A microfluidic chip for detecting circulating tumor cells and a preparation method and application thereof

By setting up multi-target nucleic acid aptamers and nanopillar structures on a microfluidic chip, the problem of insufficient sensitivity in the detection of circulating tumor cells in nasopharyngeal carcinoma in existing technologies has been solved, achieving efficient and specific cell capture and separation, and improving the accuracy and efficiency of detection.

CN116064225BActive Publication Date: 2026-08-04SHENZHEN LUOHU PEOPLELS HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHENZHEN LUOHU PEOPLELS HOSPITAL
Filing Date
2022-07-28
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Existing microfluidic chips cannot detect circulating tumor cells in nasopharyngeal carcinoma with high sensitivity, resulting in low sensitivity and specificity of the detection results, which affects the diagnosis and treatment decisions for nasopharyngeal carcinoma.

Method used

A microfluidic chip was designed by setting multiple biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 on a chip substrate and combining them with a hexagonal prism nanopillar array structure to establish a highly sensitive and specific multi-target nanofluidic chip, thereby achieving efficient capture and separation of nasopharyngeal carcinoma circulating tumor cells.

Benefits of technology

It achieves highly sensitive capture and separation of circulating tumor cells in nasopharyngeal carcinoma, significantly improving the accuracy and efficiency of detection. The detection results are superior to those of commercially available products and meet the needs of clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064225B_ABST
    Figure CN116064225B_ABST
Patent Text Reader

Abstract

The application discloses a micro-fluidic chip for detecting nasopharyngeal carcinoma circulating tumor cells, characterized in that the micro-fluidic chip comprises a chip base plate and a chip cover plate which are stacked from bottom to top, at least one micro-fluidic channel is arranged on the chip base plate, and biotin-modified nucleic acid adaptors EPCAM, Vimentin, EGFR and CD44 are connected to the micro-fluidic channel. The application connects multiple biotin-modified nucleic acid adaptors EPCAM, Vimentin, EGFR and CD44 to the micro-fluidic chip by optimizing the capture conditions, establishes a multi-target nanomicro-fluidic chip with high sensitivity and specificity, and realizes high-sensitivity capture and separation and enrichment of nasopharyngeal carcinoma circulating tumor cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cell detection technology, and in particular to a microfluidic chip and a method for detecting circulating tumor cells based on the microfluidic chip. Background Technology

[0002] Circulating tumor cells (CTCs) are tumor cells that detach from the primary tumor site and enter the bloodstream. CTCs can evade the body's immune system and reside in primary or distant organs, thus leading to recurrence and metastasis. Research on circulating tumor cells in nasopharyngeal carcinoma primarily focuses on retrospective clinicopathological analyses. Nasopharyngeal carcinoma CTC research is mainly based on Cellsearch. ® The detection platform reports a clinical sample CTC detection rate of 52.6%–92.0%. CTCs decrease significantly after radiotherapy or surgery, but some studies show a possible correlation between disease stage and CTC count, but not a significant correlation with CTC detection rate. To improve the application value of CTCs, studies combining them with other biomarkers such as EBV DNA, VCA, MMP-9, and COX2 for the diagnosis and prognostic assessment of nasopharyngeal carcinoma have yielded conflicting results. The reason for this is that CTC detection methods in clinical practice are not standardized. Only 70% of tumor cells from different tissue origins express EpCAM, relying on density gradient centrifugation, membrane filtration, and immunoaffinity separation of epithelial-derived EpCAM to count CTCs. These methods suffer from low separation efficiency and purity and cannot overcome CTC heterogeneity, leading to false positives, missed detections, or CTC rupture. This results in low sensitivity and specificity in clinical applications and poor diagnostic and prognostic correlation, seriously affecting medical decisions regarding the diagnosis and treatment of nasopharyngeal carcinoma.

[0003] Therefore, existing technologies still need to be improved and developed. Summary of the Invention

[0004] In view of the shortcomings of the prior art, the purpose of this invention is to provide a microfluidic chip and a method for detecting circulating tumor cells based on the microfluidic chip, aiming to solve the problem that existing microfluidic chips cannot detect nasopharyngeal carcinoma circulating tumor cells in blood samples with high sensitivity.

[0005] The technical solution of the present invention is as follows: A microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma, wherein the microfluidic chip includes a chip substrate and a chip cover plate stacked from bottom to top, the chip substrate is provided with at least one microfluidic channel, and biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 are connected to the microfluidic channel.

