Kit for detecting cervical cancer and application thereof
Patent Information
- Application Number
- CN202211530229.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-30
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2042-11-30
AI Technical Summary
然而,HOLMESv2检测过程复杂限制了其在临床上的应用
[0020] This invention utilizes the specificity of BstUI to effectively distinguish between methylated and unmethylated DNA. Simultaneously, the efficient amplification of target DNA by RPA generates a large amount of dsDNA (double-stranded DNA), which is then specifically recognized by Cas12a. This recognition process requires PAM sites, thus avoiding the non-specific amplification defects of RPA technology. Finally, the trans-cleavage activity of CRISPR/Cas12a is activated to non-specifically cleave the fluorescently modified single-stranded reporter gene, generating a fluorescent signal. Therefore, the detection method described in this invention has high sensitivity and selectivity, good anti-interference ability, and repeatability.
Smart Images

Figure CN116083575B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection, and in particular to a kit for detecting cervical cancer and its application. Background Technology
[0002] DNA methylation, a form of DNA chemical modification, can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group at the 5' carbon position of cytosine in CpG dinucleotides of the genome, under the action of DNA methyltransferases. Numerous studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression and playing a crucial regulatory role in tumorigenesis and development. Therefore, differentially expressed methylated DNA is an important biomarker for early tumor diagnosis and prognostic monitoring. Sulfite-dependent methylation (BS) is the gold standard for nucleic acid gene methylation detection in clinical practice. This method involves treating DNA with sulfite, converting unmethylated cytosine (C) to uracil (U), while methylated cytosine remains unchanged. The treated DNA is then sequenced or subjected to PCR using specific primers to obtain highly accurate information on DNA sequence methylation sites. However, its operation is cumbersome, time-consuming, and requires stringent experimental conditions. In addition, the target genes are easily degraded, the transformation is incomplete, and the recovery rate is low. These inherent shortcomings lead to inaccurate analysis of gene methylation (especially genes with extremely low abundance) results and poor reproducibility, which seriously limits its clinical detection effectiveness.
[0003] Methylation-sensitive restriction endonucleases (MSREs) overcome the shortcomings of BS (biochemical cleavage). This method utilizes the characteristic that methylation-sensitive restriction endonucleases do not cleave methylated regions, digesting DNA into fragments of different sizes before subsequent analysis. Because its reaction conditions are relatively mild, DNA degradation is largely avoided. Furthermore, unlike BS which requires product recovery and purification, MSRE digestion products usually do not require purification before subsequent detection reactions. However, this detection method typically has relatively low sensitivity, requiring further product amplification, i.e., expensive PCR instruments. PCR is the most widely used nucleic acid amplification technique, widely applied due to its sensitivity and specificity; however, PCR requires repeated thermal denaturation and cannot escape the limitation of relying on equipment, thus restricting its application in clinical field testing.
[0004] Since the early 1990s, many laboratories have begun developing isothermal amplification techniques that do not require heat denaturation. Techniques such as recombinant polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), chain substitution isothermal amplification (SDA), and rolling circle isothermal amplification (RCA) have been developed. Among these, SDA, RCA, and RPA have been successfully used for the detection of methylated genes. SDA and RCA are time-consuming experiments, requiring several hours to reach peak amplification of the target product, resulting in lower sensitivity in methylation detection. However, RPA can reach peak amplification of the target product within half an hour and has extremely high accuracy, thus it is widely used in disease detection.
[0005] In recent years, nucleic acid detection technologies based on regularly spaced clustered short palindromic repeats (CRISPR) such as SHERLOCK and DETECTR have attracted much attention due to their rapid and sensitive characteristics. In previous studies, CRISPR / Cas12b combined with BS technology (known as HOLMESv2) has been used for DNA methylation detection. However, the complexity of the HOLMESv2 detection process limits its clinical application. Therefore, developing rapid, sensitive, and easy-to-use methylation gene detection technologies is crucial for clinical disease detection. Summary of the Invention
[0006] To address the aforementioned problems, the present invention provides a kit for detecting cervical cancer, the kit comprising a methylation reagent for detecting the SEPT9 gene promoter SEPT9:77373475-77373595.
[0007] This invention provides a POCT kit for direct detection of cervical cancer based on a combination of isothermal amplification and CRISPR / Cas methods. The kit is for detecting methylation of the SEPT9 gene promoter fragment SEPT9:77373475-77373595. The kit comprises: Component 1: a methylation-sensitive restriction endonuclease that digests human genomic DNA, during which the methylated target sequence fragment remains intact while the unmethylated sequence fragment is specifically cleaved; Component 2: an isothermal amplification reagent that amplifies the methylated target sequence fragment to obtain double-stranded DNA, while the unmethylated sequence fragment is not isothermally amplified; and Component 3: a CRISPR / Cas12a reagent that specifically recognizes the double-stranded DNA, thereby activating the Cas12a enzyme's trans-cleavage activity to cleave single-stranded reporter DNA with a fluorescent group, generating a fluorescent signal to directly detect the methylated target sequence fragment.
[0008] In one embodiment, the methylation-sensitive restriction endonuclease is the nuclease BstUI, and the isothermal amplification reagent is the RPA isothermal amplification reagent.
[0009] In one embodiment, the CRISPR / Cas12a reagent includes crRNA, Cas12a enzyme, and a single-stranded reporter DNA with a fluorescent group. The crRNA guides the Cas12a enzyme to recognize the double-stranded DNA and specifically cleave the methylated target sequence fragment. The double-stranded DNA includes a nucleic acid fragment that specifically binds to the crRNA. The starting sequence of this nucleic acid fragment is a TTTN sequence, where N is any one of the bases A, C, or G. The single-stranded reporter DNA with a fluorescent group generates a fluorescent signal after being cleaved by the activated Cas12a enzyme for specific detection.
