Polypeptides derived from follicular fluid, chemical syntheses and uses thereof

Abstract

The application provides an isolated polypeptide, which has an amino acid sequence as shown in the following formula: X1X2X3X4X5X6HX8X9X 10 X 11 X 12 X 13 X 14 The polypeptide can enter cytoplasm and nucleus to play a role, increase cell viability of KGN cells damaged by H2O2, and increase IVM maturation rate of GV stage oocytes of aged mice, reduce abnormal rate of spindles, and rescue part of development defects of aged oocytes.

Description

Technical Field

[0001] This invention relates to reproductive biomedical technology, specifically, to a polypeptide derived from follicular fluid, a chemically synthesized compound and its application, and also to the mechanism of the chemically synthesized polypeptide in human granulosa cells and mouse oocytes. Background Technology

[0002] Infertility is a global issue affecting couples of childbearing age in various countries and regions. In vitro fertilization and embryo transfer (IVF-ET), commonly known as "test-tube baby," has helped over 8 million infertile women overcome their fertility problems. With the increasing number of women marrying and having children later in life, the number of older infertile women is also gradually rising. Age is an independent risk factor affecting female fertility; fertility declines significantly after age 35, mainly manifested in poor oocyte maturity and decreased quality (insufficient mitochondrial quantity and function, and an increased proportion of spindle abnormalities), also known as "oocyte aging." Age-related oocyte aging is also a major reason affecting the success rate of IVF in older patients, with IVF-ET outcomes showing low implantation and low pregnancy rates.

[0003] Therefore, technologies to improve oocyte quality and alleviate oocyte aging need further research. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art.

[0005] This invention is based on the following discoveries of the inventors:

[0006] Oxidative stress is considered a major cause of oocyte aging, and H2O2 is a relatively common method for inducing cellular senescence. To improve the quality of aging oocytes, many treatments for improving oocyte aging have been studied in animal models, with particular emphasis on the efficacy of antioxidants.

[0007] Follicular fluid (FF) is a liquid mainly composed of hormones, enzymes, anticoagulants, electrolytes, reactive oxygen species, and antioxidants. It fills the follicular cavity and serves as an important medium for communication between cells within the follicular cavity, transporting nutrients to the oocyte. Due to declining fertility, the composition of FF may change. Identifying specific components of FF can provide a better understanding of intrafollicular signaling. Furthermore, some components of FF can be used to assess oocyte developmental potential and serve as biomarkers of oocyte health. The cumulus-oocyte complex provides essential nutrients for oocyte maturation through various paracrine signaling pathways. Cumulus cells play a crucial role in follicular development, and even after ovulation, they remain loosely attached to the oocyte. Therefore, cumulus cells may provide information about oocyte viability. Studies have shown that characteristic molecules of cumulus cells are influenced by maternal aging at both the genetic and protein levels. Thus, aging not only accompanies oocyte senescence events but also affects the oocyte's surrounding environment, such as follicular fluid, and the function of granulosa cells.

[0008] Polypeptides are a class of bioactive components composed of 3-50 amino acids, playing a crucial role in reproductive regulation. They are characterized by their small molecular weight, good targeting ability, and easy entry into cells. Furthermore, peptide drugs possess advantages such as high affinity and selectivity, minimal interactions with other drugs, high in vivo clearance rates, and non-toxic metabolites. Therefore, they form an important molecular basis for improving oocyte developmental potential. The functional roles of small molecule peptides in vivo are prominent, playing a vital role in oocyte maturation and development. Currently, the method of adding peptide factors to in vitro maturation (IVM) culture media for use in IVM reproductive technology has made some progress, which is beneficial for improving the developmental potential of IVM oocytes. Therefore, the exogenous addition of small molecule peptides is a promising method in the field of reproductive medicine.

[0009] Peptidomics, an emerging field within proteomics, is a method for comprehensively analyzing peptides in various biological samples using mass spectrometry. It allows for the systematic, qualitative, and quantitative study of the composition and content of endogenous peptides in organisms under physiological or pathological conditions. Peptidomics analysis has been widely applied to human bodily fluids, such as serum, plasma, urine, saliva, and cerebrospinal fluid, enabling in-depth understanding of the peptide and protein composition of these substances. Methods for using peptidomics to discover potential biomarkers related to diseases are also gradually developing. The inventors found that there is currently limited research using peptidomics to identify small-molecule peptide biomarkers and their functional mechanisms related to advanced maternal age infertility in women. Considering that previous studies have validated the feasibility of applying peptidomics to explore peptides in human fetal follicles (FF), the inventors started with the FF peptidomics of older IVF patients, identifying and studying small-molecule peptides that can improve oocyte developmental potential, screening for FF peptidomics biomarkers related to oocyte aging in older women, and validating the function of key small-molecule peptides through clinical and animal cell experiments to identify targets for peptide interactions.

