Application of JAK1 protein ubiquitination site in the preparation of interferon-resistant cells

CN116064461BActive Publication Date: 2026-08-11YANGZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-12
Publication Date
2026-08-11

AI Technical Summary

Benefits of technology

[0039]本发明发现IAV介导的JAK1的K859和860泛素化位点,又是其介导ISGs的功能性位点。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064461B_ABST
    Figure CN116064461B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of molecular virology and cell biology, and discloses the application of lysine (K) 859 and 860, ubiquitination sites of the tyrosine kinase protein JAK1, in the preparation of interferon-resistant cells. This invention discovered that the influenza virus (IAV) PB2 protein interacts with the JAK1 protein and degrades JAK1 via the ubiquitin-proteasome pathway. Finally, it was determined that K859 and 860 of the JAK1 protein are its ubiquitination sites. This invention mutates K at positions 859 and 860 of the JAK1 protein to arginine (R), thereby relieving the PB2-mediated ubiquitination degradation of JAK1 by the influenza virus and reducing the production of JAK1-mediated ISGs, thus inhibiting its antiviral activity. This site holds promise as a new target for developing interferon-resistant cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular virology and cell biology, and discloses the application of the K859 / K860 site of the JAK1 protein in the preparation of interferon-tolerant cells. Background Technology

[0002] The JAK / STAT signaling pathway is a crucial pathway mediating downstream signal transduction of various cytokines, including interferon (IFN), and plays a vital role in cytokine function. The Januskinase family of tyrosine kinases comprises four proteins: JAK1, JAK2, JAK3, and TYK2. Different cytokine functions depend on different combinations of JAK / STAT signaling pathways, ultimately mediating the transcription of downstream effector genes and exerting corresponding immunomodulatory effects, which are essential for the host's immune response. Ubiquitination plays a significant role in protein degradation. Studies have shown that JAK1 degradation depends on ubiquitin ligases and ubiquitination processes. For example, the ubiquitin ligase RNF125 can mediate the ubiquitination and degradation of JAK1. This ubiquitination and degradation of JAK1 can inhibit the transduction of downstream signaling pathways of IFNs and interleukins, thereby regulating the host cell's immune response. Pathogenic microorganisms can antagonize the host immune response mediated by promoting JAK1 degradation. Studies have shown that viruses such as human cytomegalovirus (HCMV), human metapneumovirus (HMPV), and Zika virus can inhibit the antiviral effect of IFN by promoting the degradation of JAK1 via the proteasome pathway. The specific mechanism of influenza virus (IAV) protein degradation of JAK1 and the key amino acid sites involved in JAK1 degradation remain unclear. Exploring the key functional sites of JAK1 through IAV PB2 protein degradation is of great significance for the effective development and preparation of interferon-resistant cells. Summary of the Invention

[0003] This invention discovered that the K-to-R mutation at positions 859 and 860 of the JAK1 protein reduces the production of JAK1-mediated ISGs, thereby inhibiting its mediated antiviral activity. Studies have shown that the influenza virus (IAV) PB2 protein degrades JAK1 through interaction with JAK1 in a ubiquitin-proteasome-dependent manner. Further evidence demonstrates that the K859 / K860 sites of JAK1 are key amino acid sites for IAV PB2 protein degradation. Therefore, by exploring the sites where viral proteins degrade JAK1, functional sites for JAK1-mediated ISGs can be screened.

[0004] The present invention specifically adopts the following technical solution:

[0005] Application of JAK1 protein ubiquitination site in the preparation of interferon-resistant cells, wherein the JAK1 protein ubiquitination site is located at positions 859 and 860 of the JAK1 protein, and the JAK1 amino acid sequence is shown in SEQ ID NO: 1.

[0006] Furthermore, the JAK1 nucleotide sequence is shown in SEQ ID NO: 2.

[0007] Furthermore, the JAK1 protein is derived from mammals.