[0010] In one embodiment, the concentration of the genomic DNA is no higher than 2.5 ng / μL.
[0011] In one embodiment, the concentration of the endonuclease BstUI is not less than 0.75 U / μL, preferably 1 U / μL.
[0012] In one embodiment, the magnesium ion concentration in the RPA isothermal amplification reagent is 10-25 mM, preferably 10 mM.
[0013] In one embodiment, the amplification time of the RPA isothermal amplification is 5-30 minutes, preferably 15 minutes.
[0014] In one embodiment, the primer concentration in the RPA isothermal amplification reagent is 100-600 nM, preferably 400 nM.
[0015] In one embodiment, the temperature in the RPA isothermal amplification reagent is 38-43°C, preferably 42°C.
[0016] In one embodiment, the Cas12a reaction temperature is 35-45°C, preferably 45°C.
[0017] Current methods for detecting methylated genes, such as the gold standard sulfite-dependent method, require harsh conditions such as strong acid and high temperature, which can lead to DNA degradation and detection failure. Although MSRE has mild reaction conditions that can avoid DNA degradation, incomplete digestion results in a need to improve detection accuracy and sensitivity.
[0018] Compared to existing DNA methylation detection methods, which primarily use linear DNA and are less challenging to detect, the method described in this invention utilizes genomic DNA, making it more suitable for clinical applications. Furthermore, it offers a lower detection limit and a wider detection range. In addition, the entire reaction can be completed within 1 hour, making it ideal for point-of-care testing (POCT).
[0019] Specifically, this invention provides a DNA methylation detection system combining isothermal amplification (RPA) based on methylation-sensitive restriction endonuclease (MSRE) technology with a CRISPR / Cas12a (MeCRISPR) system. Compared to traditional methylation-specific PCR, the RPA reaction based on the BstUI endonuclease offers milder reaction conditions and faster detection speed (the entire reaction takes less than 1 hour). It exhibits excellent performance in DNA methylation detection, accurately detecting extremely low concentrations (1 copy / μL) and concentrations (0.01%) of methylation. Furthermore, MeCRISPR demonstrates sensitivity and specificity as high as 100% and 92.3% in clinical cervical cancer detection, showing excellent application value and promising prospects.
[0020] This invention utilizes the specificity of BstUI to effectively distinguish between methylated and unmethylated DNA. Simultaneously, the efficient amplification of target DNA by RPA generates a large amount of dsDNA (double-stranded DNA), which is then specifically recognized by Cas12a. This recognition process requires PAM sites, thus avoiding the non-specific amplification defects of RPA technology. Finally, the trans-cleavage activity of CRISPR / Cas12a is activated to non-specifically cleave the fluorescently modified single-stranded reporter gene, generating a fluorescent signal. Therefore, the detection method described in this invention has high sensitivity and selectivity, good anti-interference ability, and repeatability.
[0021] The generated dsDNA is partially complementary to crRNA, thereby activating the trans-cleavage activity of Cas12a. Cas12a can cleave nearby fluorescent reporter probes (such as FAM-DNA-BHQ1) to release a green fluorescent signal. Furthermore, the method described in this invention can also be modified by using UV light analysis for experimental visualization and real-time detection. When SEPT9 is methylated, it can activate the RPA reaction to rapidly amplify a large amount of dsDNA, thereby activating the trans-cleavage activity of Cas12a, which in turn non-specifically cleaves the single-stranded FAM-DNA-BHQ1 reporter gene. After cleavage, the reporter probe containing FAM group modification exhibits an absorption peak at 525 nm under 480 nm excitation wavelength and a detectable green fluorescent signal under UV light. Conversely, unmethylated SEPT9, unable to activate the trans-cleavage activity of Cas12a, shows no obvious green fluorescent signal under 480 nm excitation wavelength or UV light. Based on the sensor's detection principle, the methylation modification status of SEPT9 can be successfully distinguished, and it can be applied to real-time detection or high-throughput detection platforms.
[0022] In this invention, the SEPT9 gene promoter SEPT9:77373475-77373595 (121 bp) contains three 5'-CGCG-3' restriction sites. Methylated and unmethylated DNA are first treated with the BstUI methylation-sensitive restriction endonuclease, which recognizes and digests the "5'-CGCG-3'" sites. Therefore, unmethylated DNA is cleaved by BstUI. Unmethylated SEPT9 is completely digested by BstUI. Conversely, methylated SEPT9 remains unaffected and its structure is intact. The structurally intact methylated SEPT9 is used to activate the RPA amplification reaction. In the RPA system, the recombinase binds to the primer, locates the homologous sequence in the double strand, and amplifies the target region exponentially. Therefore, a large amount of dsDNA can be obtained through RPA amplification experiments. Simultaneously, the obtained dsDNA, due to the presence of the PAM sequence site, can be specifically recognized by the Cas12a enzyme, increasing the specificity of its detection. The high specificity and self-amplification capability of the CRISPR / Cas12a system further improve the detection performance of this detection system.
