An anti-human IgE nanobody and its preparation method and application

By using gene recombination technology to prepare high-affinity and highly specific anti-human IgE nanobodies, the problem of insufficient detection sensitivity of traditional mouse anti-human IgE monoclonal antibodies has been solved, realizing a high-efficiency, accurate and low-cost solution for allergen detection.

CN116120459BActive Publication Date: 2025-10-28SHANDONG DEDU BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310082470.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-08
Publication Date
2025-10-28
Estimated Expiration
2043-02-08

AI Technical Summary

Technical Problem

Traditional mouse anti-human IgE monoclonal antibodies have large molecular weights, resulting in insufficient sensitivity for allergen detection. They are also costly to produce and prone to false positive or false negative results.

Method used

To develop anti-human IgE nanobodies, gene recombination technology is used to express them in eukaryotic or prokaryotic cells. The nanobodies are then screened and purified using phage display technology and combined with chemical or biological markers to prepare nanobodies with high affinity and high specificity.

Benefits of technology

It improves the sensitivity and accuracy of allergen detection, reduces production costs, avoids false positive and false negative results, and is suitable for the development of allergen diagnostic kits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116120459B_ABST
    Figure CN116120459B_ABST
Patent Text Reader

Abstract

This invention discloses an anti-human IgE nanobody, its preparation method, and its application. The anti-human IgE nanobody is a single-domain antibody that can specifically bind to human IgE. It consists of only one structural domain and has advantages such as acid and alkali resistance, high temperature resistance, high specificity, small molecular weight, high affinity, and large-scale production capability. Moreover, it does not have the non-specific binding or contamination of heavy and light chains found in ordinary antibodies. It can be used for the detection, purification, and enrichment of human IgE, and has high detection accuracy and sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an anti-human IgE nanobody, as well as a method for preparing the nanobody and its application in allergen diagnosis, purification and enrichment of human IgE antibodies, belonging to the fields of single-domain antibody preparation (also known as nanobody preparation), genetically engineered antibody preparation, and in vitro diagnostic technology. Background Technology

[0002] Allergic diseases are one of the world's major health problems. It is estimated that about 30% to 40% of people worldwide suffer from or have suffered from various allergic diseases. Faster and more accurate diagnosis of allergic diseases is essential for their treatment.

[0003] Traditional detection methods typically use mouse anti-human IgE antibodies as the main raw material in the development of in vitro diagnostic kits for allergens. However, mouse anti-human IgE antibodies have a large molecular weight, which makes the binding efficiency of the marker and the allergen-specific IgE in the sample susceptible to steric hindrance.

[0004] To improve the sensitivity of detection systems, the industry commonly employs biotin labeling of allergens to increase their coating amount, or coating natural allergens with recombinant allergens with high sensitization rates simultaneously. These approaches not only increase production costs but also fail to fundamentally address the problem of insufficient allergen detection sensitivity. Furthermore, the research and development and production of monoclonal antibodies are extremely cumbersome and complex, resulting in poor antibody stability and high production costs. In contrast, nanobodies (Nbs) are single-domain antibodies (sdAbs) derived from the heavy chains of camel or shark immunoglobulins, with a molecular weight of approximately 15 kDa, representing the smallest antibody unit with complete antigen-binding capability. Compared to conventional antibodies, natural nanobodies possess unique properties such as high affinity, thermal stability, ease of production, and greater diversity. Their longer complementarity-determining region 3 (CDR3) enhances their ability to detect latent epitopes. Meanwhile, nanobodies lack the Fc segment found in traditional antibodies, directly avoiding false positives or false negatives caused by factors such as rheumatoid factor and heterophile reactions in samples during the development of in vitro diagnostic kits, thus improving detection accuracy. The small molecular weight and high affinity of nanobodies reduce steric hindrance in the reaction process, increasing reaction sensitivity. Therefore, nanobodies have broad application prospects in the field of in vitro diagnostics, especially in the in vitro diagnostics of allergens. Summary of the Invention

[0005] To address the shortcomings of existing mouse anti-human IgE monoclonal antibodies, this invention provides an anti-human IgE nanobody. This nanobody is a single-domain antibody that can specifically bind to human IgE. It has a small molecular weight, lacks the Fc segment found in traditional antibodies, and exhibits high specificity and affinity. When used for human IgE detection, it can avoid false positives or false negatives, and has high accuracy and sensitivity.

