Preparation and isolation of RNA-binding proteins

CN116063445BActive Publication Date: 2026-09-18PEKING UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202111299989.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-04
Publication Date
2026-09-18
Estimated Expiration
2041-11-04

Smart Images

  • Figure CN116063445B_ABST
    Figure CN116063445B_ABST
Patent Text Reader

Abstract

The present disclosure provides a pretreatment method and a separation method of RNA-binding proteins, relating to the field of biomedicine. The pretreatment method comprises: obtaining a cytoplasm extract; ultrasonic crushing the cytoplasm extract, and centrifuging the obtained mixture to obtain a supernatant; treating the supernatant obtained in the centrifugation step by fast protein liquid chromatography (FPLC) to obtain a fraction containing a target RNA-binding protein; and separating the RNA-binding protein (i.e., the target RNA-binding protein) that specifically binds to the target RNA molecule from the fraction obtained by the FPLC. By treating the cells by using the pretreatment method, the efficiency of screening specific proteins in the process of separating RNA-binding proteins from the cells is improved, and the amount of non-specific proteins is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the biomedical field, and more specifically, to a method for pretreatment and separation of RNA-binding proteins.

[0002] Background Area

[0003] RNA-binding proteins (RBPs) are a large class of proteins in cells that can bind to double-stranded or single-stranded RNA to form RNA-protein complexes. By recognizing and binding to RNA, RBPs can regulate RNA stability, alternative splicing, maturation and transport, and even function, thereby affecting related physiological and pathological processes.

[0004] Miguel A. Esteban and colleagues at the Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, designed the RICK (Newly Transcribed RNA Interactome Using Click Chemistry) technology. Using nucleic acid labeling technology, they cleverly labeled newly synthesized RNA with biotin. Then, through streptavidin-coupled magnetic beads, they separated the corresponding labeled RNA molecules and the protein molecules bound to them.

[0005] CN106093436A discloses a simple kit for detecting RNA-protein interactions and its usage method. The kit includes a mixture of biotin-labeled UTP, ATP, CTP, and GTP; T7 RNA polymerase; cell lysis buffer; streptokinase affinity magnetic beads; washing buffer; and protein elution buffer. The kit uses RNA to capture interacting proteins. First, RNA with a known sequence is labeled (e.g., biotin). This label immobilizes the RNA onto magnetic beads. The RNA is then co-incubated with a protein-containing substance. Afterward, the supernatant that has not interacted with the RNA is removed, and the protein washed off the magnetic beads is collected. The obtained protein can be used for mass spectrometry or Western blotting experiments.

[0006] However, although specific binding is usually used to isolate RBPs in existing technologies, a large number of non-specific proteins often appear in the process of isolating specific RNA-binding proteins from cells using existing methods. This results in high background noise, low screening efficiency, and the failure to identify RNA-binding proteins that interact with bait RNA.

[0007] Through long-term and unremitting research, the inventors of this invention have discovered that the above-mentioned defects in the prior art are related to the lack of understanding of cell sample pretreatment by those skilled in the art. Summary of the Invention

[0008] To overcome the shortcomings of existing technologies, this disclosure provides a pretreatment method and a separation method for RNA-binding proteins. Specifically, this disclosure provides the following technical solutions.

[0009] This disclosure provides a pretreatment method for isolating RNA-binding proteins from cells, comprising the following steps:

[0010] (1) Obtain cytoplasmic extracts without cell nuclei;

[0011] (2) Cytoplasmic extract obtained by ultrasonic disruption and / or repeated freeze-thaw cycles.

[0012] Furthermore, the above pretreatment method may include performing protein chromatography on the cytoplasmic extract obtained by ultrasonic disruption and / or repeated freeze-thaw cycles, and collecting the fraction containing RNA-binding proteins.

[0013] Furthermore, the above pretreatment method may include the step of removing cytoskeletal proteins from a fraction containing RNA-binding proteins.

[0014] In this disclosure, ultrasonic disruption and repeated freeze-thaw cycles can be performed alternately or sequentially. For example, ultrasonic disruption can be performed once during each freeze-thaw cycle. Alternatively, ultrasonic disruption can be followed by repeated freeze-thaw cycles, or vice versa.

[0015] For example, repeated freeze-thaw cycles in this disclosure refer to two or more freeze-thaw cycles, such as 3-5 cycles. More specifically, in one aspect, embodiments of this disclosure provide a pretreatment method for isolating RNA-binding proteins from cells, characterized in that the method includes:

[0016] Obtain cytoplasmic extract;

[0017] The cytoplasmic extract was ultrasonically disrupted, and the resulting mixture was centrifuged to obtain the supernatant.

[0018] The supernatant obtained by centrifugation was treated by rapid protein liquid chromatography (FPLC) to obtain a fractional blend containing a target RNA binding protein, wherein the target RNA binding protein is an RNA binding protein that specifically binds to a target RNA molecule.

[0019] The target RNA binding protein was isolated from the fraction obtained by FPLC.

[0020] In some embodiments, the step of obtaining the cytoplasmic extract includes:

[0021] Collect cells;

[0022] The cells were digested with trypsin, then centrifuged and the supernatant was discarded.

[0023] Add HEPES buffer containing protease inhibitors, incubate on ice, and then add NP-40;

[0024] Centrifuge and retain the supernatant to obtain the cytoplasmic extract.

[0025] In some embodiments, after the step of obtaining the cytoplasmic extract, the method further includes:

[0026] The obtained cytoplasmic extract was subjected to repeated freeze-thaw cycles at low temperatures (e.g., -80°C), for example, 3-5 times.

[0027] In some embodiments, the step of sonicating the cytoplasmic extract and centrifuging the resulting mixture to obtain a supernatant includes:

[0028] The cytoplasmic extract was ultrasonically disrupted for 4-6 minutes at intervals of 3-8 seconds and for an ultrasonic duration of 3-8 seconds.

[0029] The resulting mixture was centrifuged at 10,000-12,000 rpm for 5-20 minutes at 4°C, and the supernatant was retained.

[0030] In some embodiments, after the steps of sonicating the cytoplasmic extract and centrifuging the resulting mixture to obtain a supernatant, the method further includes:

[0031] Filter the supernatant obtained from centrifugation;

[0032] Place the filtered supernatant in a protein concentration column and centrifuge at 12,000 rpm for 10-20 minutes at 4°C.

[0033] Take the concentrate and resuspend it with an appropriate amount of PBS to obtain a concentrated supernatant of suitable concentration.

[0034] In some embodiments, the step of treating the supernatant obtained by centrifugation with FPLC to obtain a fractional blend containing the target RNA-binding protein further includes:

[0035] Collect multiple streams processed by FPLC in chronological order;

[0036] The multiple fractions were subjected to discontinuous SDS-PAGE gel electrophoresis, followed by silver staining to obtain a distribution map of proteins of different molecular weights in the multiple fractions.

[0037] Based on the distribution map, one or more fractions containing the target RNA binding protein are identified, and the one or more fractions are merged to obtain the fraction blend containing the target RNA binding protein.

[0038] In some embodiments, after the step of separating the target RNA-binding protein from the fraction obtained from FPLC, the method further includes:

[0039] The cytoskeletal proteins in the fraction containing the target RNA binding protein are removed by immunoprecipitation. The cytoskeletal proteins include at least one of actin, GAPDH, α-tubulin, β-tubulin, and IgG.