[0023] In this invention, the MSRE (BstUI) we selected can recognize and cleave three sequences containing 5'-CGCG-3' in this fragment, thereby ensuring complete digestion of unmethylated DNA. Furthermore, the large amount of dsDNA amplified by the RPA reaction, with the assistance of the PAM site, is specifically recognized by CRISPR / Cas12a, activating its trans-cleavage activity for fluorescence detection (visualization and high throughput). Due to its high sensitivity and specificity in real clinical sample testing, the MeCRISPR system can be used for the detection of cervical cancer in actual clinical diagnosis. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 This is a basic schematic diagram of the present invention, wherein... Figure 1 A is a schematic diagram illustrating the activation of methylated and unmethylated DNA after treatment with the BstUI methylation-sensitive restriction endonuclease and subsequent isothermal amplification reaction. Figure 1 B is a schematic diagram of the reaction in which the generated dsDNA activates the CRISPR / Cas12a system to cut the reporter gene and produce a fluorescent signal.
[0026] Figure 2 This is an image showing the electrophoresis results of dsDNA amplified by RPA for the target gene fragment;
[0027] Figure 3 This is a diagram of the CRISPR / Cas12a detection results, in which... Figure 3 A is the fluorescence spectroscopy detection result graph. Figure 3 B is a visualized detection result image;
[0028] Figure 4 This is a graph showing the optimization results of different experimental parameters in this invention. Figure 4 A shows the electrophoresis results of amplification products at different substrate concentrations. Figure 4 B is the electrophoresis result of amplification products with different concentrations of BstUI. Figure 4 C represents different concentrations of Mg. 2+ The electrophoresis results of the amplification products are shown in the figure. Figure 4 D is the electrophoresis result of the amplification products with different concentrations of primers. Figure 4 E is the electrophoresis result of the amplification products at different RAP isothermal amplification temperatures. Figure 4 F is the electrophoresis result of the amplification products at different RAP isothermal amplification times. Figure 4G is the fluorescence spectrum detection results at different CRISPR / Cas12a reaction temperatures. Figure 4 H is a visualization of the detection results at different CRISPR / Cas12a reaction temperatures;
[0029] Figure 5 This is a performance result graph of the methylation detection system of the present invention, wherein... Figure 5 A is a graph showing the test results of mSEPT9 at different concentrations. Figure 5 B is a graph showing the test results for different concentrations of mSEPT9;
[0030] Figure 6 This is a visualization of the methylation detection system of the present invention, wherein... Figure 6 A is a schematic diagram of the detection principle of the methylation detection system of the present invention. Figure 6 B is a visualization of mSEPT9 at different concentrations, and Figure 6 C is a visualization of the results of different concentrations of mSEPT9;
[0031] Figure 7 This is a graph showing the effect of the methylation detection system of this invention in detecting mSEPT9 in the clinical diagnosis of cervical cancer. Figure 7 Figures A and 7B show the results of comparing the fluorescence signal values of exfoliated cell samples from cervical cancer patients with those from non-cervical cancer patients, under the same genomic DNA conditions. Figure 7 A) and visualization results ( Figure 7 B). Detailed Implementation
[0032] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application.
[0033] Example 1: Detection of cervical cancer samples using the method of the present invention
[0034] Methylation of the SEPT9 promoter region is considered an effective biomarker for cervical cancer diagnosis, and it is detected using the following method. The principle of the detection method described in this embodiment is given in the appendix. Figure 1 From the appendix Figure 1 As shown in Figure A, methylated and unmethylated DNA are first treated by the BstUI methylation-sensitive restriction endonuclease, which recognizes and digests the "5'-CGCG-3'" site. Therefore, unmethylated DNA is cleaved by BstUI.
[0035] In this invention, the SEPT9 gene promoter SEPT9:77373475-77373595 (121 bp) contains three 5'-CGCG-3' restriction enzyme sites. Therefore, unmethylated SEPT9 is completely digested by BstUI. Conversely, methylated SEPT9 is unaffected and its structure remains intact. The structurally intact methylated SEPT9 is used to activate the RPA amplification reaction. In the RPA system, the recombinase binds to the primer, locates the homologous sequence in the double strand, and amplifies the target region exponentially. Therefore, a large amount of dsDNA can be obtained through RPA amplification experiments.
[0036] Meanwhile, as attached Figure 1 As shown in Figure B, the generated dsDNA is partially complementary to the crRNA, thereby activating the trans-cleavage activity of Cas12a. Cas12a can cleave nearby fluorescent reporter probes (FAM-DNA-BHQ1) to release a green fluorescent signal. Furthermore, the method described in this invention can also be modified by using UV light analysis for real-time, visual detection. When SEPT9 is methylated, it can activate the RPA reaction to rapidly amplify a large amount of dsDNA, thereby activating the trans-cleavage activity of Cas12a, which in turn non-specifically cleaves the single-stranded FAM-DNA-BHQ1 reporter gene. After cleavage, the reporter probe containing FAM group modification exhibits an absorption peak at 525 nm under 480 nm excitation wavelength and a detectable green fluorescent signal under UV light. Conversely, unmethylated SEPT9 cannot activate the trans-cleavage activity of Cas12a, therefore no obvious green fluorescent signal is observed under 480 nm excitation wavelength or UV light. Based on the sensor's detection principle, the methylation modification status of SEPT9 can be successfully distinguished and can be applied to point-of-care detection or high-throughput detection platforms.
[0037] I. Materials and Reagents
[0038] HeLa genomic DNA was purchased from Thermo Fisher Scientific (China) Co., Ltd. RPA primers, PAGE-related reagents (DNA marker (25-500bp), GelRed nucleic acid dye, TE buffer, and loading buffer) were purchased from Shanghai Bioengineering Technology Co., Ltd., and crRNA and fluorescently labeled single-stranded DNA (ssDNA-FQ reporter) were purchased from Guangzhou Labbio Biotechnology Co., Ltd. The Basic RPA kit was purchased from TwistDx. Jurkat genomic DNA, LbaCas12a (Cpf1), and BstUI methylation-sensitive restriction endonuclease were purchased from NEB (Beijing) Co., Ltd. DNA / RNase-free water, phenol, chloroform, and DNA markers (100-1500 bp) were all from Tiangen Biotech (Beijing) Co., Ltd. The genomic DNA extraction kit was purchased from Jingshan Biotechnology (Jiangsu) Co., Ltd.