[0008] Furthermore, after the K at positions 859 and 860 of the JAK1 protein is mutated to R, the ubiquitination site of JAK1 is eliminated, thereby relieving the ubiquitination regulation of JAK1.

[0009] Furthermore, the primer sequences used for site mutations are shown in SEQ ID NO:3 and SEQ ID NO:4.

[0010] Furthermore, the cells mentioned are HEK293T, MDCK, and A549 cells.

[0011] Furthermore, shRNA plasmids for lentiviral packaging were constructed. HEK293T cells were transfected with shRNA or shJAK1 and JAK1 plasmids for lentiviral packaging. The plasmids were then transfected, and the culture medium containing the virus was collected.

[0012] Furthermore, the shRNA target sequence of the JAK1 gene is as follows:

[0013] The shJAK-1# sequence is SEQ ID NO: 5;

[0014] The shJAK-2# sequence is SEQ ID NO: 6.

[0015] Furthermore, HEK293T cells were infected with the packaged shJAK1 lentivirus. After 48 hours, Puromycin was added for selection. After the cells showed no obvious signs of death, limiting dilution subcloning was performed. Cells from passage 3 were used as stable expression cell lines.

[0016] The present invention also provides primers for the ubiquitination site of the JAK1 protein, wherein the ubiquitination site of the JAK1 protein is located at positions 859 and 860 of the JAK1 protein, and the primer sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0017] Firstly, the 859R / 860R site of JAK1 plays a role in mediating antiviral activity.

[0018] The specific operation process is as follows:

[0019] (1) Construction of cell lines with JAK1 knockdown.

[0020] (2) The effect of JAK1 and its site-directed mutants on IFN-induced ISGs.

[0021] (3) Detect the effect of JAK1 and its site-directed mutants on IAV replication.

[0022] Secondly, the IAV PB2 protein binds to JAK1 and degrades JAK1 via the ubiquitin-proteasome pathway.

[0023] The specific identification process is as follows:

[0024] (1) The interaction between PB2 and JAK1 was demonstrated by co-IP and confocal experiments.

[0025] (2) Transfect cells with the PB2 gene recombinant vector or infect cells with the virus and detect the expression level of JAK1 protein.

[0026] (3) PB2 knockdown cell lines were constructed by knocking down PB2 expression at specific targets.

[0027] (4) The PB2 plasmid was reintroduced into the shPB2 cell line to identify the expression level of JAK1.

[0028] (5) Infect the shPB2 cell line with IAV to identify the expression level of JAK1.

[0029] (6) PB2 transfected cells, and after transfection, the proteasome inhibitor MG132 was added for treatment to identify the expression level of JAK1.

[0030] (7) The ubiquitination experiment demonstrated that PB2 promotes the ubiquitination modification of K48 linkage of JAK1.

[0031] Thirdly, the K859 / K860 site of JAK1 is a key amino acid site for the degradation of IAV PB2 protein.

[0032] The specific operation process is as follows:

[0033] (1) Construct a deletion mutant of JAK1 based on its functional structural domains.

[0034] (2) After co-transfecting cells with PB2 eukaryotic expression plasmid and JAK1 deletion mutant, the expression levels of JAK1 and its deletion mutant were detected.

[0035] (3) Predict JAK1 ubiquitination sites using online software and perform site-directed mutations on JAK1 sites.

[0036] (4) After co-transfecting JAK1 with JAK1 site mutants, the expression levels of JAK1 and its site mutants were detected.

[0037] (5) The ubiquitination experiment proved that PB2 ubiquitinates the key amino acid sites of JAK1.

[0038] Beneficial effects

[0039] This invention discovers that the K859 and 860 ubiquitination sites of JAK1 mediated by IAV are also the functional sites that mediate ISGs.

[0040] This invention helps to broaden new ideas for exploring sites where viral proteins degrade JAK1 and screening functional sites of JAK1-mediated ISGs. It also helps to utilize JAK1 functional sites as new targets for developing and preparing interferon-resistant cells. Attached Figure Description

[0041] Figure 1 Lysine 859 and 860 of the JAK1 protein are key amino acid sites that mediate the production of ISGs.