[0010] Therefore, in one aspect of the invention, an isolated polypeptide is provided. According to an embodiment of the invention, the polypeptide has the following amino acid sequence: X1X2X3X4X5X6HX8X9X 10 X 11 X 12 X 13 X 14Where X1 is D, A, C, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; X2 is R, A, C, D, E, F, G, H, I, K, L, M, N, P, Q, S, T, V, W or Y; and X3 is V, A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S X4 is L, A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W, or Y; X5 is G, A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; X6 is A, C, D, E, F, or G; X8 is I, W, or Y; X9 is L, A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W or Y, X10 is G, A, C, D, E, F, H, I, K, L, M, N, P , Q, R, S, T, V, W or Y, X11 is P, A, C, D, E, F, H, I, K, L, M, N, Q, R, S, T, V, W or Y, X12 is G, A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; X13 is A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; X14 is G, A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y. According to specific embodiments of the present invention, the polypeptide can enter the cytoplasm and nucleus to exert its effects, increasing the cell viability of H2O2-damaged KGN cells and cumulus granulosa cells from elderly IVF patients, and improving the IVM maturation rate of GV-stage oocytes in elderly mice, reducing the spindle abnormality rate, and rescuing some developmental defects in aging oocytes.

[0011] According to embodiments of the present invention, the polypeptide may further include at least one of the following additional technical features:

[0012] According to an embodiment of the present invention, the polypeptide has the amino acid sequence shown in SEQ ID NO:1:

[0013] DRVLGAHILGPGAG(SEQ ID NO:1)

[0014] Through experiments, the inventors discovered that the isolated polypeptide was significantly expressed in healthy young individuals but not in older individuals. Furthermore, the inventors found that the polypeptide exhibits high expression abundance; high evolutionary homology (100% homology between humans and mice); highly conserved amino acid sequences in mammals; and good stability and lipophilicity.

[0015] According to an embodiment of the present invention, the polypeptide has any of the amino acid sequences shown in SEQ ID NO:4 to SEQ ID NO:219 (as shown in Table 1).

[0016] It should be noted that SEQ ID NO:4 to SEQ ID NO:219 are polypeptide mutant sequences, including but not limited to these forms.

[0017] Table 1

[0018]

[0019]

[0020]

[0021] According to embodiments of the present invention, one or more amino acids in the amino acid side chain, N-terminus, and C-terminus of the polypeptide have modifying groups or tags.

[0022] According to embodiments of the present invention, the modifying group includes at least one selected from fluorescent groups, phosphate groups, acyl groups, photosensitizers, disulfide bonds, azide groups, polyethylene glycol groups, methylation groups, fluorescence quenching groups, protein coupling groups, small molecule compounds, amino groups, hydroxyl groups, carboxyl groups, carbonyl groups, alkyl groups, acetyl groups, biotin groups, ester groups, glycosyl groups, conjugate groups, and transmembrane peptide groups.

[0023] According to embodiments of the present invention, the modifying group is selected from membrane-penetrating peptide groups. This increases the membrane-penetrating ability of the polypeptide, allowing it to more easily enter the cytoplasm and nucleus to exert its function.

[0024] According to an embodiment of the present invention, the transmembrane peptide group is located at the N-terminus or C-terminus of the polypeptide.

[0025] According to an embodiment of the present invention, the transmembrane peptide group has the amino acid sequence shown in SEQ ID NO:2.

[0026] GRKKRRQRRRPPQQ(SEQ ID NO:2)

[0027] According to an embodiment of the present invention, the label includes at least one selected from Flag label, HA label, His label, Strep II label and Myc label.

[0028] According to an embodiment of the present invention, the tag is a Flag tag. When the polypeptide is modified with a Flag tag, the movement of the polypeptide can be visualized, making it easier to observe the location where the polypeptide plays a role in the cell.

[0029] According to an embodiment of the present invention, the Flag tag modifies the N-terminus or C-terminus of the polypeptide.

[0030] According to an embodiment of the present invention, the Flag tag has an amino acid sequence as shown in SEQ ID NO:3.

[0031] DYKDDDDK(SEQ ID NO:3)

[0032] It should be noted that the modified groups of the separated peptide can be one or more, that is, a membrane-penetrating peptide group or a Flag tag, or both. When both a membrane-penetrating peptide group and a Flag tag are present, if the membrane-penetrating peptide group modifies the N-terminus of the peptide, then the Flag tag modifies the C-terminus of the peptide; if the membrane-penetrating peptide group modifies the C-terminus of the peptide, then the Flag tag modifies the N-terminus of the peptide.