[0006] The specific technical solution of this invention is as follows:

[0007] This invention provides two anti-human IgE nanobodies (hereinafter referred to as nanobodies), wherein the nanobodies have the amino acid sequence shown in SEQ ID NO.1 or the amino acid sequence shown in SEQ ID NO.2.

[0008] Furthermore, the amino acid sequence of the anti-human IgE nanobody is divided into four framework regions (FRs) and three complementarity determining regions (CDRs).

[0009] Furthermore, the amino acid sequence provided by this invention can be used as a precursor and modified by random or site-directed mutagenesis techniques to obtain mutants with better properties (water solubility, stability, affinity, and specificity, etc.), which can specifically bind to human IgE.

[0010] The present invention also provides a nucleic acid molecule encoding the above-mentioned anti-human IgE nanobody, wherein the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.4.

[0011] The nucleotide sequences provided by this invention can be expressed using suitable expression systems to obtain anti-human IgE nanobodies. These expression systems include bacterial, fungal, animal cell, plant cell, insect cell, or cell-free expression systems.

[0012] This invention also provides a recombinant expression vector containing the aforementioned nucleic acid molecule. This recombinant expression vector is obtained by recombination of the expression vector and the nucleic acid molecule of this invention using commonly used gene recombination techniques. The expression vector used can be pET series, pGEX series, pPICZα-A, pPIC9, pPIC9K, pPIC3.5K, pMECS, etc.

[0013] This invention also provides a recombinant host cell containing the aforementioned recombinant expression vector. This recombinant host cell is obtained by transforming or transfecting the host cell with the recombinant expression vector. The transformation or transfection can be performed using methods commonly used in the art, such as chemical transformation or electrochemical transformation. The host cell can be selected from: BL21(DE3), Rosetta-gami(DE3), OrigamiB(DE3), Rosetta(DE3), Pichia pastoris, WK6, etc.

[0014] This invention also provides a method for preparing the above-mentioned anti-human IgE nanobody. The method involves culturing the recombinant host cells and obtaining the anti-human IgE nanobody through expression in the recombinant host cells. This preparation method is simple to operate, suitable for large-scale industrial production, and has low cost.

[0015] In a specific embodiment of the present invention, a method for preparing anti-human IgE nanobodies is provided, comprising the following steps: transforming a recombinant expression vector into host cells such as BL21 to obtain recombinant host cells; scaling up the recombinant host cells in a medium containing ampicillin at a temperature of approximately 37°C; when the bacterial OD reaches approximately 0.6, adding the inducer IPTG to induce nanobodies expression, and culturing at approximately 28°C for 48 hours; collecting the bacterial cells by high-speed centrifugation, cleaving the cells to precipitate the nanobodies, purifying the nanobodies to obtain anti-human IgE nanobodies. The cell cleavage can be performed using methods commonly used in the prior art, such as ultrasonic disruption or osmotic pressure disruption.

[0016] This invention also provides a chemically or biologically labeled anti-human IgE nanobody, formed by chemically or biologically labeling the aforementioned anti-human IgE nanobody. The chemical labeling can be isotope labeling, immunotoxin labeling, chemical drug labeling, etc., and the biological labeling can be biotin labeling, avidin labeling, enzyme labeling, etc. The isotopes can be 2H (deuterium), 15N, 13C, or 15N and 13C, etc.; the immunotoxins can be bacterial toxins, plant toxins, human protein toxins, dual-warhead or hybrid warhead toxins, etc.; and the chemical drugs can be acridinium ester (AE), luminol, fluorescein isothiocyanate (FITC), etc. The chemical or biological labeling methods can be based on those reported in the prior art, which is not difficult for those skilled in the art.

[0017] In a specific embodiment of the present invention, an anti-human IgE nanobody labeled with acridine ester (AE) is provided. This acridine ester (AE)-labeled anti-human IgE nanobody can be prepared by the following steps:

[0018] 1. Dilute the anti-human IgE nanobody (hereinafter referred to as nanobody) with 0.02M PB buffer at pH 7.5 to a final concentration of 1.0 mg / ml, then add 10 times the molar amount of acridine ester (AE) of the nanobody, mix thoroughly, and let it stand at room temperature in the dark for 30 min.