[0042] (A) Immunoblotting of HEK293T cells transfected with control shRNA (shGFP) or shRNA targeting JAK1 (shJAK1) and JAK1 plasmid. (B) Construction of a JAK1 mutant (ΔJAK1) with 7 nucleotide nonsense mutations off-target. (C) Immunoblotting of HEK293T cells stably knocked down by JAK1 transfected with JAK1-His, ΔJAK1-His, or ΔJAK1-K859 / 860R-His plasmids (top). The intensity of the immunoblot bands in the three independent experiments was quantified and normalized using Actin (bottom). (DF) qPCR analysis of IFIT1, ISG15, and TAP1 mRNAs was performed after transfecting shJAK1 HEK293T cells with ΔJAK1-WT or ΔJAK1-K859 / 860R plasmids and treating them with IFNβ. ns P>0.05, *P<0.05, **P<0.01.

[0043] Figure 2 Lysine 859 and 860 of the JAK1 protein are key amino acid sites that mediate its antiviral activity.

[0044] Viral titer after PR8 virus infection following transfection of shJAK1 HEK293T cells with ΔJAK1-WT or ΔJAK1-K859 / 860R plasmids. **P<0.01.

[0045] Figure 3IAV PB2 protein interacts with JAK1. (A) Co-IP and Ni-NTA pull-down analysis of PB2-JAK1 interaction. (B) Co-IP and Ni-NTA pull-down analysis of PB2-JAK1 interaction in IAV-infected HEK293T cells. (C) IAV PB2 (red) and JAK1 (green) co-localize in IAV-infected A549 cells. Cell nuclei are stained with DAPI (blue). Scale bar: 10 μm. Fluorescence intensity at specified locations is scanned using LASX software.

[0046] Figure 4 To inhibit JAK1 protein expression using IAV PB2 protein. (A) Immunoblotting of HEK293T cells transfected with IAV PB2 plasmid (top), with the intensity of immunoblotting bands from three independent experiments quantified and normalized using Actin (bottom). (B) Immunoblotting analysis of A549 cells infected with IAV (top), with the intensity of immunoblotting bands from three independent experiments quantified and normalized using Actin (bottom). (C) Immunoblotting of HEK293T cells transfected with control shRNA (shGFP) or shRNA targeting PB2 (shPB2) and 3xFlag-PB2-PR8 (top), with the intensity of immunoblotting bands from three independent experiments quantified and normalized using Actin (bottom). (D) The off-target PB2 mutant of shRNA (ΔPB2) was constructed from a nonsense mutant of the 5-nucleotide target sequence of the shPB2 plasmid. (E) Immunoblotting of stable PB2 knockdown HEK293T cells transfected with PB2 or ΔPB2 plasmids (top), with the intensity of the immunoblotting bands from three independent experiments quantified and normalized using Actin (bottom). (F) Immunoblotting of stable PB2 knockdown HEK293T cells transfected with PB2 plasmids (top), with the intensity of the immunoblotting bands from three independent experiments quantified and normalized using Actin (bottom). (G) Immunoblotting of stable PB2 knockdown HEK293T cells infected with PR8 virus (MOI = 0.1) (top), with the intensity of the immunoblotting bands from three independent experiments quantified and normalized using Actin (bottom). ns P>0.05, *P<0.05, **P<0.01.

[0047] Figure 5IAV PB2 protein specifically degrades JAK1 protein via the ubiquitin-proteasome pathway. (A) Immunoblot analysis of HEK293T cells transfected with PB2 plasmid and treated with DMSO and MG132. (B) Ni-NTA pull-down analysis of JAK1 ubiquitination in HEK293T cells transfected with JAK1-His, HA-ubiquitin (HA-Ub), and PB2 plasmids and treated with MG132. (C) Ni-NTA pull-down analysis of JAK1 ubiquitination in HEK293T cells transfected with PB2, HA-Ub and its mutants, and JAK1-His plasmids and treated with MG132. (D) Co-IP analysis of JAK1 ubiquitination in A549 cells infected with IAV (MOI = 0.01). (E) Co-IP analysis of JAK1 ubiquitination in shPB2 HEK293T cells infected with IAV (MOI = 0.01).