[0039] Table 1. DNA and RNA sequences used in the embodiments of the present invention.
[0040]
[0041] Note: The red sequence is the BstUI restriction site; the yellow sequence is the CRISPR / Cas12a recognition site; the blue sequence is the spacer region on the crRNA, which is responsible for being complementary to the 21 bases downstream of the protospacer adjacent motif (PAM, usually TTTN sequence, where N is any one of A, C, or G) on the double-stranded DNA.
[0042] II. Genomic DNA Extraction from Cervical Exfoliated Cells
[0043] Genomic DNA from cervical exfoliated cells was extracted using a commercially available kit, such as the nucleic acid extraction kit (magnetic bead method) from Jingshan Biotechnology (Jiangsu) Co., Ltd. The extracted genomic DNA concentration and quality were assessed using Nanodrop. Quality-compliant DNA samples (OD260 / 280 = 1.6–2.0; OD260 / 230 ≥ 3.0; DNA concentration ≥ 20 ng / μL, recommended 100 ng / μL) were adjusted to a concentration of 20 ng / μL and used as pre-adjusted nucleic acid samples. The obtained genomic DNA was then used as the target DNA to verify the practical applicability of this method.
[0044] III. Digestion of target DNA by BstUI methylation-sensitive restriction endonuclease
[0045] The target DNA (mSEPT9 and unSEPT9) was digested with BstUI restriction enzymes in a total volume of 20 μL. The specific steps are as follows: 2 μL of target DNA solution, 2 μL of buffer (10×), 2 μL (20 U) of BstUI and 14 μL of DNA / RNA-free water were added, and the mixture was reacted at 60°C for 30 minutes to obtain the target DNA digestion products.
[0046] IV. RPA Amplification
[0047] use The Basic RPA kit (Twistdx) was used to amplify the target DNA fragment from the enzyme digestion products obtained in the above steps, resulting in double-stranded DNA (dsDNA). The reaction steps were as follows: Following the manufacturer's instructions, 29.5 μL of RPA reaction buffer was used to resuspend the RPA lyophilized powder, resulting in a homogeneous and clear RPA reaction solution. Then, 2 μL of the enzyme digestion product obtained in the above steps (no purification required), 2 μL of reverse primer (10 μM), 2 μL of forward primer (10 μM), and 12.85 μL of DNA / RNase-free water were added to the RPA reaction solution, and the mixture was thoroughly mixed. Finally, 1.65 μL of magnesium acetate (280 mM) was added, bringing the total reaction volume to 50 μL. The reaction was carried out at 42°C for 15 minutes to obtain the reaction product (dsDNA).
[0048] V. Electrophoretic Analysis
[0049] The amplification products obtained from the above amplification steps were verified using a non-denaturing 3% polyacrylamide gel electrophoresis. Since directly synthesized double-stranded target DNA fragments or plasmid samples containing target gene fragments are linear DNA, they cannot simulate the real detection environment. Because the genomic DNA extracted from real clinical samples has a supercoiled structure, which is far more complex than linear DNA, we used HeLa and Jurkat as methylation-positive and negative samples, respectively, and used dsDNA amplified from the target gene fragment via RPA as the target for electrophoresis analysis. Because substances in the RPA reaction can interfere with agarose gel electrophoresis, and product recovery would result in tailing of the bands, we thoroughly mixed the RPA product with 20 μL of phenol / chloroform (1:1) solution, centrifuged, and collected the supernatant. The supernatant was mixed with 6× DNA loading buffer, and then PAGE electrophoresis was performed in 1× TAE buffer at 130V for 40 minutes. Finally, the electrophoresed gel was photographed using Tanon UV imaging for image acquisition. Both methylated SEPT9 (mSEPT9) and unmethylated SEPT9 (unSEPT9) have 121 bp bases. UnSEPT9 contains three "5'-CGCG-3'" sites of BstUI; therefore, after reacting with the BstUI restriction enzyme, unSEPT9 will be cleaved at these sites. Figure 2 It was observed that bands specifically amplified by the RPA reaction were visible in lane 3 (mSEPT9 group), while no obvious target gene fragments were found in lane 2 (unSEPT9 group) or lane 1 (negative control group). Because the methylation modification of mSEPT9 cannot be digested by restriction endonucleases and remains intact, it can be used as a template for RPA amplification to obtain a large amount of dsDNA. These results indicate that both mSEPT9 and unSEPT9 can be specifically recognized by BstUI.
[0050] VI. CRISPR / Cas12a Detection
[0051] High-throughput detection based on fluorescence spectroscopy and visualization based on UV light are based on the trans-cleavage activity of Cas12a. Therefore, the Cas12a reaction procedure is as follows: the total reaction volume is 20 μL: 8 μL DNA / RNase-free water, 2 μL Cas12 enzyme reaction buffer, 4 μL crRNA (1 μM), 2 μL Cas12a (1 μM), 2 μL fluorescent probe (5 μM FAM-DNA-BHQ1), and 2 μL reaction product. Incubate at 45°C for 15 minutes. For high-throughput detection, add 80 μL DNA / RNase-free water and measure the fluorescence signal intensity at 525 nm using a multi-functional microplate reader (SpectraMax M5) under 480 nm excitation. For visualization detection, place the CRISPR / Cas12a cleavage product (without dilution) under a UV lamp and photograph it with a smartphone or digital camera.