[0019] 2. After the reaction, add one-tenth of the volume of 0.1M Tris buffer to the reaction solution in step 1, mix thoroughly, and let stand at room temperature in the dark for 30 minutes to obtain the labeled product - acridine ester (AE) labeled anti-human IgE nanobody.

[0020] 3. After the reaction, aspirate all the labeled product into a dialysis bag and dialyze it at 2-8℃ using 0.02M PB buffer (pH 7.0) for 48 hours. Dilute the labeled antibody to 0.1ug / ml with a reconstitution solution (20mM Tris, 1% casein, 0.1% Triton X-100, 0.1% ProClin-300, pH 7.0) to obtain the acridinium ester-labeled anti-human IgE nanobody solution, and store it at 2-8℃ for later use.

[0021] This invention also provides conjugates prepared by coupling the aforementioned anti-human IgE nanobodies with a solid or semi-solid medium, or conjugates prepared by coupling chemically or biologically labeled anti-human IgE nanobodies with a solid or semi-solid medium. The solid medium may be magnetic nanobeads, fluorescent microspheres, colloidal gold, etc., and the semi-solid medium may be agarose gel microspheres, etc. Specific coupling methods can be performed according to existing technology reports.

[0022] In a specific embodiment of the present invention, an anti-human IgE nanobody coupled with magnetic nanobeads is provided. The magnetic nanobeads serve as a carrier, preferably being modified with toluenesulfonyl (-Tosyl) groups. This anti-human IgE nanobody coupled with magnetic nanobeads can be prepared using the following steps:

[0023] 1. Disperse the magnetic nanobeads by ultrasonication and wash them three times with BB-labeled buffer at pH 9.5 and 100mM. Then, calibrate the magnetic nanobeads to a final concentration of 20mg / ml.

[0024] 2. Add anti-human IgE nanobody at a ratio of 30ug antibody per milligram of magnetic nanobeads, and react for 10 minutes;

[0025] 3. Add coupling enhancer (NH4)2SO4 to a final concentration of 1.0M and react overnight;

[0026] 4. Wash the nano-magnetic beads three times, add the blocking agent BSA to a final concentration of 1 wt%, and react overnight;

[0027] 5. Wash the magnetic nanobeads three times, then resuspend them in magnetic bead dilution buffer (50mM Tris, 0.9wt% NaCl, 1wt% bovine serum albumin, 0.1wt% Triton X-100, 0.1wt% ProClin-300 pH 8.0) to a final concentration of 0.4mg / mL. This yields the magnetic nanobead-conjugated anti-human IgE nanobody solution, which should be stored at 2-8℃ for later use.

[0028] This invention also provides the application of the above-mentioned anti-human IgE nanobody and the above-mentioned conjugate in the preparation of products for detecting human IgE antibodies, purifying human IgE antibodies, and enriching human IgE antibodies.

[0029] The present invention also provides a human IgE antibody detection kit, which includes the above-mentioned anti-human IgE nanobody or the above-mentioned conjugate.

[0030] The advantages and positive effects of this invention are as follows:

[0031] 1. The nanobody of the present invention is a single-domain antibody that can specifically bind to human IgE and can be used for the detection, enrichment and purification of human IgE, such as for the preparation of reagents and tools for the detection and purification of human IgE.

[0032] 2. This invention provides the gene sequence of the nanobody, which can be efficiently expressed in eukaryotic and prokaryotic host cells through gene recombination technology. The preparation process of the nanobody is simple, low-cost, and high-yield, and has the prospect of industrial production.

[0033] 3. The nanobody of the present invention consists of only one structural domain and has the advantages of acid and alkali resistance, high temperature resistance, high specificity, small molecular weight, high affinity and large-scale production. Moreover, it does not have the non-specific binding or contamination of heavy and light chains of ordinary antibodies.