[0040] In some embodiments, the step of separating the target RNA-binding protein from the fraction obtained by FPLC further includes:

[0041] Biotin-labeled target RNA molecules were immobilized on streptavidin-conjugated magnetic beads;

[0042] Magnetic beads immobilized with the target RNA molecule were co-incubated with a fraction obtained from FPLC;

[0043] Washing is performed to remove proteins that are not bound to the target RNA molecule;

[0044] The proteins that specifically bind to the target RNA molecule on the magnetic beads are collected, thereby achieving the separation of the target RNA-binding proteins.

[0045] In some implementations, the target RNA molecules include p21, p16, and apolipoprotein APOE.

[0046] This disclosure also provides a method for isolating RNA-binding proteins from cells, comprising the steps of the pretreatment method described in this disclosure.

[0047] Furthermore, the method for isolating RNA-binding proteins from cells described in this disclosure further includes the step of capturing and isolating RNA-binding proteins from a pretreated sample via RNA capture. For example, RNA-binding proteins can be captured and isolated using magnetic beads immobilized with RNA.

[0048] In other aspects, embodiments of this disclosure provide a kit for implementing the pretreatment or separation methods described in any of the embodiments above.

[0049] In the pretreatment method provided in this embodiment, cytoplasmic extract is obtained by separating the nucleus and cytoplasm of cells. The cytoplasmic extract is then sonicated and centrifuged to obtain a supernatant. The supernatant is further processed by rapid protein liquid chromatography to obtain a fractional blend containing target RNA-binding proteins. In subsequent separation of specific RNA-binding proteins from the fractional blend obtained through the above pretreatment process using in vitro transcribed, biotin-labeled target RNA fragments as bait, the efficiency of specific protein screening in the process of isolating RNA-binding proteins from cells is improved, while the amount of non-specific proteins and background noise are reduced.

[0050] The features, functions and advantages may be implemented independently in several embodiments of this disclosure, or may be combined in other embodiments, as further details can be found in the following description and figures. Attached Figure Description

[0051] Figure 1 An experimental design flowchart for the identification method of RNA-binding proteins according to this disclosure is shown.

[0052] Figure 2 The figure shows the effect of nuclear-cytoplasmic separation after HeLa cell nuclear-cytoplasmic separation, verified by immunoblotting.

[0053] Figure 3 The image shows the silver staining results of different fractions collected in chronological order after FPLC processing, separated by SDS-PAGE gel electrophoresis. (A) represents samples 15-41 (odd numbers) from the FPLC fractions; (B) represents samples 16-42 (even numbers) from the FPLC fractions; and (C) represents samples 39-51 from the FPLC fractions.

[0054] Figure 4 The peaks of cytoplasmic proteins were filtered out using a rapid protein liquid chromatography (FPLC) system.

[0055] Figure 5 The following graph shows the Western blot results of FPLC fractions containing target RNA-binding proteins after three rounds of antibody immunoprecipitation. (A) represents the mixed sample from groups 31+33+35+37 of the FPLC fractions; (B) represents the mixed sample from groups 30+32+34+36+38 of the FPLC fractions.

[0056] Figure 6The preparation of p21 mRNA-related probes is shown. Among them, (A) shows a schematic diagram of the structure of p21 mRNA; (B) shows an agarose gel electrophoresis image of the PCR amplification product of the coding region (CR) of p21; and (C) shows an agarose gel electrophoresis image of the PCR amplification product of the 3'UTR of p21.

[0057] Figure 7 Silver staining images of p21 coding region (CR) and 3'UTR binding proteins captured in samples with different treatment methods are shown. (A) shows silver staining images of p21 coding region (CR) and 3'UTR binding proteins enriched in HeLa whole-cell extracts (i.e., without nuclear-cytoplasmic separation, repeated freeze-thaw cycles, sonication, ultrafiltration concentration, FPLC, and immunoprecipitation); (B) shows silver staining images of p21 coding region (CR) and 3'UTR binding proteins enriched in purified HeLa cytoplasmic extracts (i.e., only after nuclear-cytoplasmic separation, but without repeated freeze-thaw cycles, sonication, ultrafiltration concentration, FPLC, and immunoprecipitation); (C) shows silver staining images of p21 coding region (CR) and 3'UTR binding proteins enriched in purified HeLa cytoplasmic extracts. Silver staining images of the coding region (CR) and 3'UTR binding protein of p21 captured in the supernatant collected after repeated freeze-thaw cycles, sonication, ultrafiltration concentration, and FPLC filtration, and after three rounds of immunoprecipitation to remove cytoskeleton proteins; (D) shows silver staining images of the coding region (CR) and 3'UTR binding protein of p21 captured in the supernatant collected after repeated freeze-thaw cycles, sonication, ultrafiltration concentration, and FPLC filtration, and after three rounds of immunoprecipitation to remove cytoskeleton proteins.

[0058] Figure 8 Silver staining images of the p21 coding region (CR) and 3'UTR binding protein captured in samples treated with different methods are shown. (A) shows the silver staining image of the p21 coding region (CR) and 3'UTR binding protein captured in the supernatant collected after the HeLa cytoplasmic extract was subjected only to ultrafiltration concentration and FPLC filtration without repeated freeze-thaw cycles and sonication, followed by collection of fractions 30+32+34+36+38 and removal of cytoskeleton proteins via three rounds of immunoprecipitation. (B) shows the silver staining image of the p21 coding region (CR) and 3'UTR binding protein captured in the supernatant collected after the HeLa cytoplasmic extract was subjected only to repeated freeze-thaw cycles, ultrafiltration concentration and FPLC filtration, followed by collection of fractions 30+32+34+36+38 and removal of cytoskeleton proteins via three rounds of immunoprecipitation.

[0059] Figure 9The diagram shows RNA-binding proteins enriched at the 3'UTR of p21 obtained using the method according to this disclosure. (A), (B), and (C) represent mass spectrometry results from three independent experiments (groups 1 to 3), respectively; (D) represents the protein obtained after intersecting the three experiments (where bold and underlined proteins are p21 3'UTR-specific binding proteins reported in previous literature).

[0060] Figure 10 This demonstrates the use of RNA binding assays and Western blotting assays to... Figure 7 The figure shows the validation of the representative RNA-binding proteins ELAVL1 (HuR) and HNRNPD.

[0061] Figure 11 The diagram shows RNA-binding proteins enriched using the coding region (CR) and 3'UTR of p16 as probes. (A) shows a silver-stained image of the p16 coding region (CR) and 3'UTR-binding proteins captured in the supernatant collected after FPLC filtration of purified HeLa cytoplasmic extract and collection of fractions 30+32+34+36+38, followed by three rounds of immunoprecipitation to remove scaffold proteins. (B) shows the p16 3'UTR-related RNA-binding proteins identified by mass spectrometry analysis of the proteins recovered from the silver-stained bands.

[0062] Figure 12 The diagram shows RNA-binding proteins enriched using the coding region (CR) and 3'UTR and 5'UTR of mouse apolipoprotein APOE mRNA as probes. (A) shows a silver-stained image of the CR, 3'UTR, and 5'UTR binding proteins of APOE mRNA captured in the supernatant collected after FPLC filtration of purified Hepa1-6 cytoplasmic extracts and collection of fractions 30+32+34+36+38, followed by three rounds of immunoprecipitation to remove skeletal proteins; (B) shows the APOE 3'UTR-related RNA-binding proteins identified by mass spectrometry analysis of proteins recovered from the silver-stained bands; and (C) shows a diagram validating representative RNA-binding proteins using RNA binding assays and Western blotting. Detailed Implementation

[0063] The examples described below are illustrative in nature and are not intended to limit this disclosure, its application, or its uses. Furthermore, the advantages provided by the examples and embodiments described below are illustrative in nature and not all examples and embodiments provide the same or the same degree of advantage.