[0033] In another aspect of the invention, the present invention proposes the use of the aforementioned polypeptide as a biomarker for follicular fluid, said biomarker being used to characterize oocyte senescence. The inventors have experimentally discovered that the isolated polypeptide is significantly expressed in a healthy young group but not in an older group; therefore, said polypeptide can characterize the state of oocytes.

[0034] In another aspect of the invention, the invention provides for the use of the aforementioned polypeptide in the preparation of a medicament for at least one of the following: treating or preventing female infertility; correcting developmental defects in aging oocytes; increasing the cell viability of H2O2-damaged KGN cells; increasing the activity of granulosa cells in elderly individuals; improving the IVM maturation rate of oocytes; and reducing the abnormality rate of spindle fibers in aging oocytes.

[0035] In another aspect of the invention, the use of the reagent in the preparation of a kit is proposed. According to embodiments of the invention, the reagent is used to detect the aforementioned polypeptide, and the kit is used to detect oocyte viability or female infertility. The kit according to embodiments of the invention can effectively detect the content of autoantibodies corresponding to the isolated polypeptides, thereby diagnosing or predicting oocyte viability or the prognosis of female infertility, and has high accuracy and specificity.

[0036] According to embodiments of the present invention, the use of the reagent in the preparation of the kit may further include at least one of the following additional technical features:

[0037] According to embodiments of the present invention, the reagent comprises an antibody or probe that binds to the polypeptide.

[0038] According to embodiments of the present invention, the failure to detect the polypeptide is an indication of low oocyte viability or infertility or difficulty conceiving in the examined woman.

[0039] In another aspect of the invention, the use of the reagent in the preparation of a medicament is proposed. According to embodiments of the invention, the reagent is used to increase the content or activity of the aforementioned polypeptide, and the medicament is used for at least one of the following: treating or preventing female infertility; correcting developmental defects in aging oocytes; increasing the cell viability of H2O2-damaged KGN cells; increasing the activity of granulosa cells in older individuals; improving the IVM maturation rate of oocytes; and reducing the abnormality rate of the spindle apparatus in aging oocytes.

[0040] According to embodiments of the present invention, the use of the reagent in the preparation of a drug may further include at least one of the following additional technical features:

[0041] According to an embodiment of the present invention, the reagent comprises a vector for overexpressing the polypeptide, the vector having the nucleotide sequence shown in SEQ ID NO:220.

[0042] GACAGAGTGCTGGGCGCCCACATCCTGGGCCCCGGCGCCGGC (SEQ ID NO: 220)

[0043] In another aspect of the invention, a method for determining the source of a sample to be tested is provided. According to an embodiment of the invention, the method includes: determining the source of the sample to be tested based on the aforementioned polypeptide in the sample.

[0044] According to an embodiment of the present invention, the sample to be tested is follicular fluid.

[0045] According to an embodiment of the present invention, the detection of polypeptides in follicular fluid is an indication that the follicular fluid originates from a young organism.

[0046] According to an embodiment of the present invention, no polypeptide was detected in the follicular fluid, which is an indication that the follicular fluid originated from an older organism.

[0047] In another aspect of the invention, a method for increasing the activity of granulosa cells in elderly individuals is provided. According to an embodiment of the invention, the method includes contacting the granulosa cells with the aforementioned polypeptide. According to a specific embodiment of the invention, this method can significantly increase the activity of cumulus-granulosa cells in elderly IVF patients in a concentration-dependent manner.

[0048] According to an embodiment of the present invention, the concentration of the polypeptide in the contact system is 10–60 μg / ml.

[0049] According to an embodiment of the present invention, the concentration of the polypeptide in the contact system is 20 μg / ml or 50 μg / ml.

[0050] In another aspect of the invention, a method is provided to improve the IVM maturation rate of oocytes and reduce the abnormality rate of spindle fibers in aging oocytes. According to an embodiment of the invention, the method includes contacting the oocyte with the aforementioned polypeptide. According to a specific embodiment of the invention, this method can significantly improve the IVM maturation rate of oocytes and reduce the abnormality rate of spindle fibers in aging oocytes.

[0051] According to an embodiment of the present invention, the concentration of the polypeptide in the contact system is 10–60 μg / ml.

[0052] According to an embodiment of the present invention, the concentration of the polypeptide in the contact system is 20 μg / ml.