[0048] Figure 6 K859 and 860 of the JAK1 protein are key amino acid sites for the degradation of the IAV PB2 protein.

[0049] (A) Schematic diagram of JAK1 deletion mutants (top), and Western blot of HEK293T cells transfected with JAK1 or its deletion mutants and PB2 plasmid (bottom). (B) Online prediction of JAK1 ubiquitination modification using CPLM1.0. (C) Western blot of HEK293T cells transfected with JAK1 and its mutants and PB2 plasmid. (D) Analysis of Western blot band intensity (C). ns P>0.05, *P<0.05, **P<0.01. (E) Immunoblot of HEK293T cells transfected with JAK1 and its mutants and PB2 plasmid. (F) Molecular model of JAK1 kinase domain generated by PyMOL (PDB:4ehz). K859 / K860 sites are shown in pink. (G) Ni-NTA pull-down analysis of JAK1 ubiquitination in HEK293T cells transfected with JAK1 or its mutants, HA-Ub, and PB2 plasmids and treated with MG132. Detailed Implementation

[0050] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0051] Example 1: Construction of JAK1 knockdown cell lines

[0052] 1.1 Construction of shRNA plasmids for lentiviral packaging:

[0053] Based on the gene sequence (SEQ ID NO: 2), a specific shRNA sequence was designed.

[0054] The shJAK-1# sequence is: (SEQ ID NO: 5);

[0055] The shJAK-2# sequence is: (SEQ ID NO: 6);

[0056] After adding restriction enzyme sites and hairpin structures to these two sequences, synthesis was performed. The two synthesized complementary single-stranded sequences were dissolved in dd H2O to a concentration of 100 μM. After dissolution, 10 μL of each complementary sequence was mixed. A 20 μL reaction mixture was placed in a PCR instrument and heated at 95 °C for 5 min. Then, a gradient cooling process was implemented, decreasing the temperature by 1 °C per minute, gradually lowering from 95 °C to 20 °C, allowing the single-stranded sequences to pair complementaryly and form a double-stranded DNA sequence with sticky ends. This sequence was then ligated and inserted into a lentiviral vector after enzyme digestion for subsequent lentiviral packaging and infection experiments.

[0057] 1.2 shRNA screening and lentivirus packaging

[0058] First, HEK293T cells were transfected with control shRNA (shGFP) or shJAK1 and JAK1 plasmids. Western blotting showed that shJAK1 had a good interference effect. Figure 1 A). Next, lentivirus packaging was performed. When the HEK293T cell density reached 80%, the plasmid (shJAK1:psPAX:pMD2.G = 4:3:1) was transfected. Fresh culture medium was replaced 12 hours after transfection. After culturing for another 48 hours, the virus-containing culture medium was carefully collected, filtered through a 0.45 μm filter, and stored at -80°C for later use.

[0059] 1.3 Establishment of stable expression cell lines

[0060] Packaged shJAK1 lentivirus was used to infect HEK293T cells. After 48 hours, Puromycin was added for selection. Once no obvious cell death was observed, limiting dilution subcloning was performed. Cells from passage 3 onwards were used as stable expression cell lines.