[0064] This specific implementation includes the following sections: (1) Definitions; (2) Overview; and (3) Examples.

[0065] definition

[0066] Unless otherwise stated, the following definitions apply to this document.

[0067] When used in conjunction with a numerical value, “approximately” means ±5% of the value being modified.

[0068] The terms “include,” “contain,” and “have” (and their variations) are used interchangeably to mean that something includes but is not limited to, and are open-ended terms that are not intended to exclude other unreferenced elements or method steps.

[0069] Terms such as “first,” “second,” and “third” are used to distinguish or identify individual members in a group, without intending to restrict the order or numerical value.

[0070] Fast protein liquid chromatography (FPLC) is a type of protein liquid chromatography. Its principle is similar to high-performance liquid chromatography (HPLC). It incorporates gas chromatography theory from classic liquid column chromatography, with improvements to the phase medium. It utilizes a high-pressure pump, a highly sensitive detector, gradient elution device, automatic collection device, and microcomputers to develop modern liquid chromatography. It not only retains the speed and high resolution of HPLC but also offers advantages such as large column capacity, high recovery efficiency, and less likelihood of inactivating biomolecules.

[0071] "p21" is the cell cycle inhibitor protein with the broadest known CDK inhibitory activity. It has the functions of broadly inhibiting cyclin-complexes, negatively regulating CDK, and playing a role in tumor suppression.

[0072] p16 is an important tumor suppressor gene that inhibits cyclin-dependent kinases CDK4 and CDK6 and is a regulatory gene for the G1 / S phase transition of the cell cycle.

[0073] Apolipoprotein E (APOE) is an important component of plasma lipoproteins and plays a crucial regulatory role in plasma lipid metabolism. Its gene can regulate many biological functions and is associated with the pathogenesis of many diseases.

[0074] Actin is a type of cytoskeletal protein, a globular protein with a molecular weight of approximately 42,000. It is found in all eukaryotic cells except for sperm cells of nematodes. Actin is one of the two monomeric subunits of microfilaments, which are one of the three major structural components of the cytoskeleton. Actin also constitutes the contractile tissues in muscle cells. Therefore, actin plays a significant role in cellular activities, such as muscle contraction, cell migration, division and protoplasmic flow, vesicle and organelle movement, intercellular communication, and the establishment and maintenance of cell shape and connections.

[0075] Tubulins are a family of cytoskeletal proteins with multiple members. The most common members are α-tubulin and β-tubulin, which are the main components of microtubules. Microtubules are formed by the aggregation of dimers of α-tubulin and β-tubulin. The degree of tubulin aggregation within the cell affects the length of microtubules and, in turn, cell morphology.

[0076] Overview

[0077] Overall, the pretreatment methods and kits for isolating RNA-binding proteins from cells, as described in this article, can achieve efficient isolation, screening, and capture of RNA-binding proteins with low background noise, reducing the amount of non-specific proteins present.

[0078] When detecting RNA-protein interactions using existing methods (such as CN106093436A), the inventors found that this method is difficult to effectively screen and identify RNA-binding proteins. The inventors speculate that the reasons are: 1) Conventional cell or tissue lysis methods are insufficient to break down certain organelles or macromolecular complexes in the cytoplasm, preventing the complete release of cytoplasmic proteins and affecting protein capture efficiency; 2) Non-specific signals from interactions between cytoskeleton proteins, non-RNA-binding proteins, and other unknown RNAs and target RNAs cause interference. These potential challenges significantly limit the accuracy and reliability of the screening and identification of target RNA-binding proteins.

[0079] In the pretreatment method provided in this embodiment, cytoplasmic extract is obtained by separating the nucleus and cytoplasm of cells. The cytoplasmic extract is then sonicated and centrifuged to obtain a supernatant. The supernatant is further processed by rapid protein liquid chromatography to obtain a fractional blend containing target RNA-binding proteins. In subsequent separation of specific RNA-binding proteins from the fractional blend obtained through the above pretreatment process using in vitro transcribed, biotin-labeled target RNA fragments as bait, the efficiency of specific protein screening in the process of isolating RNA-binding proteins from cells is improved, while the amount of non-specific proteins and background noise are reduced.

[0080] In some embodiments, this disclosure provides a pretreatment method for isolating RNA-binding proteins from cells, the method comprising:

[0081] Obtain cytoplasmic extract;

[0082] The cytoplasmic extract was ultrasonically disrupted, and the resulting mixture was centrifuged to obtain the supernatant.

[0083] The supernatant obtained by centrifugation was treated by rapid protein liquid chromatography (FPLC) to obtain a fractional blend containing a target RNA binding protein, wherein the target RNA binding protein is an RNA binding protein that specifically binds to a target RNA molecule.

[0084] The target RNA binding protein was isolated from the fraction obtained by FPLC.

[0085] In some embodiments, the step of obtaining the cytoplasmic extract includes:

[0086] Collect cells;

[0087] The cells were digested with trypsin, then centrifuged and the supernatant was discarded.

[0088] Add HEPES buffer containing protease inhibitors, incubate on ice, and then add NP-40; optionally, after thoroughly dispersing NP-40, centrifuge at 4°C, 500g for 3-5 minutes, preferably 5 minutes.

[0089] Centrifuge and retain the supernatant to obtain the cytoplasmic extract.

[0090] The inventors have discovered that by adding a nucleoplasmic separation step to obtain cytoplasmic extracts, the non-specific binding of nucleoproteins to RNA can be effectively removed, thereby effectively reducing the RNA binding background. Furthermore, by using FPLC to separate the concentrated proteins, protein-protein and RNA-protein complexes in the system can be removed, allowing for the acquisition of as many free proteins as possible, thereby improving screening efficiency and reducing non-specific binding.

[0091] In some embodiments, after the step of obtaining the cytoplasmic extract, the method further includes:

[0092] The obtained cytoplasmic extract was subjected to repeated freeze-thaw cycles at -80°C 3-5 times.

[0093] In some embodiments, the step of sonicating the cytoplasmic extract and centrifuging the resulting mixture to obtain a supernatant includes:

[0094] The cytoplasmic extract was ultrasonically disrupted for 4-6 minutes at intervals of 3-8 seconds and for an ultrasonic duration of 3-8 seconds.

[0095] The resulting mixture was centrifuged at 10,000-12,000 rpm for 5-20 minutes at 4°C, and the supernatant was retained.

[0096] The inventors have discovered that by repeatedly freezing and thawing cytoplasmic extracts and then sonicating them, organelles in the cytoplasm can be destroyed, cytoplasmic proteins can be fully released, and screening efficiency can be improved. The inventors further discovered that when the cytoplasmic extracts are repeatedly frozen and thawed at -80°C 3-5 times, preferably 3-4 times, followed by sonication for 4-6 minutes (with intervals of 3-8 seconds and sonication duration), and then centrifuged at 4°C, 12,000 rpm for 5-20 minutes, optionally 5-15 minutes, preferably 10-15 minutes, the final silver staining results show the best separation effect, with a good balance between the level of background noise reduction and the types of proteins captured.