[0052] like Figure 3 As shown, the fluorescence spectrum and visual detection results are as follows: Figure 3 A and Figure 3 As shown in Figure B, only mSEPT9 produced strong fluorescence, while the fluorescence of unSEPT9 and the negative control group was negligible. These results indicate that mSEPT9 can avoid BstUI site-specific digestion through 5mC modification, thereby triggering the RPA reaction to generate a large amount of dsDNA, which in turn specifically activates the trans-cleavage activity of Cas12a to cleave the fluorescently labeled single-stranded reporter gene, releasing a fluorescent signal. Meanwhile, unSEPT9, because it can be recognized and digested by BstUI, cannot activate subsequent RPA and CRISPR / Cas12a reactions. In high-throughput detection ( Figure 3 A) Only the mSEPT9 group showed a significant signal intensity at the 525nm emission wavelength, while the unSEPT9 and NC signal values were comparable. This is because in the mSEPT9 group, the non-specific cleavage property of Cas12a was activated, leading to the cleavage of FAM-DNA-BHQ1 and the separation of the FAM group from the quenching group. The FAM group exhibits a specific absorption peak at the 525nm excitation wavelength. In visual detection ( Figure 3 (B) Only the mSEPT9 group showed obvious green fluorescence under UV light. This is because FAM-DNA-BHQ1 was cleaved, causing the FAM group to separate from the quenching group and release fluorescence. These results demonstrate that the MeCRISPR system can successfully detect DNA methylation with low background interference and high sensitivity and accuracy.
[0053] Example 2: Optimization Experiment of the Method of the Invention
[0054] To improve the sensitivity of this method, the MSRE assay (BstUI enzyme digestion substrate concentration, BstUI concentration) and RPA assay (Mg) were adjusted respectively. 2+ Key parameters such as primer concentration, reaction time, reaction temperature, and CRISPR / Cas12a assay (CRISPR / Cas12a cleavage time and CRISPR / Cas12a reaction temperature) were optimized. See attached results. Figure 4 .
[0055] (I) Optimization of MSRE Experimental Parameters
[0056] 1. Optimization of BstUI substrate concentration: To achieve point-of-care testing (POCT) using MeCRISPR technology, we first set the digestion reaction time to 30 min to optimize the substrate concentration. MSRE (methylation-sensitive restriction endonuclease) experimental conditions optimization: 2 μL of Jurkat gDNA at different concentrations (0 / 25 / 50 / 100 / 250 / 500 ng, i.e., 0, 1.25, 2.5, 5, 12.5, 25 ng / μL), 2 μL of buffer (10X), 2 μL of BstUI (20 U), and 14 μL of DNA / RNase-free water were incubated at 60°C for 30 min to obtain the target DNA digestion product. The digestion product from the above steps was amplified using an RPA kit to obtain double-stranded DNA (dsDNA) amplification products. The amplification steps and system were as described in Example 1. Finally, the RPA reaction products were analyzed by PAGE according to the electrophoresis analysis in Example 1 to obtain the target gDNA digestion effect. Figure 4 As shown in Figure A, the PAGE results indicate that when the substrate amount is 100-500 ng (5 / 12.5 / 25 ng / μL), the target DNA shows specific amplification, indicating that Jurkat gDNA digestion is incomplete under these conditions. However, no target band appears in the 50 ng (2.5 ng / μL) group, indicating that Jurkat gDNA is completely digested under these conditions. Therefore, 2.5 ng / μL Jurkat gDNA (50 ng) was selected as the optimal enzyme digestion substrate concentration for MSRE experiments.
[0057] 2. BstUI Enzyme Concentration Optimization: We first set the digestion reaction time to 30 min and the substrate concentration to 2.5 ng / μL to optimize the optimal BstUI enzyme concentration. MSRE (methylation-sensitive restriction endonuclease) experiment BstUI enzyme concentration optimization conditions: 2 μL of different concentrations of BstUI enzyme (i.e., 0, 0.1, 0.25, 0.5, 0.75, 1 U / μL), 2 μL of buffer (10×), 2 μL of BstUI (20 U), and 14 μL of DNA / RNA-free water were reacted at 60℃ for 30 min to obtain the target DNA digestion product. The digestion product from the above steps was amplified using an RPA kit to obtain double-stranded DNA (dsDNA) amplification products. The amplification steps and system were the same as those in Example 1 for RPA amplification. Finally, the RPA reaction product was processed in step five and analyzed by PAGE to obtain the target gDNA digestion effect. Figure 4 As shown in Figure B, the PAGE results indicate that specific amplification of the target DNA occurred when the BstUI enzyme concentration was 0, 0.1, 0.25, and 0.5 U / μL, indicating that Jurkat gDNA digestion was incomplete under these conditions. However, no target band appeared at concentrations of 0.75 and 1 U / μL, suggesting complete digestion of Jurkat gDNA under these conditions. Given that the cleavage capacity of BstUI is related to the background signal, incomplete digestion leads to a high background signal; therefore, 1 U / μL of BstUI enzyme was chosen as the optimal enzyme concentration for MSRE experiments.