[0061] Example 2: Construction of JAK1 mutant vector

[0062] 2.1 Construction of the plasmid for the JAK1 mutant (ΔJAK1) with a 7-nucleotide nonsense mutation

[0063] First, based on the sequences (SEQ ID NO: 1) and (SEQ ID NO: 5), primers (SEQ ID NO: 3) and (SEQ ID NO: 4) were designed, and site-directed mutagenesis was used to mutate the corresponding sites. Using the recombinant plasmid JAK-His as a template, the complete recombinant plasmid was amplified using polymerase. After column recovery of the PCR product, DpnI was added and the reaction was carried out at 37℃ for 1 hour. The enzyme digestion mixture was then inactivated in a PCR instrument at 80℃ for 5 minutes before transformation. The transformation system was plated on LB agar plates containing an appropriate amount of ampicillin and incubated overnight at 37℃. Single colonies were randomly selected for colony PCR verification. The correct colonies were sequenced and named ΔJAK1.

[0064] 2.2 Site-directed mutagenesis at JAK1 ubiquitination sites

[0065] First, primers (SEQ ID NO: 7) and (SEQ ID NO: 8) were designed based on the sequence (SEQ ID NO: 2). Site-directed mutagenesis was used to mutate the corresponding ubiquitination site (K) to R. The specific procedure is the same as in 2.1.

[0066] 2.3 Validation of JAK1 mutant expression

[0067] JAK1 and its site-directed mutant vector were transfected into the shJAK1 cell line, and JAK1 was reintroduced. Immunoblot analysis showed that the JAK1 site-directed mutant was successfully expressed, achieving the off-target effect of nonsense mutation. Figure 1 B, 1C).

[0068] Example 3: K859 and 860 of the JAK1 protein are key amino acid sites that mediate the production of ISGs.

[0069] To investigate the effects of JAK1 protein K859 and 860 on ISGs, JAK1WT and its site-directed mutant vectors were transfected into the shJAK1 cell line. After IFNβ treatment, ISG levels were detected by RT-qPCR. Compared with JAK1WT, the JAK1-K859 / 960R mutation significantly reduced the levels of IFNβ-induced IFIT1, ISG15, and TAP1 mRNA. Figure 1 DF).

[0070] Example 4: K859 and 860 of the JAK1 protein mediate its antiviral activity

[0071] JAK1 and its site-directed mutant vector were transfected into the shJAK1 cell line to restore JAK1 expression. IAV replication was detected [the A / PuertoRico / 8 / 34(PR8) strain was identified and preserved in our laboratory]. Compared with JAK1WT, the JAK1-K859 / 960R mutation showed weakened antiviral activity. Figure 2 The results showed that K859 and 860 of the JAK1 protein are key amino acid sites mediating its antiviral activity, and the JAK1-K859 / 860R mutation is beneficial to viral replication.

[0072] Example 5: Detection of the interaction between IAV PB2 protein and JAK1 protein

[0073] First, HEK293T cells were seeded into 6-well plates and transfected with JAK1-His and PB2 expression plasmids. Cells were collected 36 hours after transfection for pull-down or co-IP experiments. Figure 3 As shown in Figure A, JAK1 and PB2 proteins interact under transfection conditions. Next, HEK293T cells were seeded into 6-well plates, transfected with JAK1-His, infected with IAV, and collected 24 hours after infection for pull-down and co-IP experiments. Figure 3 As shown in Figure B, JAK1 and PB2 proteins interact under infection conditions. Furthermore, co-localization analysis of JAK1 and PB2 was performed by seeding A549 cells into confocal dishes, infecting them with IAV, and collecting the cells 12 hours later for confocal microscopy analysis. Figure 3 As shown in Figure C, JAK1 and PB2 proteins co-localize under viral infection. These results indicate that IAV PB2 protein interacts with JAK1 protein.

[0074] Example 6: PB2 protein inhibits JAK1 protein expression

[0075] 6.1 Construction of shRNA plasmids for lentiviral packaging:

[0076] Based on the PB2 gene (SEQ ID NO: 9) sequence, specific shRNA sequences for silencing the PB2 protein, shPB2-1# (SEQ ID NO: 10) and shPB2-2# (SEQ ID NO: 11), were designed.

[0077] The method is the same as 1.1

[0078] 6.2 Screening for silencing PB2 protein shRNA and lentiviral packaging

[0079] The method is the same as 1.2.