[0034] 4. The nanobody of this invention can be applied in the development of allergen diagnostic kits. Lacking the Fc segment found in traditional antibodies, it directly avoids false positives or false negatives caused by factors such as rheumatoid factor and heterophile reactions in the sample, thus improving detection accuracy. The small molecular weight and high affinity of the nanobody of this invention reduce steric hindrance in the reaction process, improving reaction sensitivity. It eliminates the need for a streptomycin-biotin amplification system in kit development, saving costs and reducing contamination. Attached Figure Description

[0035] Figure 1 This is an electrophoresis diagram of the VHH gene in Example 1; where lane 1 is the DNA molecule standard and lane 2 is the VHH fragment obtained by PCR amplification.

[0036] Figure 2This is a schematic diagram of screening specific single positive clones using phage enzyme-linked immunosorbent assay (ELISA); where 1 is an ELISA plate coated with human IgE, 2 is an anti-human IgE nanobody, 3 is a mouse anti-HA antibody, 4 is a goat anti-mouse alkaline phosphatase labeled antibody, and 5 is an alkaline phosphatase chromogenic solution.

[0037] Figure 3 This is a flowchart of the detection of total IgE allergens using anti-human IgE nanobodies in Example 7.

[0038] Figure 4 This is a flowchart of the detection of specific IgE allergens using anti-human IgE nanobodies in Example 8. Detailed Implementation

[0039] The technical solution of the present invention will be described in detail below through embodiments. It should be noted that these embodiments are descriptive and not limiting, and cannot be used to limit the scope of protection of the present invention.

[0040] Unless otherwise specified, the raw materials used in this invention are all conventional commercially available products; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0041] This invention first immunizes a Bactrian camel in Xinjiang with human IgE. After four immunizations, peripheral blood lymphocytes are extracted from the camel, and a nanobody library targeting human IgE is constructed. The human IgE antibody is conjugated onto an ELISA plate to display the correct spatial structure of the protein, thus exposing the antigenic epitopes of the human IgE antibody. Phage display technology is then used to screen a nanobody gene library (camel heavy chain antibody phage display gene library) that exhibits human IgE antibody immunogenicity, ultimately obtaining nanobody strains that can be efficiently expressed in host cells.

[0042] The present invention will be further described below with reference to specific embodiments.

[0043] Example 1: Construction of a nanobody library (VHH) targeting human IgE:

[0044] (1) The concentration of human IgE (purchased from Holmes) was 500 micrograms per milliliter. For each immunization, 1 mg of human IgE was mixed with an equal volume of Freund's adjuvant (purchased from Sigma). A healthy Bactrian camel from Xinjiang was immunized once a week for a total of 4 immunizations. Except for the first immunization which used complete Freund's adjuvant, all the remaining immunizations used incomplete Freund's adjuvant. During the immunization process, B cells were stimulated to express antigen-specific nanobodies.

[0045] (2) After four immunizations, 100 ml of camel peripheral blood lymphocytes were extracted and total RNA was extracted using the RNA extraction kit provided by QIAGEN. The extracted RNA was reverse transcribed into cDNA according to the instructions of the Super-Script III FIRST STRANDSUPERMIX kit.

[0046] (3) The VHH fragment was obtained by two-step PCR amplification.

[0047] First round of PCR:

[0048] Using cDNA as a template

[0049] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC

[0050] Downstream primer: GGTACGTGCTGTTGAACTGTTCC

[0051] The first round of PCR amplification was to amplify the fragment between the heavy chain antibody-guided peptide and antibody CH2. The PCR program was: annealing at 54°C for 25 cycles.

[0052] Second round of PCR:

[0053] Using the first-round PCR product as a template,

[0054] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG

[0055] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

[0056] The second round of amplification yielded the VHH fragment. The PCR program was: annealing at 60℃ for 17 cycles, followed by fragment recovery. The results are as follows: Figure 1 The DNA bands shown from left to right are: the first is the DNA molecular marker, and the second is the VHH electrophoresis band, which is approximately 500 bp.

[0057] (4) Digest 20 μg of pMECS phage display vector and 10 μg of the above-obtained heavy chain antibody variable region gene (VHH fragment) with restriction endonucleases (purchased from NEB) PstI and NotI, and ligate the two fragments with T4 DNA ligase (purchased from TaKaRa).