[0053] In another aspect of the invention, a pharmaceutical composition is provided. According to embodiments of the invention, the pharmaceutical composition comprises the aforementioned polypeptide. As is known from the foregoing, the polypeptide can enter the cytoplasm and nucleus to exert its effects, increasing the cell viability of H2O2-damaged KGN cells and cumulus granulosa cells from elderly IVF patients, and improving the IVM maturation rate of GV-stage oocytes from elderly mice, reducing the spindle abnormality rate, and rescuing some developmental defects in aging oocytes. Therefore, the pharmaceutical composition also has the effect of increasing the cell viability of H2O2-damaged KGN cells and cumulus granulosa cells from elderly IVF patients, improving the IVM maturation rate of GV-stage oocytes from elderly mice, reducing the spindle abnormality rate, and rescuing some developmental defects in aging oocytes.

[0054] According to embodiments of the present invention, the pharmaceutical composition is in the form of capsules, tablets, granules, powders, injections, or sprays.

[0055] In another aspect of the invention, a protein complex is provided. According to embodiments of the invention, the protein complex comprises the aforementioned polypeptide and an interacting protein of the polypeptide.

[0056] According to embodiments of the present invention, the interacting proteins of the polypeptide include at least one selected from PLXNB2, ARHGAP1, NAP1L4, TWF1, ACTL6A and RAB8A.

[0057] In another aspect of the invention, the invention provides for the use of the aforementioned pharmaceutical composition or the aforementioned protein complex in the preparation of a medicament for at least one of the following: treating or preventing female infertility; correcting developmental defects in aging oocytes; increasing the cell viability of H2O2-damaged KGN cells; increasing the activity of granulosa cells in older individuals; improving the IVM maturation rate of oocytes; and reducing the abnormality rate of the spindle apparatus in aging oocytes.

[0058] The beneficial effects of this invention are:

[0059] This invention, from a peptidomics perspective, provides a functional polypeptide derived from follicular fluid: FDP3 (amino acid sequence: DRVLGAHILGPGAG), which can rescue some developmental defects in aging oocytes. The polypeptide described in this invention can enter the cytoplasm and nucleus to exert its effects, increasing the cell viability of H2O2-damaged KGN cells and cumulus granulosa cells from elderly IVF patients, and improving the IVM maturation rate of GV-stage oocytes from elderly mice, while reducing the rate of spindle abnormalities, thus rescuing some developmental defects in aging oocytes. The mechanism by which this polypeptide improves cell development is preliminarily considered to be related to the interactions of PLXNB2, ARHGAP1, NAP1L4, TWF1, ACTL6A, and RAB8A.

[0060] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0061] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0062] Figure 1 This is a mass spectrum of the FDP3 chemically synthesized peptide according to an embodiment of the present invention;

[0063] Figure 2 The figure shows the effect of FDP3 on the viability of H2O2-damaged KNG cells according to an embodiment of the present invention (*P<0.05, **P<0.01, ***P<0.001, nsP>0.05).

[0064] Figure 3 This describes the expression of the polypeptide FDP3-flag in KGN cells according to an embodiment of the present invention.

[0065] Figure 4 The effect of FDP3 on the cell viability of cumulus granulosa cells in elderly individuals according to embodiments of the present invention (*P<0.05, **P<0.01);

[0066] Figure 5 The effect of the polypeptide FDP3-flag according to the embodiments of the present invention on the maturation of IVM in older female mice (**P<0.01, nsP>0.05);

[0067] Figure 6 This is a localization map of the expression of the polypeptide FDP3-flag in oocytes according to an embodiment of the present invention;

[0068] Figure 7The effect of the polypeptide FDP3-flag on the oocyte spindle according to an embodiment of the present invention (*P<0.05);

[0069] Figure 8 These are the interacting target proteins screened by the peptide FDP3-flag according to embodiments of the present invention;

[0070] Figure 9 This is a Western blotting verification of the target protein of the peptide FDP3-flag interaction according to an embodiment of the present invention. Detailed Implementation

[0071] Unless otherwise specifically indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Furthermore, any methods or materials similar to or equivalent to those described herein may be used to practice this invention. The following terms are defined for the purposes of this invention.

[0072] It should be noted that, in the broadest sense, the term "peptide" as used in this application refers to a compound consisting of two or more subunit amino acids, amino acid analogs, or other peptide mimics. Therefore, the term "peptide" includes short peptide sequences, as well as longer peptides and proteins. The term "amino acid" as used herein refers to natural and / or non-natural or synthetic amino acids, including D or L optical isomers, as well as amino acid analogs and peptide mimics.