[0097] In some embodiments, after the steps of sonicating the cytoplasmic extract and centrifuging the resulting mixture to obtain a supernatant, the method further includes:

[0098] Filter the supernatant obtained from centrifugation;

[0099] Place the filtered supernatant in a protein concentration column (such as a 3K protein concentration column) and centrifuge at 12,000 rpm for 10-20 minutes, preferably 10-15 minutes, at 4°C.

[0100] Take the concentrate and resuspend it with an appropriate amount of PBS to obtain a concentrated supernatant of suitable concentration.

[0101] In some embodiments, the step of treating the supernatant obtained by centrifugation with FPLC to obtain a fractional blend containing the target RNA-binding protein further includes:

[0102] Collect multiple streams processed by FPLC in chronological order;

[0103] The multiple fractions were subjected to SDS-PAGE gel electrophoresis, followed by silver staining to obtain a distribution map of proteins of different molecular weights in the multiple fractions.

[0104] Based on the distribution map, one or more fractions containing the target RNA binding protein are identified, and the one or more fractions are merged to obtain the fraction blend containing the target RNA binding protein.

[0105] The inventors have discovered that performing SDS-PAGE gel electrophoresis on FPLC fractions, followed by silver staining to obtain a distribution map of proteins with different molecular weights in the multiple fractions, and selecting appropriate fraction blends based on this distribution map, helps to obtain pretreated samples with high abundance, low protein complex content, and an overall protein molecular weight below 200 kDa. Preferably, fraction groups with an overall molecular weight below 200 kDa are selected for merging. In some embodiments, any 2, 3, 4, 5, 6, 7, 8, or 9 fractions from fraction groups 30-38 can be selected for mixing to obtain the fraction blend. In some preferred embodiments, any 2, 3, or 4 fractions from fraction groups 35-38 can be selected for mixing to obtain the fraction blend.

[0106] In some embodiments, after the step of separating the target RNA-binding protein from the fraction obtained from FPLC, the method further includes:

[0107] The cytoskeletal proteins in the fraction containing the target RNA binding protein are removed by immunoprecipitation. The cytoskeletal proteins include at least one of actin, GAPDH, α-tubulin, β-tubulin, and IgG.

[0108] The inventors have discovered that using immunoprecipitation to remove skeletal proteins such as actin, GAPDH, and tubulin from fractions can better remove non-specific bindings and reduce background noise.

[0109] In some embodiments, the step of separating the target RNA-binding protein from the fraction obtained by FPLC further includes:

[0110] Biotin-labeled target RNA molecules were immobilized on streptavidin-conjugated magnetic beads;

[0111] The magnetic beads immobilized with the target RNA molecule were co-incubated with the fraction obtained from S3;

[0112] Washing is performed to remove proteins that are not bound to the target RNA molecule;

[0113] The proteins that specifically bind to the target RNA molecule on the magnetic beads are collected, thereby achieving the separation of the target RNA-binding proteins.

[0114] By employing biotin-labeled target RNAs, RNA-binding proteins that bind to target RNA molecules or fragments can be selectively isolated, captured, enriched, and identified.

[0115] In some implementations, the target RNA molecules include p21, p16, and apolipoprotein APOE.

[0116] In another aspect, this disclosure provides a kit for implementing the pretreatment and separation methods of any of the above embodiments.

[0117] The pretreatment and separation methods provided in this disclosure can be used to screen RNA-binding proteins that bind to specific RNAs, as well as to screen and identify new RNA-binding proteins.

[0118] Example

[0119] The present invention will be described below through specific embodiments, but the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0120] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0121] (I) Instruments, materials and actual preparation

[0122] 1. Main instruments:

[0123] CO2 incubator: A product of Thermo Scientific, USA;

[0124] Cell culture clean bench: a product of Thermo Scientific, USA;

[0125] Pipettes: Eppendorf, Germany;

[0126] High-speed refrigerated centrifuge: Eppendorf GmbH, Germany;

[0127] Full-wavelength scanning multi-function reader: Thermo Scientific, USA;

[0128] -80℃ ultra-low temperature freezer: Thermo Fisher Scientific, USA;

[0129] -20℃ Ultra-Low Temperature Freezer: China Meiling Corporation;

[0130] Thermostatic heating table: Eppendorf GmbH, Germany;

[0131] Scanner: Epson Corporation, Japan;

[0132] DNA agarose gel electrophoresis system: Bio-Rad, USA;

[0133] Image master gel imaging system and image analysis software: Pharmacia, Sweden;

[0134] MVS-1 Vortex Mixer: Beijing Beide Scientific Instruments Co., Ltd.;

[0135] Horizontal shaking table: Haimen Qilin Bell Instrument Manufacturing Co., Ltd.;

[0136] Vertical shaking table: Haimen Qilin Bell Instrument Manufacturing Co., Ltd.;

[0137] PCR instrument: Bio-Rad Laboratories, USA;

[0138] Electronic balance: Shanghai Precision Instruments Co., Ltd.

[0139] Vertical slab electrophoresis system: Bio-Rad, USA;

[0140] Electropter: Bio-Rad Systems, Inc., USA;

[0141] Gradient gel electrophoresis system: Invitrogen, USA;

[0142] HWI constant temperature water bath: Beijing Medical Equipment Factory;

[0143] Inverted phase contrast microscope: Olympus Corporation, Japan;

[0144] Vibra Cell ultrasonic disruptor: Sonics, Inc., USA;

[0145] Pure chromatography system: GE Healthcare, USA;

[0146] Superose 6 10 / 300: GE Healthcare, USA;

[0147] UV crosslinker: Hoefer Corporation, USA;

[0148] Magnetic frame: Invitrogen, USA.

[0149] 2. Main reagents and consumables:

[0150] Cell culture reagents: DMEM (4.5 g / L glucose, containing L-glutamine) cell culture medium and fetal bovine serum were both products of Hyclone, USA. Trypsin was purchased from Maichen Technology (Beijing) Co., Ltd. Penicillin and streptomycin were purchased from Thermo Fisher Scientific, cell culture dishes and plates were purchased from BD Biosciences, and cell scrapers and shovels were products of Corning, USA.

[0151] DNA agarose gel electrophoresis reagent: Ordinary agarose was purchased from Beijing Dingguo Biotechnology Co., Ltd.;

[0152] Trans2K plus Marker was purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0153] The DL2000 was purchased from Takara Corporation of Japan;

[0154] Diethyl pyrocarbonate (DEPC) was purchased from Invitrogen, USA.

[0155] Dynabeads M-280 streptavidin was purchased from Invitrogen, USA.

[0156] The protease inhibitor Cocktail was purchased from Roche, Switzerland.

[0157] Biotin-11-UTP was purchased from Biotium, Inc., USA.

[0158] RiboLock RNase inhibitors were purchased from Thermo Fisher Scientific, Inc., USA.

[0159] The sterile needle filter was purchased from Pall, USA.

[0160] The ultrafiltration concentrator tubes were purchased from Millipore, USA.

[0161] 3. Main reagent kit:

[0162] The BCA protein quantification kit was purchased from Thermo Scientific, USA.

[0163] The agarose gel DNA recovery kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0164] The RNA purification kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0165] The RNA reverse osmosis kit was purchased from Beijing TransGen Biotech Co., Ltd.

[0166] The T7 in vitro transcription kit was purchased from Thermo Scientific, USA.

[0167] The kits for preparing nuclear and cytoplasmic proteins were purchased from Beijing Pulilai Gene Technology Co., Ltd.

