. After incubation, the mixture was added to Huh7 cells (serum-free culture) pre-cultured in 96-well plates and cultured for another 48 hours. After 48 hours, the expression level of luciferase was detected using the Promega luciferase assay kit.

[0107] like Figure 5 As shown, wild-type AAV1, 2, 3, 6, and 8 are relatively easily neutralized by the natural neutralizing antibodies present in IVIG, while wild-type AAV9 exhibits strong resistance to neutralizing antibodies. Mutants 1-1, 1-18, 3-19, and 4-24 show strong resistance to neutralizing antibodies, while mutant 2-10 almost completely evades the neutralizing effect of IVIG. This indicates that mutant AAVs capable of evading neutralizing antibodies in IVIG have been successfully screened from the mutant library.

[0108] Example 5: Efficiency of adeno-associated virus mutants in evading peripheral blood neutralizing antibodies

[0109] In this embodiment, the approximate range of AAV antibody concentrations in peripheral blood serum from 19 healthy individuals and 26 hemophilia patients was first determined. Subsequently, eight serial dilutions were performed at a ratio of 1:2, and a PBS control group without neutralizing antibodies was set up.

[0110] Mix 20 μL of serum diluent with 20 μL (1×10) 8 Different wild-type and mutant AAVs (μg) were incubated at 4°C for 30 min. After incubation, the mixture was added to Huh7 cells (serum-free culture) pre-cultured in 96-well plates and cultured for another 48 hours. After 48 hours, the expression level of luciferase was detected using the Promega luciferase assay kit, and the titer of AAV neutralizing antibody in serum samples was calculated.

[0111] The titers of anti-AAV neutralizing antibodies in healthy serum samples and patient serum samples are shown in Figure 6(A) and Figure 6(B), respectively. The data were visualized, with the scale bar indicating the serum dilution factor; a higher dilution factor and a darker color indicate a higher concentration of neutralizing antibodies in the serum. Analysis of the results revealed that the positive rate of anti-AAV neutralizing antibodies in peripheral blood serum of hemophilia patients was lower than that of healthy individuals, although nearly one-third of hemophilia patients still had anti-AAV neutralizing antibodies in their peripheral blood serum. The mutant 2-10 significantly evaded the neutralizing effect of neutralizing antibodies, reducing the positive rate of wild-type AAV neutralizing antibodies in serum from one-third to one-eighth. The use of the mutant 2-10 is expected to enable more hemophilia patients to receive AAV gene therapy.

[0112] Since mutant 2-10 can effectively evade AAV neutralizing antibodies, a comparison of the antibody expression profiles of wild-type and mutant AAV revealed that the antibody expression profiles of AAV9 and 2-10 are quite similar. Figure 1 Analysis of the origins of various mutants suggests that amino acids 100 to 200 from the N-terminus of the outer shell protein amino acid sequence may be the high-frequency recognition region for anti-AAV neutralizing antibodies.

[0113] Example 6: In vivo infection efficiency of adeno-associated virus mutants 2-10

[0114] This embodiment uses humanized hepatocyte mice for in vivo validation experiments. Humanized hepatocyte mice can represent the complex in vivo environment and directly detect the infection and expression efficiency of AAV in human hepatocytes. AAV8, as an AAV gene therapy vector, has been successfully applied in multiple clinical trials. In this embodiment, AAV8-GFP is used as a control to detect the infection and expression efficiency of mutant 2-10GFP in humanized hepatocyte mice.

[0115] 1×10 11 μg AAV8-GFP and 2-10GFP were intravenously injected into humanized mice with liver cells. Seven days later, the livers of the mice were isolated and immunofluorescence stained. The staining was performed using TRITC-labeled anti-human albumin antibody, and the livers were observed and photographed using a confocal fluorescence microscope.

[0116] like Figure 7 As shown, there was no significant difference in the ability of AAV8 and 2-10 to infect human liver cells in humanized mice, indicating that while 2-10 has evolved the ability to evade AAV neutralizing antibodies, it has not weakened its specific ability to infect human liver cells in vivo.

[0117] Example 7: Gene therapy effect of adenovirus mutant LP2-10 on AAV neutralizing antibody-positive coagulation factor 9 gene-deficient mice.

[0118] In this embodiment, we simulated the gene therapy process of hemophilia patients with AAV neutralizing antibodies in vivo, as shown in Figure 8(A). First, F9 KO mice were immunized subcutaneously with AAVs (a mixture of AAV1 / 2 / 3 / 6 / 8 / 9). On day 13, peripheral blood was collected, and the AAV neutralizing antibody detection system was used to detect whether neutralizing antibodies against AAV were successfully induced. The results showed that AAVs as antigens could induce neutralizing antibodies against AAV1 / 2 / 3 / 6 / 8. On day 14, AAV8 / F9 and LP2-10-F9 were injected intravenously. Peripheral blood was collected on days 28 and 42 to detect the level of hF9, as shown in Figure 8(B). In mice with neutralizing antibodies, the hF9 level of the gene therapy group with LP2-10 as the vector was significantly higher than that of the AAV8 group. In mice without immunization, the gene therapy effect of LP2-10 was slightly lower than that of AAV8, but there was no significant difference.

[0119] In summary, this invention constructs an adeno-associated virus (AAV) library by splicing and recombinating the capsid protein-encoding gene of wild-type AAV. Five AAV mutants were obtained by screening with neutralizing antibodies against the AAV capsid protein. These mutants have the ability to evade AAV neutralizing antibodies and exhibit highly efficient and specific infection ability against human liver cells. They have broad application prospects and huge market value in the field of gene therapy for hemophilia.

[0120] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. An adeno-associated virus mutant, characterized in that, The amino acid sequence of the capsid protein of the adeno-associated virus mutant is shown in SEQ ID NO:

5.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the outer shell protein of the adeno-associated virus mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleic acid sequence of the nucleic acid molecule is shown in SEQ ID NO:

10.

4. An expression carrier, characterized in that, The expression vector includes a wild-type adeno-associated virus vector into which the nucleic acid molecule of claim 2 is inserted.

5. The expression vector according to claim 4, characterized in that, The wild-type adeno-associated virus vector is AAV2.

6. A method for preparing an adeno-associated virus mutant, characterized in that, The method includes co-transfecting mammalian cells with the expression vector and helper plasmid as described in claim 3; lysing the mammalian cells after culture to obtain the adeno-associated virus mutant.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises any one or a combination of at least two of the adeno-associated virus mutant of claim 1, the nucleic acid molecule of claim 2, or the expression vector of claim 4.

8. The pharmaceutical composition according to claim 7, characterized in that, The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

9. The use of the adeno-associated virus mutant of claim 1, the nucleic acid molecule of claim 2, the expression vector of claim 4, or the pharmaceutical composition of claim 7 in the preparation of a drug vector for treating gene defects; The genetic defect is hemophilia.