[0058] (5) The ligation product was electroporated into electrocompetent TG1 cells to construct a phage display library of nanobodies targeting human IgE. The library size was calculated by plate counting, and the size was 1.8 * 10⁻⁶. 9Meanwhile, the insertion rate of the constructed library was detected by colony PCR, and the insertion rate was approximately 100%.

[0059] Example 2: Screening process for anti-human IgE nanobodies:

[0060] (1) Dissolve human IgE in pH 8.2, 100mM NaHCO3 solution to a final concentration of 1-50ug / ml; take 100μL and couple it onto an ELISA plate, place it at 4℃ overnight, and set up a blank control at the same time.

[0061] (2) On the second day, 100 μL of 0.1 wt% casein was added to each of the two wells and sealed at room temperature for 2 hours.

[0062] (3) After 2 hours, add 8*10 11 TFU phage (from the phage display library of nanobody against human IgE in Example 1) was incubated at room temperature for 1 hour.

[0063] (4) Wash five times with PBST (PBS contains 0.05 wt% Tween 20) to remove unbound phages.

[0064] (5) The phages that specifically bind to human IgE are dissociated using triethylamine (100mM) and then used to infect E. coli TG1 in the logarithmic growth phase. The resulting phages are purified for the next round of screening. This screening process is repeated 3-4 times. During the continuous screening process, positive clones are continuously enriched, thus achieving the goal of using phage display technology to screen for human IgE-specific antibodies in the antibody library.

[0065] In this embodiment, in order to obtain anti-human IgE nanobodies with high affinity and strong specificity, a conditional gradient screening method was used in the screening process. That is, the human IgE coating concentration of the enzyme-labeled plate in the first round of screening was 50 ug / ml, the human IgE coating concentration of the enzyme-labeled plate in the second round of screening was 25 ug / ml, the human IgE coating concentration of the enzyme-labeled plate in the third round of screening was 5 ug / ml, and the human IgE coating concentration of the enzyme-labeled plate in the fourth round of screening was 1 ug / ml.

[0066] In this embodiment, in order to eliminate the interference of human IgG and IgM, the phage to be screened is first mixed with human IgG and IgM for 1 hour during the screening process, and then the operation of step (3) is performed.

[0067] Example 3: Screening for specific single positive clones using phage enzyme-linked immunosorbent assay (ELISA):

[0068] The principle of screening for specific single positive clones using phage enzyme-linked immunosorbent assay (ELISA) is illustrated in the diagram below. Figure 2 As shown. The steps are as follows:

[0069] (1) From the cell culture dishes containing bacteriophages screened in Example 2 above, 96 single colonies were selected and inoculated into TB medium containing 100 micrograms per milliliter of ampicillin (1 liter of TB medium contains 2.3 g of potassium dihydrogen phosphate, 12.52 g of dipotassium hydrogen phosphate, 12 g of peptone, 24 g of yeast extract, and 4 ml of glycerol). After growing to the logarithmic phase, IPTG was added to a final concentration of 1 mmol and cultured overnight at 28°C.

[0070] (2) Obtain crude antibody by permeation method and transfer the antibody to ELISA plate coated with human IgE and place it at room temperature for 1 hour.

[0071] (3) Wash away unbound antibodies with PBST, add mouse anti-HAtag antibody (purchased from Roche), and incubate at room temperature for 1 hour.

[0072] (4) Wash away unbound antibodies with PBST, add anti-mouse alkaline phosphatase conjugate (goat anti-mouse alkaline phosphatase labeled antibody, purchased from Sigma), and incubate at room temperature for 1 hour.

[0073] (5) Wash away unbound antibodies with PBST, add alkaline phosphatase colorimetric solution, and read the absorbance value at 405 nm wavelength on an ELISA instrument.

[0074] (6) When the OD value of the sample well is more than 3 times greater than the OD value of the control well, it is judged as a positive clone well.

[0075] (7) The bacteria in the positive clone wells were swirled in LB liquid containing 100 micrograms per milliliter to extract plasmids and perform sequencing.