[0080] 6.3 Establishment of cell lines with stable PB2 protein expression silence

[0081] The method is the same as in 1.3.

[0082] 6.4 Construction of the PB2 mutant plasmid with 5 nucleotide nonsense mutations (ΔPB2)

[0083] First, primers (SEQ ID NO: 12 and SEQ ID NO: 13) were designed based on the sequences of the PB2 gene (SEQ ID NO: 9) and the PB2 gene silencing region (SEQ ID NO: 10). Site-directed mutagenesis was then used to mutate the corresponding sites. The method was the same as in section 2.1.

[0084] To investigate the effect of IAV PB2 on JAK1 expression, A549 cells were seeded into 12-well plates and transfected with the PB2 expression plasmid. Samples were collected after 36 hours for Western blotting analysis. Figure 4 As shown in Figure A, IAV PB2 inhibited the expression of endogenous JAK1 protein in a dose-dependent manner. To further investigate JAK1 expression under viral infection, A549 cells were seeded into 12-well plates, infected with IAV, and samples were collected at 0, 6, 12, and 24 hours post-infection for Western blotting analysis. Figure 4 As shown in Figure B, IAV infection suppresses the expression of endogenous JAK1 protein. Next, the shPB2 interference cell line was constructed ( Figure 4 C), and the PB2 plasmid with off-target effects ( Figure 4 D, 4E), in the shPB2 cell line, PB2 cells were reintroduced, and JAK1 expression was detected, such as Figure 4 As shown in Figure F, PB2 inhibits JAK1 expression. Finally, we infected the shPB2 interference cell line with IAV, and collected samples at 0, 9, 12, and 18 hours after infection for Western blotting analysis. Figure 4 As shown in Figure G, the degradation level of JAK1 in the shPB2 interference cell line was inhibited compared to the shGFP cell line. These results indicate that IAV PB2 protein can degrade JAK1 protein.

[0085] Example 7: Detection of IAV PB2 protein promoting JAK1 protein ubiquitination

[0086] To investigate the pathway of IAV PB2 degradation of JAK1, HEK293T cells were seeded into 12-well plates and transfected with IAV PB2 expression plasmids at varying concentrations. After 24 hours of transfection, cells were treated with DMSO or the proteasome inhibitor MG132 for 12 hours before Western blotting analysis. Figure 5As shown in Figure A, JAK1 degradation was inhibited by MG132, indicating that PB2 degrades JAK1 via the proteasome pathway. Further, HEK293T cells were seeded into 6-well plates and transfected with JAK1-His, HA-Ub, and PB2 expression plasmids at varying concentrations. After 24 hours of transfection, cells were treated with MG132 for 12 hours before pull-down experiments were performed. Figure 5 As shown in Figure B, IAV PB2 promotes JAK1 ubiquitination in a dose-dependent manner. Subsequently, to investigate the type of JAK1 ubiquitination, HEK293T cells were seeded into 6-well plates and transfected with JAK1-His, HA-Ub-K48, or HA-Ub-K63, as well as the IAV PB2 expression plasmid. After 24 hours of transfection, cells were treated with MG132 for 12 hours before pull-down experiments. Figure 5 As shown in Figure C, IAV PB2 promotes JAK1K48-linked ubiquitination. Then, a viral infection experiment was performed. A549 cells were seeded into 6-well plates, infected with IAV, and samples were collected at 0, 6, 9, and 12 hours post-infection for immunoprecipitation. Figure 5 As shown in Figure D, IAV infection promotes JAK1 ubiquitination. Finally, after IAV infection of shPB2 cells, an immunoprecipitation experiment was performed. This further demonstrated that IAV PB2 protein promotes the ubiquitination and degradation of JAK1. Figure 5 E).