[0006] The microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma includes the following: the nucleotide sequence of the nucleic acid aptamer EPCAM is SEQ ID No. 1; the nucleotide sequence of the nucleic acid aptamer Vimentin is SEQ ID No. 2; the nucleotide sequence of the nucleic acid aptamer EGFR is SEQ ID No. 3; and the nucleotide sequence of the nucleic acid aptamer CD44 is SEQ ID No. 4.

[0007] The microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma includes a hexagonal prism nanopillar array structure disposed on the microfluidic channel.

[0008] The microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma, wherein the microfluidic channel is modified with streptavidin.

[0009] The microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma has five microfluidic channels on its substrate.

[0010] A method for fabricating a microfluidic chip, comprising the steps of: A chip substrate is provided, wherein at least one microfluidic channel is disposed on the chip substrate; The microfluidic channel is etched to form a hexagonal prism nanopillar array structure within the microfluidic channel; After connecting biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 to the microfluidic channel, a chip cover plate is then placed on the chip substrate to obtain the microfluidic chip.

[0011] An application of a microfluidic chip, wherein the microfluidic chip is used to detect circulating tumor cells in nasopharyngeal carcinoma.

[0012] Beneficial effects: The microfluidic chip provided by this invention establishes a highly sensitive and specific multi-target nano-microfluidic chip by connecting multiple biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44, thereby achieving highly sensitive capture, separation and enrichment of nasopharyngeal carcinoma circulating tumor cells. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of a microfluidic chip structure according to the present invention.

[0014] Figure 2 This is a schematic diagram illustrating the fabrication method of a microfluidic chip according to the present invention.

[0015] Figure 3 This diagram shows the flow cytometry results of the aptamer unit recognizing tumor cells according to the present invention.

[0016] Figure 4 The figure shows the results of the capture efficiency evaluation of the microfluidic chip substrate combined with the aptamer in this invention.

[0017] Figure 5 This is a diagram showing the optimized loading flow rate of the microfluidic system of this invention.

[0018] Figure 6 Fluorescence field images of circulating tumor cells from nasopharyngeal carcinoma patients are presented in this invention.

[0019] Figure 7 Images are shown in bright field and fluorescence field after sample sorting.

[0020] Figure 8 This is a comparison chart of the sorting efficiency of microfluidic chip systems and commercially available products. Detailed Implementation

[0021] This invention provides a microfluidic chip and a method for detecting circulating tumor cells based on the microfluidic chip. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0022] Numerous studies have confirmed that circulating tumor cells (CTCs) involved in hematogenous spread can undergo epithelial-mesenchymal transition (EMT). In transformed CTCs, the expression of epithelial markers (such as EpCAM) is downregulated, while the expression of mesenchymal markers (Vimentin, N-cadherin) is upregulated. Therefore, at least two subtypes of CTCs exist in the blood. Studies have shown that the degree of EMT in CTCs is positively correlated with their tumor metastatic potential and negatively correlated with prognosis; CTCs with mesenchymal characteristics may have stronger invasiveness and metastatic potential. Relying solely on physical separation and immune capture techniques using single epithelial markers suffers from low recognition efficiency, difficulty in modification, and challenges in non-destructive release, severely limiting the clinical application of CTC detection, the development of clinical detection methods for EMT-transformed CTCs, and research on the role of EMT-transformed CTCs in tumor metastasis mechanisms. The inability to efficiently, sensitively, and specifically detect different CTC subpopulations with metastatic and tumorigenic activity may lead to diagnostic and treatment biases. Therefore, capture techniques based on high specificity and sensitivity urgently need to be developed.

[0023] Based on this, the present invention provides a microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma, wherein the microfluidic chip includes a chip substrate 10 and a chip cover plate 20 stacked from bottom to top, the chip substrate 10 is provided with at least one microfluidic channel 11, and biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 are connected to the microfluidic channel 11.

[0024] In this invention, the nucleotide sequence of the nucleic acid aptamer EPCAM is SEQ ID No. 1, specifically: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGT TGGCCTG, whose 3' end is connected to the Biotin-C6 spacer; The nucleotide sequence of the nucleic acid aptamer Vimentin is SEQ ID No.2, specifically: CACGCATAGCCTTTGCTCCTCGTCTGGAACGTCGCAGCTTTAGTTCTGGGCCTATGCGTG, with its 5' end linked to Biotin-C6spacer. The nucleotide sequence of the nucleic acid aptamer EGFR is SEQ ID No.3, specifically: TACCAGTGCGATGCTCAGTGCCGTTTCTTCTCTTTCGCTTTTTTTGCTTTTGAGCATGCTGACGCATTCGGTTGAC, with its 5' end linked to the biotin-C6 spacer. The nucleotide sequence of the nucleic acid aptamer CD44 is SEQ ID No. 4, specifically: GGGATGGATCCAAGCTTACTGGCATCTGGATTTGCGCGTGCCAGAATAAAGAGTATAACGTGTGAATGGGAAGCTTCGATAGGAATTCGG, with its 5' end linked to the biotin-C6 spacer.