[0073] The terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0074] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0075] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this invention, but do not exclude other aspects.

[0076] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0077] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to vertebrates, preferably mammals. Mammals include, but are not limited to, humans, mice, rats, apes, chickens, cattle, zebrafish, bony fish, carp, tilapia, large yellow croaker, and crucian carp. It also encompasses tissues, cells, and their progeny from biological entities obtained in vivo or cultured in vitro.

[0078] As used herein, the term "application" refers to the addition of a substance to a culture medium. Application can be made via any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or percutaneous). Parenteral application includes intravenous, intramuscular, intra-arterial, intradermal, subcutaneous, intraperitoneal, intravenous, and intracranial administration. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, and percutaneous patches.

[0079] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0080] Example 1: Discovery of biomarkers for follicular fluid origin in older IVF patients

[0081] This study included elderly infertile women undergoing IVF assisted reproduction due to fallopian tube or female factors, and young, healthy women undergoing IVF assisted reproduction due to male factors, all from the Reproductive Medicine Center of Shuguang Hospital affiliated with Shanghai University of Traditional Chinese Medicine. Patients were divided into a normal control group and an elderly group. A standard ovulation induction protocol was used, and follicular fluid was collected on the day of oocyte retrieval (microscopic confirmation of MII stage oocytes). Previously, this follicular fluid was routinely discarded; therefore, its use in this study was feasible. All patients obtained and signed informed consent forms before the fluid was used in this study.

[0082] 1. Collection and preservation of follicular fluid

[0083] On the day of oocyte retrieval, the first tube of pale yellow, bloodless, and clear follicular fluid was collected from both the normal control group and the advanced maternal age group. Microscopic examination confirmed the presence of MII stage oocytes. After collection, the fluid was centrifuged at 3000 rpm for 10 minutes at 4°C. The supernatant was aliquoted into cryopreservation tubes, labeled, flash-frozen in liquid nitrogen for 5 minutes, and then directly stored at -80°C for subsequent peptidomics analysis.

[0084] 2. Experimental Methods

[0085] Peptideomics detection method: Thermo Scientific TM Q Exactive TM The Orbitrap quadrupole mass spectrometer uses label-free quantification to perform mass spectrometry analysis on protein enzymatically digested peptides.

[0086] 3. Data Analysis

[0087] 1) Statistical analysis was performed using IBM SPSS Statistics V.25.0 software. Data visualization was performed using GraphPad Prism 8.0.

[0088] 2) Tandem mass spectra were analyzed using PEAKS Studio version X+ (Bioinformatics Solutions Inc., Waterloo, Canada): PEAKS DB searched the GDPR21020040 database for Uniprot sources. The "None enzyme" setting was used. Peptide card values ​​were: -10lgP ≥ 0 (-10lgP is the protein confidence score; a higher value indicates that the protein contains more reliable peptides).

[0089] Mass spectrometry analysis was used to screen the peptide described in this invention from differentially expressed peptides based on the following criteria: ① the peptide was significantly expressed in healthy young groups but not in older groups; ② the peptide expression abundance was high; ③ it showed high evolutionary homology, with 100% homology between humans and mice; and ④ the function of the precursor protein. The amino acid sequence of this peptide is DRVLGAHILGPGAG. Sequence alignment across different species revealed that the amino acid sequence of this peptide is highly conserved in mammals, with 100% homology between humans and mice. The corresponding precursor protein is DLDH (dihydrolipoamide dehydrogenase), which is mainly involved in mitochondrial metabolism and regulates apoptosis by affecting DNA binding capacity.

[0090] To further investigate the function and mechanism of this small molecule peptide, the peptide sequence was chemically synthesized in vitro. To enhance its membrane-penetrating ability, a membrane-penetrating peptide sequence (GRKKRRQRRRPPQQ) was added to the N-terminus of the peptide. The chemically synthesized peptide was named FDP3 (Follicular Fluid Derived Peptide 3, sequence GRKKRRQRRRPPQQDRVLGAHILGPGAG). The successful synthesis of this peptide was verified by mass spectrometry. Figure 1As shown. Simultaneously, a Flag-labeled (C-terminus) FDP3 was chemically synthesized and named FDP3-flag.

[0091] Example 2: Functional study of peptides on granulosa cells in elderly individuals

[0092] The polypeptide was initially functionally validated using ovarian granulosa cell lines from elderly patients (KGN cells) and cumulus granulosa cells from elderly IVF patients on the day of oocyte retrieval.