[0058] (II) RPA Optimization Experiment
[0059] 1.Mg 2+ Concentration optimization: We first prepared Mg at different concentrations. 2+ (0, 10, 15, 20, 25, 30 mM) to optimize Mg 2 + The concentration of RPA was determined. The specific steps are as follows: Following the instructions, resuspend the RPA lyophilized powder in 29.5 μL of RPA reaction buffer to obtain a homogeneous and transparent RPA reaction solution. Then, add 2 μL of the enzyme digestion product obtained in the above steps (no purification required), 2 μL of reverse primer (10 μM), 2 μL of forward primer (10 μM), and 12.85 μL of DNA / RNase-free water to the RPA reaction solution and mix thoroughly. Finally, add 2 μL of magnesium acetate (different concentrations), bringing the total reaction volume to 50 μL. Incubate at 42℃ for 30 minutes to obtain the reaction product (dsDNA). The substrate digestion steps and system are as described in step three. Finally, process the RPA reaction product according to step five and perform PAGE analysis to obtain the target gDNA amplification effect. Figure 4 As shown in C, the PAGE experimental results indicate that when Mg 2+Specific amplification of the target DNA was observed at concentrations of 10, 15, 20, and 25 mM. No target band was observed at 0 and 30 mM. Furthermore, the target DNA band was brightest at 10 mM, indicating the highest amplification efficiency at this concentration; therefore, 10 mM Mg was chosen. 2+ As the optimal Mg for RPA experiment 2+ concentration.
[0060] 2. Primer Concentration Optimization: We first prepared primers of different concentrations (0, 100, 200, 400, 500, and 600 nM) to optimize the primer concentration. The specific steps are as follows: According to the instructions, resuspend the RPA lyophilized powder in 29.5 μL of RPA reaction buffer to obtain a homogeneous and transparent RPA reaction solution; then add 2 μL of the enzyme digestion product obtained in the above steps (no purification required), 2 μL of reverse primers (different concentrations), 2 μL of forward primers (different concentrations), and 12.85 μL of DNA / RNase-free water to the RPA reaction solution, and mix thoroughly. Finally, add 2 μL of magnesium acetate (final concentration 10 mM), for a total reaction volume of 50 μL. React at 42℃ for 30 minutes to obtain the reaction product (dsDNA). The substrate digestion steps and system are the same as in step three. Finally, the RPA reaction product is processed in step five and analyzed by PAGE to obtain the target gDNA amplification effect. Figure 4 As shown in Figure D, the PAGE results indicate that specific amplification of the target DNA occurred at primer concentrations of 100, 200, 400, 500, and 600 nM. No target band was observed at 0 nM, demonstrating the specificity of the amplification. Furthermore, the target DNA band showed the highest brightness at 400 nM, indicating the highest amplification efficiency under this condition. Therefore, 400 nM was selected as the optimal primer concentration for RPA experiments.
[0061] 3. Temperature Optimization: We first set different temperatures (38℃, 39℃, 40℃, 41℃, 42℃, and 43℃) to optimize the reaction temperature. The specific steps are as follows: According to the instructions, resuspend the RPA lyophilized powder in 29.5 μL of RPA reaction buffer to obtain a homogeneous and transparent RPA reaction solution; then add 2 μL of the enzyme digestion product obtained in the above steps (no purification required), 2 μL of reverse primer (final concentration 400 nM), 2 μL of forward primer (final concentration 400 nM), and 12.85 μL of DNA / RNase-free water to the RPA reaction solution, and mix thoroughly. Finally, add 2 μL of magnesium acetate (final concentration 10 mM), for a total reaction volume of 50 μL. React at different temperatures for 30 minutes to obtain the reaction product (dsDNA). The substrate digestion steps and system are the same as in step three. Finally, the RPA reaction product is processed in step five and analyzed by PAGE to obtain the target gDNA amplification effect. Figure 4 As shown in Figure E, the PAGE experiment results indicate that the target DNA underwent specific amplification at temperatures of 38℃, 39℃, 40℃, 41℃, 42℃, and 43℃. The target DNA band showed the highest brightness at 42℃, indicating the highest amplification efficiency under these conditions. Therefore, 42℃ was selected as the optimal reaction temperature for the RPA experiment.
[0062] 4. Time Optimization: In addition, RPA amplification time is also an important reaction parameter, closely related to the sensitivity of methylation gene detection. We first set different reaction times (0, 5, 10, 15, 20, and 30 min) to optimize the reaction time. The specific steps are as follows: According to the instructions, resuspend the RPA lyophilized powder in 29.5 μL of RPA reaction buffer to obtain a homogeneous and transparent RPA reaction solution; then add 2 μL of the enzyme digestion product obtained in the above steps (no purification required), 2 μL of reverse primer (final concentration 400 nM), 2 μL of forward primer (final concentration 400 nM), and 12.85 μL of DNA / RNase-free water to the RPA reaction solution, and mix thoroughly. Finally, add 2 μL of magnesium acetate (final concentration 10 mM), for a total reaction volume of 50 μL. React at 42℃ for different times to obtain the reaction product (dsDNA). The substrate digestion steps and system are the same as in step three. Finally, the RPA reaction product was processed in step five and analyzed by PAGE to obtain the target gDNA amplification effect. Figure 4 As shown in Figure F, the PAGE experiment results indicate that no target band appeared at 0 min and 5 min, demonstrating the specificity of the amplification. Specific amplification of the target DNA occurred at 5 min, 10 min, 15 min, and 30 min. At 15 min, the target DNA band reached its peak brightness, indicating the highest amplification efficiency under this condition. Therefore, 15 min was selected as the optimal reaction time for the RPA experiment.