[0168] The gel filtration calibration kit was purchased from GE Healthcare, USA.

[0169] The ECL chemiluminescence reagent kit was purchased from Beijing Bio-Long Immunotechnology Co., Ltd.

[0170] The silver staining kit was purchased from Thermo Fisher Scientific, USA.

[0171] 4. Main reagents and preparation:

[0172] (1) Cell culture related reagents

[0173] 1) PBS solution: NaCl 8.5g, KCl 0.2g, Na2HPO4·12H2O 2.85g, KH2PO4 0.27g, adjust pH to 7.0, and bring volume to 1000mL of triple-distilled water. Autoclave and store at 4℃ for later use.

[0174] (2) Western blot reagents

[0175] 1) Triple-decontamination cell lysis buffer: 50mM Tris-HCl (pH 8.0), 150mM NaCl, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate;

[0176] 2) 30% Acrylamide: 29.2g acrylamide, 0.8g N,N'-methylenebisacrylamide, add distilled water to 100mL, filter with filter paper, and store in a brown bottle at 4℃;

[0177] 3) 10% separating gel (10 mL): 4.0 mL distilled water, 3.3 mL 30% acrylamide, 2.5 mL 1.5 M Tris-HCl (pH 8.8), 0.1 mL 10% SDS, 0.1 mL 10% ammonium persulfate, 0.004 mL TEMED;

[0178] 4) 5% Stacking Gel (5mL): 3.4mL distilled water, 0.83mL 30% acrylamide, 0.63mL 1.5M Tris-HCl (pH 8.8), 0.05mL 10% SDS, 0.05mL 10% ammonium persulfate, 0.005mL TEMED;

[0179] 5) 6× loading buffer: 300mM Tris-HCl (pH 6.8), 12% SDS, 0.6% bromophenol blue, 60% glycerol, 6% mercaptoethanol;

[0180] 6) Tris-HCl-glycine electrophoresis buffer: 25mM Tris-HCl (pH 8.3), 250mM glycine, 0.1% SDS;

[0181] 7) Electroporation buffer: 39mM glycine, 48mM Tris-HCl, 0.037% SDS, 20% methanol;

[0182] 8) Coomassie Brilliant Blue Decolorizing Solution: 45 mL methanol, 45 mL distilled water, 10 mL glacial acetic acid, mix well;

[0183] 9) Sealing solution: 5% skim milk powder, prepared with TBST;

[0184] 10) TBST: 100mM Tris-HCl (pH 7.5), 0.9% NaCl, 0.1% Tween 20;

[0185] 11) Developer solution: Take 2.54g of developer powder from the small packet, add it to 300mL of triple-distilled water, stir in the dark until it is completely dissolved, then add 32.4g of developer powder from the large packet, stir and mix well to dissolve, and make up the volume with triple-distilled water to 500mL. Store at room temperature in the dark for later use.

[0186] 12) Fixing solution: Take 11.52g of fixing powder packet, add it to 300mL of triple-distilled water, stir in the dark until it is completely dissolved, then add 42.62g of fixing powder packet, stir and mix until dissolved, and make up to 500mL with triple-distilled water. Store at room temperature in the dark for later use.

[0187] 13) Cytoplasmic and nuclear protein extraction buffer:

[0188] The formulation of buffer A is: 10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, plus protease inhibitor / DTT (5 mM);

[0189] Buffer B formulation: 20mM HEPES (pH 7.9), 0.45M NaCl, 1mM EDTA, plus protease inhibitor / DTT (5mM).

[0190] (3) RNA pull-down test reagents:

[0191] 1) 2×TENT buffer: 20mM Tris-HCl (pH=8.0), 2mM EDTA (pH=8.0), 500mM NaCl, 1% Triton X-100;

[0192] 2) Solution A: 0.1M NaOH, 0.05M NaCl;

[0193] 3) Solution B: 0.1M NaCl.

[0194] (II) Experimental Methods:

[0195] 1. Total RNA was extracted using Trizol. For specific methods, please refer to the Trizol instruction manual from Sigma.

[0196] 2. cDNA was synthesized by reverse transcription using a full-length gold RNA reverse transcription kit:

[0197] (1) The reaction system is as follows:

[0198] 2 μg RNA solution

[0199] 2×TransScript mixture 10μL

[0200] 1 μL of TransScript enzyme

[0201] Random primer (0.5 μg / μl) 1 μL

[0202] To bring the DEPC water level up to 20 μL.

[0203] (2) Mix gently, centrifuge, then centrifuge at 25°C for 10 minutes, 42°C for 30 minutes, 85°C for 5 minutes, stop at 4°C, and store the product at -20°C.

[0204] 3. Primer design:

[0205] Primers for the CR and 3'UTR fragments were designed based on the p21 sequence, and the T7 promoter sequence was added to the 5' end of all upstream primers: 5'-CCAAGCTTCTAATACGACTCACTATAGGGAGA-3' (SEQ ID NO:1)

[0206] p21(CR)-F:ATGTCAGAACCGGCTGGG(SEQ ID NO:2)

[0207] p21(CR)-R:TTAGGGCTTCCTCTTGGAGAAGA(SEQ ID NO:3)

[0208] p21(3'UTR)-F:TCCGCCCACAGGAAG(SEQ ID NO:4)

[0209] p21(3'UTR)-R:AAGTAAAGTCACTAAGAATCATTTATTG (SEQ ID NO:5).

[0210] 4. PCR amplification:

[0211] The reaction system was performed according to the NEB Ultra Fidelity PCR Kit instructions:

[0212]

[0213] Place it in a PCR instrument for PCR, and set the program as follows:

[0214]

[0215] 5. Recover PCR products using the Tiangen agarose gel DNA recovery kit:

[0216] (1) DNA agarose gel electrophoresis:

[0217] Prepare an agarose gel of appropriate concentration using agarose and TBE solution (0.045 mol / L Tris-boric acid, 0.001 mol / L EDTA), and perform electrophoresis on the PCR products. Monitor the electrophoretic results of the desired bands.

[0218] (2) Cut out the target band and recover the PCR product. Refer to the kit instructions for specific steps. Sequencing a portion of the DNA solution for identification is performed. Once the sequencing confirms that the DNA is correct, it can be used as a transcription template.

[0219] Marked probe

[0220] Use the T7 in vitro transcription (Thermo) kit. Following the product instructions, add the reaction reagents according to the following formula:

[0221] NTP mixture:

[0222]

[0223] In vitro transcription reaction mixture:

[0224]

[0225] Incubate at 37°C for 4 hours; add 1 μL of DNase I and incubate at 37°C for 30 minutes; then purify the probe.

[0226] 6. Use the Tiangen RNA purification kit to purify the probe. Store the purified probe at -20℃ for later use. Refer to the kit instructions for specific steps.

[0227] 7. Extraction of cytoplasmic and nuclear proteins:

[0228] 1) Discard the culture medium from the cell culture dish and wash twice with PBS;

[0229] 2) Digest with an appropriate amount of pancreatic enzyme for a few minutes (do not over-digest) to cause the cells to detach;

[0230] 3) Add an equal volume of PBS to neutralize the trypsin, mix well by pipetting, and transfer to a centrifuge tube (EP tube). Centrifuge at 4°C, 3000 rpm for 2-3 minutes to collect the cells.

[0231] 4) After centrifugation, discard the supernatant and wash twice with PBS at 4°C, 3000 rpm, for 2-3 minutes.