[0025] This invention optimizes the capture conditions for multiple targets and connects multiple biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 on a microfluidic chip to establish a highly sensitive and specific multi-target nano-microfluidic chip, thereby achieving highly sensitive capture and separation of nasopharyngeal carcinoma circulating tumor cells.

[0026] Specifically, such as Figure 2 As shown, the present invention also provides a method for fabricating a microfluidic chip, which includes the following steps: A chip substrate is provided, wherein at least one microfluidic channel is disposed on the chip substrate; The microfluidic channel is etched to form a hexagonal prism nanopillar array structure within the microfluidic channel; Streptavidin was added to PBS solution to prepare a 1 mg / mL stock solution. Before use, it was diluted with PBS to 10 μg / mL. 100 μL was transferred and added to the microfluidic channel. After incubation for 1 h, it was washed with PBS and then dried to obtain the activated microfluidic channel. After connecting biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 to the activated microfluidic channel, a chip cover plate is then placed on the chip substrate to obtain the microfluidic chip.

[0027] The present invention will be further explained and illustrated below through specific embodiments: Example 1 Validation of aptamer recognition of tumor cells To improve the capture efficiency of microfluidic systems, a combination of multiple target aptamers was selected. Using 5... The ability of FAM-modified aptamers EPCAM, Vimentin, EGFR, and CD44 to recognize SUNE1 (nasopharyngeal carcinoma cells) and PBMCs (peripheral blood mononuclear cells) from healthy volunteers was validated. (See attached text.) Figure 2 , 3 SUNE1 showed a fluorescence signal of 10 without the addition of a biometric unit. 2 When FAM-EPCAM, FAM-Vimentin, FAM-EGFR, and FAM-CD44 were added respectively, the fluorescence intensity increased in the following proportions: FAM-EPCAM ≥ FAM-EGFR > FAM-Vimentin > FAM-CD44. The mixture of these four biorecognition units significantly improved the selective capture ability of the aptamer combination for SUNE1. Flow cytometry results for healthy volunteer PBMCs with and without the four biorecognition units are shown below. Figure 3 As shown, from Figure 3 It can be seen that although the fluorescence intensity of PBMCs in healthy volunteers was enhanced, it was still less than that in the blank group of tumor cells, indicating that the aptamer biological unit can recognize and capture tumor cells.

[0028] Example 2 The capture efficiency of aptamers combined with micro / nano-structured microfluidic chip substrates Four experimental groups were designed using EPCAM(+) cells MCF-7 and A549, and EPCAM(-) cells HeLa and Jurkat: Flat w / o Biotin (A), Flat w / Biotin (B), Structure w / o Biotin (C), and Structure w / Biotin (D). The modifications of EPCAM aptamers were compared and analyzed. The results are as follows: Figure 4As shown in the diagram: A: Cells MCF-7, A549, HeLa, and Jurkat, before aptamer capture, were added to ordinary glass slides and allowed to stand for 1 hour. After washing three times with PBS, the adsorbed cells were counted under a microscope. The adsorption rate of different cell types without aptamer capture ranged from 6.33% to 10.87%. B: Cells captured by biomodified aptamers were added to ordinary glass slides modified with streptavidin. After standing, washing, and microscopic examination, the capture rate did not change significantly compared to group A. C: Unmodified cells added to the nanofluidic chip substrate showed a 4-fold increase in capture efficiency compared to ordinary glass slides, indicating that the nanofluidic substrate, with its unique hexagonal prism nanostructure, effectively intercepted tumor cells, while exhibiting low interception efficiency for leukocytes. D: After streptavidin modification, the nanofluidic chip substrate showed a further 2-fold increase in tumor cell capture efficiency compared to the unmodified structure, indicating that the combination of aptamers and nanostructures can significantly improve cell capture efficiency.

[0029] Example 3 Microfluidic condition optimization The flow rate of tumor cells through microfluidic channels affects cell capture efficiency. Determining the optimal flow rate helps improve the capture efficiency of rare cells. Using EPCAM as an example, this study investigated the tumor cell capture efficiency at flow rates of 0.2–2.0 mL / hr. The results are as follows: Figure 5 As shown, for EpCAM+ cells MCF-7 and A549, the cell capture efficiency initially increased and then decreased with increasing flow rate, indicating that the substrate responds to EpCAM+ cells. For EpCAM- cells HeLa and Jurkat, the cell capture efficiency did not change significantly with flow rate. Based on the capture targets used in this study—EPCAM, Vimentin, and EGFR—flow rate has a regulatory effect on improving the efficiency of multi-target biorecognition units in capturing tumor cells. The optimal flow rate was optimized to 0.5 mL / hr.