[0063] (III) CRISPR / Cas12a Optimization Experiment
[0064] 1. Temperature Optimization: We first set different temperatures (35℃, 37℃, 39℃, 41℃, 43℃, and 45℃) to optimize the reaction concentration. The specific steps are as follows: The total reaction volume is 20μL: 8μL DNA / RNase-free water, 2μL Cas12a enzyme reaction buffer, 4μL crRNA (1μM), 2μL Cas12a (1μM), 2μL fluorescent probe (5μM FAM-DNA-BHQ1), and 2μL RPA reaction product. Incubation was performed at different temperatures for 15 minutes. The RPA experimental steps and system are as described in Example 1. For high-throughput detection, 80μL of DNA / RNase-free water was added, and the fluorescence signal intensity at 525nm was measured using a multi-functional microplate reader (SpectraMax M5) under 480nm excitation. For visualization detection, the CRISPR / Cas12a cleavage product (without dilution) was placed under a UV lamp and photographed with a smartphone or digital camera. Figure 4 As shown in G-4H, the fluorescence signal gradually increases with increasing temperature from 35℃ to 45℃. Furthermore, the fluorescence signal intensity is highest at a reaction temperature of 45℃. Figure 4 G). Visualization results ( Figure 4 H) It was also found that the green fluorescence signal was strongest at a reaction temperature of 45°C. Therefore, the reaction temperature of Cas12a in the next experiment was 45 minutes.
[0065] Example 3: Performance Study of MeCRISPR System for Detecting DNA Methylation
[0066] Compared with existing DNA methylation detection methods, other current technologies use linear DNA, which is easier to detect, and do not use genomic DNA with supercoiled structures. Therefore, the method described in this invention uses genomic DNA, which is closer to clinical applications, and has a lower detection limit and a wider detection range. In addition, the entire reaction can be completed within 1 hour, making it very suitable for point-of-care testing (POCT). These superior performances may be due to the following reasons: (1) The specific recognition of the BstUI enzyme, and the fact that the fragment selected in this invention has 3 restriction sites, which enables effective differentiation between methylated and unmethylated DNA. (2) The efficient amplification capability of RPA can generate a large amount of dsDNA in a short time. (3) The obtained dsDNA, due to the presence of the PAM sequence site, can be specifically recognized by Cas12a, increasing the specificity of its detection. The high specificity and self-amplification capability of the CRISPR / Cas12a system further improve the detection performance of this detection system.
[0067] To investigate the performance of this methylation detection system, we prepared mSEPT9 at different concentrations (0, 1, 2.5, 5, 10, 10...). 2 10 310 4 10 5 The performance of the MeCRISPR system for mSEPT9 detection was investigated under optimal experimental conditions (copies / μL). Figure 5 As shown in Figure A, under 480nm lasing light stimulation, 1, 2.5, 5, 10, 10 2 10 3 10 4 10 5 The fluorescence signal value of copies / ×LmSEPT9 at 525nm gradually increased and was significantly higher than that of the control group (0 copies / μL mSEPT9).
[0068] Existing research indicates that the proportion of methylated modifications in mammalian genomes is typically less than 0.1%, with the vast majority remaining in an unmethylated state. Therefore, detecting genes with extremely low methylation levels in a large number of unmethylated samples is crucial. To address this issue, we first set the detection amount of unmethylated target DNA (umSEPT9) to 50 ng, then added different amounts of methylated target DNA (mSEPT9) to the unmethylated SEPT9 reaction system, preparing a series of mSEPT9 solutions with concentration gradients (0%, 0.01%, 0.05%, 0.1%, 1%, 10%, and 100%). Under optimal experimental conditions, we further investigated the performance of the MeCRISPR system for mSEPT9 detection. Figure 5 As shown in Figure B, under 480 nm lasing stimulation, the fluorescence signal values of 0.01%, 0.05%, 0.1%, 1%, 10%, and 100% mSEPT9 at a wavelength of 525 nm gradually increased and were significantly higher than those of the control group (0% mSEPT9). These results demonstrate that the MeCRISPR system used in this invention has high accuracy and sensitivity in the detection of methylated genes.
[0069] Example 4: Visualization Study of DNA Methylation Detection Using the MeCRISPR System
[0070] Visual detection of tumors offers advantages such as intuitiveness and convenience, making the establishment of a visually visualized methylation gene detection platform of great application value in tumor detection. Therefore, this invention combines the MeCRISPR system with a portable handheld ultraviolet lamp to achieve visualized detection. Based on the detection principle of MeCRISPR visualization (… Figure 6 A) When methylated target DNA (mSEPT9) is present, the test tube will show a green fluorescence under UV light. However, no obvious green fluorescence will appear in unmethylated DNA (mSEPT9). Next, this invention investigates the sensitivity of the MeCRISPR system in the visual detection of methylated genes. Figure 6 As shown in Figure B, under ultraviolet light, as the concentration of mSEPT9 increased from 0 to 10... 5 As the copies / μL gradient increases, the green fluorescence in the reaction tube gradually changes from colorless to dark. Notably, mSEPT9 at concentrations as low as 1 copy / μL can be visually detected in MeCRISPR experiments. Furthermore, from... Figure 6 As can be seen from Figure C, under ultraviolet light, as the mSEPT9 / unSEPT9 ratio gradually increases from 0 to 100%, the green fluorescence in the reaction tube shows a trend of gradually changing from colorless to dark. Notably, even as low as 0.01% mSEPT can be detected by the MeCRISPR system. These results demonstrate that the MeCRISPR-based system used in this invention has high sensitivity for the visual detection of methylated genes and does not require complex instruments, thus showing good application prospects in resource-limited areas.