[0093] 1. Obtaining KGN cells and cumulus granulosa cells from elderly individuals

[0094] 1) Hydrogen peroxide-induced KGN cell senescence method: KGN cells were cultured in 96-well plates. After cell adhesion, the cells were pretreated with medium containing 400 μmol / L H2O2 solution. After 4 hours, the H2O2 medium was removed and replaced with DMEM medium.

[0095] 2) After oocyte retrieval from elderly IVF patients, cumulus granulosa cells were placed in 15ml centrifuge tubes, and 0.25% trypsin was added for digestion. The centrifuge tubes were placed in a 37℃ water bath. The cells were digested for 0.5-2 minutes, and fresh DMEM medium was added to stop the digestion. The supernatant was discarded after centrifugation. An appropriate amount of medium was added, the cells were resuspended, and plated. The cells were then transferred to a 37℃ cell culture incubator containing 5% CO2 for subsequent experiments.

[0096] 2. Experimental Grouping

[0097] 1) KGN cell function experiment grouping

[0098] (1) Blank control group: KGN cells cultured in DMEM medium.

[0099] (2) Hydrogen peroxide modeling (H2O2) group: The method of hydrogen peroxide-induced senescence of KGN cells in 1) was used. After replacing the medium with DMEM, the cells were incubated for 24 h.

[0100] (3) H2O2+FDP3 (20μg / ml) group: The method of hydrogen peroxide-induced senescence of KGN cells was used in 1. After 4 hours, the medium containing H2O2 was removed and replaced with DMEM medium containing 20μg / ml peptides for 24 hours.

[0101] (4) H2O2+FDP3 (50μg / ml) group: The method of hydrogen peroxide-induced senescence of KGN cells was used in 1. After 4 hours, the medium containing H2O2 was removed and replaced with DMEM medium containing 50μg / ml peptides for 24 hours.

[0102] 2) Grouping of Cumulus Granulosa Cell Function Experiment in Elderly IVF Patients

[0103] (1) Blank control group: elderly human cumulus granulosa cells cultured in DMEM medium.

[0104] (2) FDP3 (20 μg / ml) group: After the cumulus granulosa cells of elderly people were cultured to adherence, DMEM culture medium containing 20 μg / ml peptide was added and cultured for another 24 h.

[0105] (3) FDP3 (50 μg / ml) group: After the cumulus granulosa cells of elderly people were cultured to adherence, DMEM culture medium containing 50 μg / ml peptide was added and cultured for another 24 h.

[0106] 3. Experimental methods and observation indicators

[0107] 1) Cell viability assay method

[0108] KGN cells and cumulus granulosa cells from elderly IVF patients were subjected to different interventions, and cell viability was detected using the CCK-8 assay.

[0109] 2) Immunofluorescence staining experiment

[0110] Chemically synthesized FDP3-flag was added to culture medium to culture KGN cells. After 24 hours, an immunofluorescence staining experiment was performed to observe its cell entry.

[0111] The experimental results are as follows:

[0112] 1) KGN cells

[0113] (1) After KGN cells were damaged by H2O2, FDP3 was added to the culture medium. After 24 hours of treatment, CCK8 assay showed that both 20 μg / ml and 50 μg / ml of FDP3 significantly increased the viability of damaged KGN cells (P < 0.05, P < 0.001), and this effect was concentration-dependent. Figure 2 As shown.

[0114] (2) Chemically synthesized FDP3-flag was added to the culture medium and KGN cells were cultured. After 24 hours, immunofluorescence staining was performed. Confocal observation revealed that the fluorescence was distributed in the cytoplasm and nucleus of KGN cells, indicating that FDP3-flag can enter KGN cells and exert its function. Figure 3 As shown.

[0115] 2) Cumulus granulosa cells in elderly IVF patients

[0116] After cell adhesion, different concentrations of FDP3 were added to the culture medium. After 24 hours of treatment, cell viability was detected by CCK8 assay. The results showed that both 20 μg / ml and 50 μg / ml of FDP3 significantly increased the viability of cumulus granulosa cells from elderly IVF patients (P < 0.05, P < 0.01), exhibiting a concentration-dependent effect. Figure 4 As shown.

[0117] Example 3: Effects of peptides on the development of aging oocytes in older female rats

[0118] ICR female mice were used as research subjects. Young female mice were 6-8 weeks old; older female mice were 12-15 months old. All mice were purchased from Beijing Vital River Company through the Animal Experiment Center of Shanghai University of Traditional Chinese Medicine. The older ICR female mice were non-retired rats, while the 8-week-old young female mice were routinely housed at the Animal Experiment Center of Shanghai University of Traditional Chinese Medicine for 12-13 months, with light exposure from 7:00 AM to 7:00 PM and free access to water. This study was approved by the Animal Ethics Committee of Shanghai University of Traditional Chinese Medicine.