[0232] 5) After thoroughly removing the supernatant, resuspend the cell clusters in buffer A: 100 μL / 6cm culture dish; 200 μL / 10cm culture dish. Before use, add a protease inhibitor cocktail to buffer A (the cocktail is a mixture containing various protease inhibitors).

[0233] 6) After mixing, incubate on ice for 15 minutes;

[0234] 7) Add 25 μL of 2.5% NP-40 (diluted to 2.5% with buffer A) to every 200 μL of system;

[0235] 8) After thoroughly dispersing NP-40 using the centrifuge tube (EP tube), centrifuge at 4°C, 500g for 5 minutes to prevent NP-40 from undergoing excessive fission and nuclear membrane breakdown;

[0236] 9) The supernatant is the cytoplasmic extract (containing cytoplasmic proteins and cytoplasmic RNA, etc.). The cytoplasmic extract can be directly used for routine protein analysis such as Western blot. The precipitate is the nuclear component.

[0237] 10) Repeated freeze-thaw cycles and sonication: Take an appropriate amount of the cytoplasmic extract from step 9), freeze and thaw the obtained supernatant repeatedly in a refrigerator, and then sonicate it repeatedly with an ultrasonic disruptor (Sonics, USA or Ningbo Xinzhi Biotechnology Co., Ltd.) to destroy the organelles in the cytoplasm and fully release the cytoplasmic proteins. Then centrifuge at 4°C and 12,000 rpm for 10-15 minutes. The final supernatant is the cytoplasmic protein.

[0238] 11) Ultrafiltration and concentration: Take 5-10 mL of the above cytoplasmic protein and filter it using a 0.45 μm sterile syringe filter from Pall (USA). The supernatant is then concentrated by ultrafiltration using a 3k ultrafiltration tube from Millipore (USA). Centrifuge at 4°C, 12,000 rpm for 10-20 minutes to obtain cytoplasmic protein with a final volume of 0.5-1 mL.

[0239] 8. Rapid protein liquid chromatography (FPLC) analysis; detailed procedures can be found in the documentation provided by GE Healthcare. Pure chromatography system instruction manual.

[0240] 9. Immunoprecipitation:

[0241] Collect FPLC eluates. Taking eluates 30, 32, 34, and 36 as examples, combine the four eluates and add 2 μg of α-tubulin, β-tubulin, β-actin, GAPDH, IgG heavy chain, IgG light chain antibodies, and 10-40 μL of protein A / G magnetic beads. Incubate at 4°C with gentle shaking for 2 hours. Collect the supernatant by adsorbing the magnetic beads using a magnetic rack. Repeat the above steps three times to remove the corresponding backbone proteins and internal control proteins as much as possible through immunoprecipitation. Divide the obtained supernatant protein into equal volumes for later use.

[0242] 10. Biotin Pull-down Experiment

[0243] Take 40 μL of Dynabeads M-280 avidin magnetic beads (Invitrogen), wash twice with 600 μL of solution A (0.1M NaOH, 0.05M NaCl), and wash once with 600 μL of solution B (0.1M NaOH); add 30 μL of 1×TENT buffer (2×TENT buffer: 20 mM pH 8.0 Tris-HCl, 2 mM pH 8.0 EDTA, 500 mM NaCl, 1% v / v Triton X-100), and place on ice until needed;

[0244] Prepare the reaction working solution according to the following system:

[0245]

[0246] After suspending at room temperature for 30 minutes, add 40 μL of pre-washed magnetic beads and continue to suspend at room temperature for another 30 minutes; wash five times with pre-cooled PBS, add 40 μL of 1× silver staining protein loading buffer, incubate at 70°C for 10 minutes, and analyze the product by silver staining.

[0247] 11. Silver Dye

[0248] 1) Load the proteins obtained after biotin pull-down onto a precast gel and run electrophoresis with a dedicated 1.5μL Sharp Marker;

[0249] 2) The voltage during electrophoresis is 80V;

[0250] 3) Wash the glue with three-stage distilled water for 5 minutes, twice;

[0251] 4) Fix the gel with 30% anhydrous ethanol: 10% acetic acid: 60% triple-distilled water for 15 minutes, changing the fixative once in between;

[0252] 5) Wash the glue with 10% ethanol for 5 minutes each time, twice; then wash with triple-distilled water for 5 minutes each time, twice.

[0253] 6) Prepare the Sensitizer working solution (50 μL of Sensitizer in 25 mL of water) and strictly sensitize for 1 minute;

[0254] 7) Wash with water for 1 minute twice;

[0255] 8) Prepare the working stain solution (0.5 mL Enhancer in 25 mL stain), and stain the gel for 30 minutes;

[0256] 9) Prepare the Developer working solution (0.5 mL Enhancer in 25 mL Developer), wash for 20 seconds twice (with triple-distilled water), then sensitize for 2-3 minutes until bands appear;

[0257] 10) Stop the reaction in 5% acetic acid for about 10 minutes;

[0258] 11) Replace with triple-distilled water, take photos, cut the gel, and send it to mass spectrometer.

[0259] 12. Mass spectrometry identification results were compared with RNA-binding protein databases:

[0260] Based on existing literature and databases, the existing RNA-binding proteins were compiled and entered into an Excel document. The results of each mass spectrometry identification were analyzed and compared using Python. The results of three independent replicate experiments were clustered and the intersection was obtained using the online tool https: / / bioinfogp.cnb.csic.es / tools / venny / index.htmL to obtain the corresponding RNA-binding proteins.

[0261] 13. Western blot: Refer to the standard Western blot experimental method.

[0262] Example 1. Pretreatment for isolating RNA-binding proteins from HeLa cells:

[0263] Experimental Example 1-2:

[0264] A certain amount of HeLa cells were collected, and nuclear-cytoplasmic separation was performed to obtain a cytoplasmic extract. The cytoplasmic extract was repeatedly freeze-thawed and sonicated to fully release the cytoplasmic proteins. The cytoplasmic proteins were concentrated by ultrafiltration, and the concentrated proteins were separated using a rapid protein liquid chromatography (FPLC) system. Then, a suitable fraction was selected, and cytoskeletal proteins such as actin, GAPDH, and tubulin were removed from the fraction using immunoprecipitation to obtain a pretreated sample.

[0265] The completion of each step in Experiment Examples 1-2 was verified. Specifically, after the separation of HeLa cell nuclei and cytoplasm, the effectiveness of the separation was verified by Western blotting. Figure 2 As can be seen, no detectable amount of Lamin A / C was found in the cytoplasmic extract, indicating that the isolated cytoplasmic proteins are of good purity and there is no obvious nuclear protein contamination, making them suitable for subsequent experiments.

[0266] After repeated freeze-thaw cycles, ultrasonic disruption, ultrafiltration concentration, and FPLC processing, the cytoplasm obtained after nuclear-cytoplasmic separation was collected in chronological order. Each fraction was then separated by SDS-PAGE gel electrophoresis, and the distribution of proteins of different molecular weights in each fraction was observed and analyzed by silver staining. Figure 3 ). Figure 3 In the diagram, (A) refers to samples 15-41 (odd numbers) in the FPLC fraction; (B) refers to samples 16-42 (even numbers) in the FPLC fraction; and (C) refers to samples 39-51 in the FPLC fraction. The filtration peaks of cytoplasmic proteins after passing through the FPLC system are shown in... Figure 4 .