[0030] Example 4 Circulating tumor cell fluorescence immunoassay SUNE1 cells were mixed with Jurkat cells to prepare simulated samples and PBMCs from clinical patients. After sorting, immunofluorescence staining and microscopic examination were performed. Figure 6 and Figure 7 Under a bright-field microscope, the cells with relatively larger diameters can be preliminarily identified as SUNE1. Fluorescent antibody staining revealed that CD45 (555nm) expression in Jurkat cells was mainly on the cell membrane, while PCK (488nm) and Vimentin (647nm) expression in SUNE1 cells was present in both the cell membrane and cytoplasm.

[0031] Example 5 Clinical sample testing CTC detection was performed on 5 patients with nasopharyngeal carcinoma and 2 patients with skull base tumors collected clinically. All 5 patients were clinically stage III-IV, had lymph node metastasis, and had EBV DNA loads of 5.01. 10^2 ~ 8.08 10^4 copies. The number of CTCs detected in the 7 samples were 17, 44, 81, 89, 100, 20, and 40 per 4 mL, respectively, with a detection rate of 100%. Compared to the commercially available CTC100 platform, the number of CTCs in the same sample increased by 5 times, laying the foundation for further downstream CTC analysis, such as... Figure 8 As shown in the figure. A search of literature and the COSMIC catalog of somatic mutations in cancer revealed genetic mutations and frequencies in nasopharyngeal carcinoma, with the mutation frequencies being TP53 (42%), PIK3CA (10%), and EGFR (3%) in descending order. CTCs were selected from the seven samples mentioned above, and 3-5 CTCs were successfully selected from each sample for EGFR and PIK3CA mutation testing; all results were negative.

[0032] In summary, over 80% of nasopharyngeal carcinoma (NPC) patients exhibit upregulated EGFR expression, particularly in non-keratinizing NPC tissues where the expression rate exceeds 90%. High EGFR expression is associated with poor prognosis in NPC. NPC is a malignant tumor of the epithelial tissue of the nasopharynx, thus exhibiting EPCAM expression. EPCAM is one of the main immune-mediated CTC capture targets. NPC is a highly invasive and metastatic cancer, exhibiting EMT transformation. Mesenchymal markers such as Vimentin can reduce tissue adhesion, promote tumor cell shedding, and release into the bloodstream after invading the basal layer. To improve the capture efficiency of rare cell CTCs, this invention utilizes a multi-target aptamer recognition unit combined with a nanofluidic chip system. Flow cytometry analysis demonstrated multi-target recognition, and the dual effect of the nanofluidic structure and aptamers significantly improved capture efficiency by 6 times. The optimal flow rate was determined, and the recovery rate in simulated samples reached over 75%. The optimized microfluidic system was used to test 7 clinical samples, achieving a 100% CTC detection rate. The number of cells detected was 5 times that of commercially available products, further realizing single-cell collection and EGFR and PIK3CA mutation detection on CTCs.

[0033] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma, characterized in that, The microfluidic chip includes a chip substrate and a chip cover plate stacked from bottom to top. At least one microfluidic channel is provided on the chip substrate. Biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 are connected to the microfluidic channel. A hexagonal prism nanopillar array structure is provided on the microfluidic channel. The microfluidic channel is modified with streptavidin.

2. The microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer EPCAM is SEQ ID No. 1, the nucleotide sequence of the nucleic acid aptamer Vimentin is SEQ ID No. 2, the nucleotide sequence of the nucleic acid aptamer EGFR is SEQ ID No. 3, and the nucleotide sequence of the nucleic acid aptamer CD44 is SEQ ID No.

4.

3. The microfluidic chip for detecting circulating tumor cells in nasopharyngeal carcinoma according to claim 1, characterized in that, The chip substrate has five microfluidic channels.

4. A method for fabricating a microfluidic chip as described in claim 1, characterized in that, Including the following steps: A chip substrate is provided, wherein at least one microfluidic channel is disposed on the chip substrate; The microfluidic channel is etched to form a hexagonal prism nanopillar array structure within the microfluidic channel; After connecting biotin-modified nucleic acid aptamers EPCAM, Vimentin, EGFR and CD44 to the microfluidic channel, a chip cover plate is then placed on the chip substrate to obtain the microfluidic chip.