[0087] Example 8: Detection of key amino acid sites in IAV PB2 protein that degrade JAK1

[0088] First, we constructed a JAK1 deletion mutant vector according to standard molecular biology procedures. Figure 6 A). Next, cells were co-transfected with the JAK1 deletion mutant vector and the PB2 eukaryotic expression vector. Samples were collected after 36 hours and analyzed by Western blotting. (See attached image.) Figure 6 As shown in Figure A, IAV PB2 protein degrades 560-1154 amino acids of JAK1. Subsequently, based on online prediction using CPLM1.0, a site-directed mutagenesis vector was constructed. Figure 6 B) Cells were co-transfected with the JAK1 site-directed mutagenesis vector and the PB2 eukaryotic expression vector. Samples were collected after 36 hours and analyzed by Western blotting. The JAK1-K859 / 960R mutation inhibited PB2 degradation, indicating that K859 and 860 of the JAK1 protein are key amino acid sites for IAV PB2 protein degradation. Figure 6 Finally, cells were co-transfected with the JAK1 site-directed mutagenesis vector and the PB2 eukaryotic expression vector. Samples were collected after 36 hours for pull-down experiments. K859 and 860 mutations in R inhibited ubiquitination levels ( Figure 6(FG). The above results indicate that K859 and 860 of the JAK1 protein are key amino acid sites for ubiquitination and degradation of the IAV PB2 protein.

[0089] Overall, this invention reveals a negative regulatory mechanism of PB2-JAK1, in which JAK1 kinase interacts with the IAVPB2 protein, and demonstrates that the ubiquitination sites of IAVPB2 protein that promote JAK1 development include K859 and 860. These sites are crucial for maintaining normal activation levels of the JAK1-mediated signaling pathway.

[0090] Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0091] SEQ ID NO: 1

[0092]

[0093] SEQ ID NO:2

[0094]

[0095] SEQ ID NO:3

[0096] TGACGAGAACACCAAACTTTGGTACGCCCCGAACCGGAC

[0097] SEQ ID NO:4

[0098] GTCCGGTTCGGGGCGTACCAAAGTTTGGTGTTCTCGTCA

[0099] SEQ ID NO:5

[0100] GCTCTGGTATGCTCCAAATCG

[0101] SEQ ID NO:6

[0102] GGTGGAAGTGATCTTCTATCT

[0103] SEQ ID NO:7

[0104] CAGATATTGTTTCAGAAAGAAGACCAGCAACTGAAGTGGA

[0105] SEQ ID NO:8

[0106] TCCACTTCAGTTGCTGGTCTTCTTTCTGAAACAATATCT

[0107] SEQ ID NO:9

[0108]

[0109] SEQ ID NO:10

[0110] GCTGTGACATGGTGGAATAGG

[0111] SEQ ID NO:11

[0112] GCTAAAGCATGGAACCTTTGG

[0113] SEQ ID NO:12

[0114] CCTCTGGCCGTGACGTGGTGGAACCGCAATGGACCAAT

[0115] SEQ ID NO:13

[0116] TTGGTCCATTGCGGTTCCACCACGTCACGGCCAGAGG

Claims

1. The application of mutating lysine residues at positions 859 and 860 of the JAK1 protein to arginine in the preparation of interferon-resistant cells, characterized in that, Includes the following steps: The mutation of lysines at positions 859 and 860 of the JAK1 protein to arginine eliminates the ubiquitination site of JAK1, thereby relieving the regulation of JAK1 ubiquitination degradation mediated by influenza virus PB2 protein, reducing the production of JAK1-mediated ISGs, and thus inhibiting its mediated antiviral activity; the amino acid sequence of the JAK1 protein is shown in SEQ ID NO:1; the cell is HEK293T.

2. The application according to claim 1, characterized in that, The JAK1 protein is derived from mammals.

3. The application according to claim 1, characterized in that, The nucleotide sequence of the JAK1 protein is shown in SEQ ID NO:

2.

4. The application according to claim 1, characterized in that, The primer sequences used for the mutation are shown in SEQ ID NO:3 and SEQ ID NO:4.

Citation Information

Patent Citations

  • Methods for treating hair loss disorders

    CN103370076A