[0267] Suitable fractions obtained by FPLC filtration were collected, and antibodies against different backbone proteins were added. After three rounds of immunoprecipitation, the removal efficiency of backbone proteins in different fractions was detected by Western blot. Figure 5 It can be seen that antibodies against different cytoskeletal proteins effectively removed the cytoskeletal proteins from the fraction, thereby avoiding non-specific binding in subsequent experiments. Figure 5 In the above, (A) refers to the mixed sample of groups 31+33+35+37 in the FPLC fraction; (B) refers to the mixed sample of groups 30+32+34+36+38 in the FPLC fraction.

[0268] Comparative Examples 1-4:

[0269] As a comparison with Experimental Examples 1 and 2, in Comparative Example 1, HeLa whole-cell extract was prepared as a pretreated sample. That is, this pretreated sample did not undergo nuclear-plasma separation, repeated freeze-thaw cycles, ultrasonic disruption, ultrafiltration concentration, FPLC, or immunoprecipitation.

[0270] In Comparative Example 2, HeLa cytoplasmic extract was prepared as a pretreated sample. That is, this pretreated sample only underwent a nucleoplasmic separation step, but did not undergo repeated freeze-thaw cycles, ultrasonic disruption, ultrafiltration concentration, FPLC, or immunoprecipitation.

[0271] In Comparative Example 3, HeLa cytoplasmic extracts that underwent ultrafiltration concentration, FPLC filtration, and immunoprecipitation were prepared as pretreated samples. Specifically, these pretreated samples were not subjected to repeated freeze-thaw cycles and ultrasonic disruption, but only to ultrafiltration concentration and FPLC filtration. Subsequently, the pretreated samples were obtained by removing cytoskeletal proteins through three rounds of immunoprecipitation on the FPLC fractions from groups 30+32+34+36+38.

[0272] In Comparative Example 4, a HeLa cytoplasmic extract that underwent repeated freeze-thaw cycles, ultrafiltration concentration, FPLC filtration, and immunoprecipitation was prepared as a pretreated sample. Specifically, this pretreated sample was not subjected to ultrasonic disruption, but only underwent repeated freeze-thaw cycles, ultrafiltration concentration, and FPLC filtration. Subsequently, the pretreated sample was obtained by removing cytoskeletal proteins through three rounds of immunoprecipitation on the FPLC fractions from groups 30+32+34+36+38.

[0273] Example 2. Isolation and capture of RNA-binding proteins:

[0274] Furthermore, biotin pull-down experiments and silver staining were performed on samples obtained by different treatment methods for the binding proteins of the p21 coding region (CR) and 3'UTR.

[0275] Biotin was used to label the target RNA, and the biotin-labeled target RNA was immobilized on streptavidin-conjugated magnetic beads. The prepared p21 mRNA-related probes are as follows: Figure 6 As shown. Among them, Figure 6 (A) shows a schematic diagram of the structure of p21 mRNA; (B) shows an agarose gel electrophoresis image of the PCR amplification product of the coding region (CR) of p21; (C) shows an agarose gel electrophoresis image of the PCR amplification product of the 3'UTR of p21.

[0276] The magnetic beads (Dynabeads) immobilized with p21 mRNA were co-incubated with the pretreated samples obtained by the methods in Examples 1-2 and Comparative Examples 1-4. After incubation for a certain period, the samples were washed multiple times to remove proteins that were not bound to the target RNA. Proteins specifically bound to the magnetic beads were collected and subjected to silver staining and gel electrophoresis. Using the p21 CR and proteins enriched only by the magnetic beads as references, non-specifically bound proteins were removed, and the 3' UTR-specific bands were excised for subsequent mass spectrometry sequencing.

[0277] result:

[0278] The results of silver staining of the pretreated samples obtained from Comparative Examples 1-2 are shown in [reference]. Figure 7 (A) and (B); the results of silver staining of the pretreated samples obtained from Experimental Examples 1-2 are shown in (A) and (B). Figure 7 (C) and (D); see the results of silver staining of the pretreated samples obtained from Comparative Examples 3-4. Figure 8 (A) and (B).

[0279] A comparison of the silver staining results of Comparative Examples 1-2 and Experimental Examples 1-2 shows that when using whole-cell extracts without nuclear-cytoplasmic separation, or cytoplasmic extracts that have only been separated but without repeated freeze-thaw cycles, ultrasonic disruption, ultrafiltration concentration, FPLC, and immunoprecipitation, a very large amount of non-specific proteins are generated in the system, resulting in very low capture and screening efficiency. However, after treating HeLa cells with the pretreatment steps described in this disclosure, the non-specific binding of nuclear proteins to RNA is effectively removed, thereby effectively reducing background noise caused by non-specific binding and improving screening efficiency.

[0280] The comparison of silver staining results between Comparative Examples 3-4 and Experimental Examples 1-2 shows that when the HeLa cytoplasmic lysate was not subjected to repeated freeze-thaw cycles and sonication, or was only subjected to freeze-thaw cycles but not sonication, the exposure of proteins within the organelles was insufficient, and the proteins enriched after incubation with the CR and 3'UTR of p21 were not ideal. Therefore, repeated freeze-thaw cycles and sonication of the cytoplasmic extract can effectively disrupt organelles in the cytoplasm, fully release cytoplasmic proteins, and thus improve screening efficiency.

[0281] Example 3. Mass spectrometry identification of RNA-binding proteins:

[0282] In Example 2, the silver staining results obtained in Experiment 1 were used to cut out the specific protein silver staining band captured by the p21 3'UTR probe, and then mass spectrometry was performed for identification. By comparing the mass spectrometry identification results with an RNA-binding protein database, the specific RNA-binding protein of p21 3'UTR captured according to the method of this disclosure was confirmed.

[0283] in, Figure 9 The captured specific protein is shown, with results from three independent replicate experiments. The protein highlighted in red is a previously reported p21 3'UTR-specific binding protein. Figure 9 (A), (B), and (C) in the figure represent the mass spectrometry results obtained from three independent experiments (groups 1 to 3), respectively; (D) represents the protein obtained after taking the intersection of the three experiments (the proteins marked in bold and underline are the specific binding proteins of p21 3'UTR reported in previous literature).

[0284] Then, the interaction between the identified RNA-binding proteins and target RNA was further verified using techniques such as immunoblotting or surface plasmon resonance. Specifically, RNA binding assays and immunoblotting were used to verify the interaction between the identified RNA-binding proteins and target RNA. Figure 9 The representative RNA-binding proteins ELAVL1 (also known as HuR) and HNRNPD obtained in (D) were validated. Figure 10 ).

[0285] The experimental results above show that by using the pretreatment method provided in this disclosure to pretreat cells and then separating RNA-binding proteins, the presence of non-specific proteins can be significantly reduced, background noise can be reduced, and the screening efficiency of specific RNA-binding proteins can be significantly improved.

[0286] Example 4. Enrichment of RNA-binding proteins for other target RNAs:

[0287] In addition to p21, the inventors used the coding region (CR) of p16 as a control and employed the 3'UTR as a probe to screen and enrich the corresponding specific RNA-binding proteins. Figure 11 ).in, Figure 11 (A) shows a silver staining image of the binding protein of the coding region (CR) and 3'UTR of p16 captured in the supernatant collected after FPLC filtration of purified HeLa cytoplasmic extract and collection of fractions 30+32+34+36+38, followed by three rounds of immunoprecipitation to remove skeletal proteins; (B) shows the p16 3'UTR-related RNA-binding protein identified by mass spectrometry analysis of the protein recovered by gel cutting of the silver-stained bands.