[0119] 1. Obtaining mouse GV stage oocytes

[0120] Both older and younger female mice underwent ovulation induction between 4 PM and 6 PM, with each mouse receiving an intraperitoneal injection of 10 IU of PMSG. Forty-eight hours later, the mice were euthanized by carbon dioxide inhalation. Both ovaries were removed via laparotomy, and the adipose tissue was removed. The mice were then rinsed three times with PBS solution. The ovarian tissue was then punctured with a 1 ml sterile syringe needle, and the cumulus-oocyte complex in the GV stage was aspirated using a Pasteur tube. The complex was rinsed three times with oocyte wash buffer solution in the in vitro culture medium for immature oocytes and then transferred to a balanced IVM culture medium. The cumulus cells surrounding the oocytes were repeatedly removed by blowing and blowing with a thinned Pasteur tube. The oocytes were preserved for subsequent experiments.

[0121] 2. Preparation of IVM culture medium

[0122] IVM culture medium is prepared one day in advance. FSH (0.075 IU / ml) and LH (0.075 IU / ml) are added to the IVM culture medium, and the embryo culture mineral oil is added. The medium is then placed in a 37°C, 5% CO2 incubator for overnight equilibration.

[0123] 3. In vitro maturation culture of mouse oocytes

[0124] On the day of the experiment, after oocytes were retrieved under a dissecting microscope from mice, GV stage oocytes were transferred into equilibrated IVM culture medium (total volume 100 μL) using a Pasteur pipette and placed in a 37℃, 5% CO2 incubator. The oocyte maturation rate was observed after 24 hours.

[0125] 4. Experimental Grouping

[0126] (1) Blank control group: After oocyte retrieval, GV stage oocytes were transferred into equilibrated IVM culture medium using a Pasteur tube.

[0127] (2) FDP3-flag (20μg / ml) group: FDP3-flag at a concentration of 20μg / ml was added to the equilibrated IVM culture drop before oocyte retrieval the next day. The total volume of the IVM culture drop was 100μL. After oocyte retrieval, GV stage oocytes were transferred into the above IVM culture drop using a Pasteur tube.

[0128] (3) FDP3-flag (50μg / ml) group: FDP3-flag at a concentration of 50μg / ml was added to the equilibrated IVM culture drop before oocyte retrieval the next day. The total volume of the IVM culture drop was 100μL. After oocyte retrieval, GV stage oocytes were transferred into the above IVM culture drop using a Pasteur tube.

[0129] After 24 hours, the oocytes were transferred to equilibrated G1 culture droplets, and the maturation rate of the oocytes was observed. The oocytes were then fixed for immunofluorescence staining.

[0130] 5. Experimental methods and observation indicators

[0131] 1) Observation and counting under an inverted microscope: Observe the maturation rate of oocytes in three groups of IVM.

[0132] 2) Immunofluorescence staining experiment: FDP3-flag was added to the oocyte IVM culture medium. According to 3.2) in Example 2, the immunofluorescence staining experiment was performed after 24 hours to observe the cell entry and spindle morphology.

[0133] The experimental results are as follows:

[0134] 1) Effects of FDP3-flag on in vitro maturation of GV stage oocytes in older female mice

[0135] The effects of peptides on oocyte maturation were observed. The results showed that the MII maturation rate of oocytes supplemented with 20 μg / ml FDP3-flag in IVM culture medium was significantly increased compared to the blank control group (P < 0.01). Figure 5 As shown.

[0136] 2) Expression of FDP3-flag in oocytes

[0137] When FDP3-flag was added to oocyte IVM culture medium, immunofluorescence staining experiments performed 24 hours later showed that fluorescence was distributed in the cytoplasm and nucleus of the oocytes, indicating that FDP3-flag could successfully enter the cells and exert its function. Figure 6 As shown.

[0138] 3) Effects of FDP3-flag on oocyte spindle morphology

[0139] FDP3-flag at a concentration of 20 μg / ml was added to oocyte IVM culture medium. Oocytes were collected 24 hours later for immunofluorescence staining. The morphology of the oocyte spindle was observed using a laser confocal microscope. The results showed that the proportion of abnormal spindles in the FDP3-flag 20 μg / ml group was significantly lower than that in the blank control group. Figure 7 As shown.

[0140] Example 4: Preliminary Results of the Mechanism of Action of Peptides—Screening of FDP3-flag Interacting Proteins

[0141] The KGN cell line was used to screen for interacting proteins of FDP3-flag.