[0071] Example 5: Real Sample Detection
[0072] To evaluate the effectiveness of the MeCRISPR system in detecting mSEPT9 in the clinical diagnosis of cervical cancer, cervical exfoliated cells, a commonly used clinical sample in non-invasive cervical cancer diagnosis, were used as the material. The MeCRISPR assay was performed to detect mSEPT9, and the results were compared with pathological examination, the gold standard for cervical cancer diagnosis, to explore its detection efficacy. First, genomic DNA samples extracted from cervical exfoliated cells were used as the material, and their concentration was adjusted to 25 ng / μL. The target DNA (mSEPT9) was detected using the MeCRISPR method. Figure 7 As shown in Figure A, under the same conditions of genomic DNA (25 ng / μL), the fluorescence signal value of exfoliated cell samples from cervical cancer patients was significantly higher than that of samples from non-cervical cancer patients. Furthermore, under the same conditions of genomic DNA (25 ng / μL), observation of the fluorescence intensity of test tubes under ultraviolet light revealed that the fluorescence brightness of genomic DNA from cervical cancer patients was significantly higher than that from samples from non-cancer patients. Figure 7 (As shown in B). Finally, 53 real samples were tested. The present invention showed a sensitivity of 100%, a specificity of 92.3%, and an accuracy of 96.2% in cervical cancer detection. Its excellent detection performance makes it suitable for detecting complex real samples. These results demonstrate that the method described in this invention has extremely high sensitivity and specificity for detecting cellular DNA methylation in the diagnosis of cervical cancer.
[0073] It should be understood that the disclosed invention is not limited to the specific methods, schemes, and substances described, as these are all subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the invention, which is limited only by the appended claims.
[0074] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.
Claims
1. A POCT kit for direct detection of cervical cancer based on a combination of isothermal amplification and CRISPR / Cas methods, characterized in that, The kit is a methylation detection kit for the SEPT9 gene promoter fragment SEPT9: 77373475-77373595. The sequence of the SEPT9: 77373475-77373595 fragment is CGACCCGCTGCCCACCAGCCATCATGTCGGACCCCGCGGTCAACGCGCAGCTGGATGGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGA. The SEPT9: 77373475-77373595 fragment contains three 5'-CGCG-3' BstUI recognition sites and a CRISPR / Cas12a recognition site TTTCGGACTTCGAAGGTGGGTGCT. The kit includes: Component 1: It includes a methylation-sensitive restriction endonuclease that digests human genomic DNA, during which the methylated target sequence fragment remains intact while the non-methylated sequence fragment is specifically cleaved; Component 2: It includes an isothermal amplification reagent, which amplifies the methylated target sequence fragment to obtain double-stranded DNA, while the unmethylated sequence fragment is not amplified isothermally. The isothermal amplification reagent includes a forward primer CGACCCGCTGCCCACCAGCCATCATGTCGG and a reverse primer TCTCCAGCACGTCCGCGGCCGCAGCAGCCAG for isothermal amplification. Component 3: CRISPR / Cas12a reagent, which specifically recognizes the double-stranded DNA, thereby activating the Cas12a enzyme's trans-cleavage activity to cleave the single-stranded reporter DNA with a fluorescent group, generating a fluorescent signal to directly detect the methylated target sequence fragment; The methylation-sensitive restriction endonuclease is the nuclease BstUI, and the isothermal amplification reagent is the RPA isothermal amplification reagent; The CRISPR / Cas12a reagent comprises crRNA, Cas12a enzyme, and a single-stranded reporter DNA with a fluorescent group. The crRNA guides the Cas12a enzyme to recognize the double-stranded DNA and specifically cleave the methylated target sequence fragment. The double-stranded DNA includes a nucleic acid fragment that specifically binds to the crRNA. The crRNA is UAAUUUCUACUAAGUGUAGAUGGACUUCGAAGGUGGGUGCUG. The single-stranded reporter DNA with a fluorescent group generates a fluorescent signal after being cleaved by the activated Cas12a enzyme for specific detection.
2. The reagent kit according to claim 1, characterized in that, The concentration of the genomic DNA is no higher than 2.5 ng / μL.
3. The reagent kit according to claim 1, characterized in that, The concentration of the endonuclease BstUI is not less than 0.75 U / μL.
4. The reagent kit according to claim 3, characterized in that, The concentration of the endonuclease BstUI is 1 U / μL.
5. The reagent kit according to claim 1, characterized in that, The magnesium ion concentration in the RPA isothermal amplification reagent is 10-25 mM.
6. The reagent kit according to claim 5, characterized in that, The magnesium ion concentration in the RPA isothermal amplification reagent is 10 mM.
7. The kit according to any one of claims 1-6, characterized in that, The amplification time for the RPA isothermal amplification is 5-30 minutes.
8. The kit according to claim 7, characterized in that, The amplification time for the RPA isothermal amplification is 15 minutes.
9. The kit according to any one of claims 1-6, characterized in that, The primer concentration in the RPA isothermal amplification reagent is 100-600 nM.
10. The reagent kit according to claim 9, characterized in that, The primer concentration in the RPA isothermal amplification reagent is 400 nM.
11. The kit according to any one of claims 1-6, characterized in that, The isothermal amplification temperature of the RPA is 38-43℃.
12. The kit according to claim 11, characterized in that, The isothermal amplification temperature of the RPA was 42℃.
13. The kit according to any one of claims 1-6, characterized in that, The reaction temperature of Cas12a is 35-45℃.
14. The kit according to claim 13, characterized in that, The reaction temperature of Cas12a is 45℃.
Citation Information
Patent Citations
Probe for detecting SEPT9 gene methylation and application of probe
CN104830855A
Kit applied in detecting cervical cancers and application thereof
CN109554473A