[0288] Based on the above results, it can be seen that the pretreatment and separation methods disclosed in this paper can also be used to identify previously reported RNA-binding proteins that bind to p16 3'UTR: AUF1, HuR, NSun2, etc. See Wang W., 2012, Regulatory RNA-binding proteins in senescence. Ageing Res Rev. 2012, 11(4):485-49.

[0289] Furthermore, the inventors also used the coding region (CR) and 3'UTR, 5'UTR of mouse apolipoprotein APOE mRNA as probes to screen and enrich the corresponding unknown specific RNA-binding proteins. Figure 12 ).in, Figure 12 (A) shows a silver staining image of the binding proteins of APOE mRNA at the CR, 3'UTR, and 5'UTR captured in the supernatant collected after FPLC filtration of purified Hepa1-6 cytoplasmic extract and collection of fractions 30+32+34+36+38, followed by three rounds of immunoprecipitation to remove skeletal proteins; (B) shows the APOE 3'UTR-related RNA-binding proteins identified by mass spectrometry analysis of the proteins recovered from the silver-stained bands, including some novel RNA-binding proteins such as GRSF1 and HnRNPF; (C) shows a graph validating representative RNA-binding proteins using RNA binding assays and immunoblotting experiments.

[0290] The experimental results above demonstrate that the pretreatment method provided in this disclosure significantly improves protein screening efficiency and significantly reduces the presence of nonspecific proteins in the enrichment process of RNA-binding proteins for various target RNAs. Furthermore, the results confirm that the pretreatment and separation methods provided herein can be used not only to screen for RNA-binding proteins that bind to specific RNAs, but also to screen and identify novel RNA-binding proteins.

[0291] Example 5. Further improvements to the test conditions:

[0292] The inventors further tested the conditions of step "10) Repeated freeze-thaw cycles and sonication" in "7. Cytoplasmic and nuclear protein extraction" under "(I) Instruments, Materials and Actual Preparation". Table 1 below provides the specific parameters for each test case:

[0293] Table 1. Specific parameters for each test case

[0294]

[0295] As can be seen from the separation results scores under various conditions shown in Table 1, when the cytoplasmic extract is repeatedly frozen and thawed at -80℃ 3-4 times, then sonicated for 4-6 minutes with an ultrasonic disruptor (with intervals of 3-8 seconds and sonication duration), and then centrifuged at 4℃, 12,000 rpm for 10-15 minutes, the final silver staining results show the best separation effect, in which there is a good balance between the level of background noise reduction and the types of proteins captured.

[0296] The foregoing content of this disclosure may cover a number of different examples with independent utility. Although each of these examples has been disclosed in one or more preferred forms, the specific embodiments disclosed and described herein should not be considered limiting, as many variations are possible. To a certain extent, the section headings used in this disclosure are for organizational purposes only. The subject matter of this disclosure includes all new and non-obvious combinations and sub-combinations of the various elements, features, functions, and / or characteristics disclosed herein. The following claims specifically point to certain combinations and sub-combinations considered new and non-obvious. Other combinations and sub-combinations of features, functions, elements, and / or characteristics may be claimed in applications claiming priority to this or related applications. Such claims, whether broader, narrower, equivalent, or different in scope from the original claims, are considered to be included within the subject matter of this disclosure. sequence list <110> Beijing University <120> Pretreatment and isolation methods for RNA-binding proteins <130> 21SG1F5316 <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 32 <212> DNA <213> Artificial sequence <220> <223> T7 starter <400> 1 ccaagcttct aatacgactc actataggga ga 32 <210> 2 <211> 18 <212> DNA <213> Artificial sequence <220> <223> p21 CR forward primer <400> 2 atgtcagaac cggctggg 18 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> p21 CR reverse primer <400> 3 ttagggcttc ctcttggaga aga 23 <210> 4 <211> 15 <212> DNA <213> Artificial sequence <220> <223> p21 3'UTR forward primer <400> 4 tccgcccaca ggaag 15 <210> 5 <211> 28 <212> DNA <213> Artificial sequence <220> <223> p21 3' UTR reverse primer <400> 5 aagtaaagtc actaagaatc atttattg 28

Claims

1. A method of pre-treating an RNA-binding protein, characterized in that, The method includes: Obtain cytoplasmic extracts without cell nuclei; The obtained cytoplasmic extract was subjected to ultrasonic disruption and repeated freeze-thaw cycles: the obtained cytoplasmic extract was repeatedly frozen and thawed at -80℃ 3-4 times, and then the cytoplasmic extract was ultrasonically disrupted for 4-6 minutes at intervals of 3-8 seconds and an ultrasonic duration of 3-8 seconds. The resulting mixture was centrifuged at 12,000 rpm for 10-15 minutes at 4°C to obtain a supernatant, which was then filtered. The filtered supernatant was concentrated by ultrafiltration at 12,000 rpm for 10-20 minutes at 4°C to obtain a concentrated solution. The obtained concentrate was subjected to rapid protein liquid chromatography, and fractions containing RNA-binding proteins were collected: multiple fractions after rapid protein liquid chromatography were collected in chronological order; SDS-PAGE gel electrophoresis was performed on the multiple fractions, followed by silver staining to obtain a distribution map of proteins of different molecular weights in the multiple fractions; based on the distribution map, one or more fractions containing the target RNA-binding protein were identified, and the one or more fractions were merged to obtain a fraction blend containing the target RNA-binding protein, wherein fractions with an overall molecular weight below 200 KD were selected for merging; α-Tubulin, β-Tubulin, β-actin, GAPDH, IgG heavy chain and IgG light chain antibodies were used to remove α-tubulin, β-tubulin, β-actin, GAPDH and IgG from the fractional blend containing the target RNA binding protein.

2. The method of claim 1, wherein, The steps for obtaining the cytoplasmic extract without the cell nucleus include: Collect cells; The cells were digested with trypsin, then centrifuged and the supernatant was discarded. Add HEPES buffer containing protease inhibitors, incubate on ice, and then add NP-40; Centrifuge and retain the supernatant to obtain the cytoplasmic extract.

3. A method for isolating RNA-binding proteins, comprising the pretreatment step of any one of claims 1-2.

4. The method of claim 3, wherein, The method further includes: Biotin-labeled target RNA molecules were immobilized on streptavidin-conjugated magnetic beads; The magnetic beads immobilized with the target RNA molecule were co-incubated with the supernatant collected after removing α-tubulin, β-tubulin, β-actin, GAPDH and IgG from the fractional blend containing the target RNA binding protein. Washing is performed to remove proteins that are not bound to the target RNA molecule; The proteins that specifically bind to the target RNA molecule on the magnetic beads are collected, thereby achieving the separation of the target RNA binding protein. The target RNA molecule is selected from at least one of p21, p16, the coding region of apolipoprotein APOE mRNA, 3' UTR, and 5' UTR.

Citation Information

Patent Citations

  • Kit for simply and conveniently detecting RNA and protein interaction and usage method thereof

    CN106093436A

  • Sample pretreatment method of secretory proteins in culture medium with serum

    CN106324249A

  • Detection of protein-RNA interaction

    JP2019017281A

  • Trap-tagging: a novel method for the identification and purification of rna-protein complexes

    US20060105341A1

  • Method of capturing and identifying novel rnas

    WO2016059187A1