[0142] 1. Experimental Grouping

[0143] (1) FDP3-flag group: FDP3-flag at a concentration of 50 μg / ml was added to KGN cell culture medium and incubated for 24 h. After 24 h, the cells were digested, centrifuged to collect the cell pellet, and stored at -80℃ for later use.

[0144] (2) Blank control group: FDP3-flag at a concentration of 0 μg / ml was added to KGN cell culture medium and incubated for 24 h. After 24 h, the cells were digested, centrifuged to collect the cell pellet, and stored at -80℃ for later use.

[0145] 2. Experimental Methods

[0146] 1) Immunoprecipitation combined with mass spectrometry analysis method

[0147] FDP3-flag interacting proteins were identified in the blank control group and FDP3-flag-incubated KGN cells. First, proteins were extracted from the samples, quantified, and then a suitable amount was used for Co-IP experiments. The proteins enriched by Co-IP were digested with Trypsin, and the processed samples were analyzed by LC-MS / MS. Data were matched using MaxQuant (1.6.2.10) software, and interacting proteins were screened according to the screening criterion of Fold change (FDP3-flag group vs. blank control group) > 10.

[0148] 2) Co-IP Validation Analysis

[0149] Candidate interacting proteins of FDP3-flag identified by mass spectrometry were validated by Western blotting.

[0150] The experimental results are as follows:

[0151] 1) Protein identification results

[0152] A total of 2,569 proteins and 17,255 peptides were identified. Following the screening criterion of Fold change (FDP3-flag group vs. blank control group) > 10, 638 interacting proteins were identified.

[0153] 2) Screening of FDP3-flag interaction target proteins

[0154] Based on the screening criteria of Score > 20 and Fold change > 10, and after reviewing relevant literature, proteins closely related to oocyte development and aging function were selected as candidate interacting proteins. The target interacting proteins screened were: PLXNB2, ARHGAP1, NAP1L4, TWF1, ACTL6A, and RAB8A. See details below. Figure 8 .

[0155] 3) Validation of FDP3-flag interaction target protein

[0156] Candidate interacting proteins of FDP3-flag identified by mass spectrometry were validated by Western blotting. Figure 9 The results showed that the antibodies NAP1L4, TWF1, ARHGAP1, RAB8A, PLXNB2, and ACTL6A in the FDP3-flag experimental group all had obvious target bands, while no target bands were observed in the blank control group. This indicates that the proteins NAP1L4, TWF1, ARHGAP1, RAB8A, PLXNB2, and ACTL6A enriched by the immunoprecipitation experiment interact with FDP3-flag.

[0157] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0158] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. An isolated polypeptide, characterized in that, The amino acid sequence of the polypeptide is shown in SEQ ID NO:

1.

2. The polypeptide according to claim 1, characterized in that, One or more amino acids at the N-terminus and C-terminus of the polypeptide have modifying groups or tags.

3. The polypeptide according to claim 2, characterized in that, The modifying group is selected from membrane-penetrating peptide groups.

4. The polypeptide according to claim 3, characterized in that, The transmembrane peptide group is located at the N-terminus or C-terminus of the polypeptide.

5. The polypeptide according to claim 4, characterized in that, The amino acid sequence of the transmembrane peptide group is SEQ ID NO:

2.

6. The polypeptide according to claim 2, characterized in that, The label includes at least one selected from the Flag label, HA label, His label, Strep II label and Myc label.

7. The polypeptide according to claim 6, characterized in that, The label is the Flag label.

8. The polypeptide according to claim 7, characterized in that, The Flag tag modifies the N-terminus or C-terminus of the polypeptide.

9. The polypeptide according to claim 8, characterized in that, The Flag tag has an amino acid sequence as shown in SEQ ID NO:

3.

10. Use of the polypeptide according to any one of claims 1 to 9 in the preparation of a medicament for the treatment of female infertility.

11. The use of the reagent in the preparation of the kit, characterized in that, The reagent is used to detect the polypeptide according to any one of claims 1 to 9, and the kit is used to detect oocyte viability or female infertility. The reagent is a probe that binds to the polypeptide.

12. The use according to claim 11, characterized in that, The absence of the polypeptide is an indication of low oocyte viability or infertility or difficulty conceiving in the woman being examined.

13. A pharmaceutical composition, characterized in that, Includes the polypeptide described in any one of claims 1 to 9.

14. The pharmaceutical composition according to claim 13, characterized in that, The pharmaceutical composition is in the form of capsules, tablets, granules, powders, injections, or sprays.

15. Use of the pharmaceutical composition of claim 13 or 14 in the preparation of a medicament for the treatment of female infertility.

Images