[0076] The gene sequences of each clone were analyzed using the sequence alignment software Vector NTI. Clones with identical CDR1, CDR2, and CDR3 sequences were considered the same clone, while clones with different sequences were considered different clones. Ultimately, two nanobodies were obtained, which are the anti-human IgE nanobodies of this invention. One anti-human IgE nanobodies is designated as Anti-human IgE Nanobodies 1, with its amino acid sequence shown in SEQ ID No. 1 and its nucleic acid sequence shown in SEQ ID No. 3; the other anti-human IgE nanobodies are designated as Anti-human IgE Nanobodies 2, with its amino acid sequence shown in SEQ ID No. 2 and its nucleic acid sequence shown in SEQ ID No. 4.

[0077] Example 4: Expression and purification of nanobodies in host bacterium Escherichia coli:

[0078] (1) The two anti-human IgE nanobodies obtained from the sequencing analysis in Example 3 above were cloned into the expression vector PET-32a, and the recombinant plasmids that were correctly identified by sequencing were transformed into the expression host bacterium BL21. BL21 was inoculated into 100 mL of LB medium containing 100 μg / mL ampicillin and cultured overnight at 37°C with shaking. When the OD value reached 0.6-1, IPTG was added and cultured at 28°C with shaking for 48 h. The OD of the bacterial culture after overnight culture should be 20-30.

[0079] (4) Centrifuge to collect bacterial cells, set to Beckman JA-10 8000rpm 4℃ 15min.

[0080] (5) The nanobody was initially purified by high-pressure osmosis, and the steps were as follows:

[0081] 5.1) Prepare hypertonic solution TS (200g sucrose, 400ml 1M Tris-HCl pH8.0, 10ml 100mM EDTA, diluted to 1L);

[0082] 5.2) Add 1 ml TS to the bacterial cells collected from every 100 ml of bacterial culture, mix well by pipetting, and incubate at 4°C for 2 hours.

[0083] 5.3) After 2 hours, use 1 / 4 TS (one volume of TS plus three volumes of water) to perform an osmotic shock on the bacterial cells: add 2 ml of 1 / 4 TS to the bacterial cells collected from every 100 ml of bacterial solution, mix at 4°C for 2-3 hours.

[0084] 5.4) After 2-3 hours, add 100 μL of 2M MgCl2;

[0085] 5.5) Obtain the supernatant by high-speed centrifugation, set to Beckman JA-25.50 8000rpm 4℃ 30min.

[0086] Note that the protein is already in the supernatant, not in the precipitate.

[0087] The nanobody protein obtained by the initial purification of the nanobody using high pressure osmosis in this step has a purity of over 70%. Compared with the traditional cell disruption method, this method avoids the large-scale release of E. coli intrinsic proteins and effectively reduces the interference of impurity proteins in subsequent affinity purification.

[0088] (6) The antibody protein was further purified by nickel column ion affinity chromatography. To obtain high-purity antibodies, an imidazole gradient elution method was used. Low-concentration imidazole elution buffer (50 mmol, 100 mmol) was used to wash away impurities, and high-concentration imidazole elution buffer (250 mmol, 500 mmol) was used to elute the protein. Finally, antibody protein with a purity of more than 90% can be prepared, namely anti-human IgE nanobodies.

[0089] Example 5: Preparation of anti-human IgE nanobodies coupled with magnetic nanobeads

[0090] Using toluenesulfonyl (-Tosyl) modified magnetic nanobeads as a carrier, anti-human IgE nanobody 1 or anti-human IgE nanobody 2 prepared by the method in Example 4 above were coupled to obtain anti-human IgE nanobody conjugated with magnetic nanobeads. The specific preparation method is as follows:

[0091] Tosyl-modified (-Tosyl) nanobeads were ultrasonically dispersed and washed three times with labeling buffer (100 mM BB, pH 9.5), and the nanobeads were calibrated to a final concentration of 20 mg / ml.

[0092] Add anti-human IgE nanobody 1 or anti-human IgE nanobody 2 at a ratio of 30ug nanobody per milligram of magnetic nanobeads, and react for 10 minutes.

[0093] Add coupling enhancer (NH4)2SO4 to a final concentration of 1.0 M and react overnight;

[0094] The coupled magnetic beads were washed three times, and the blocking agent BSA was added to a final concentration of 1 wt%, and the reaction was carried out overnight.

[0095] The magnetic beads were washed three times to obtain anti-human IgE nanobodies conjugated with magnetic beads. The anti-human IgE nanobodies conjugated with magnetic beads were resuspended in magnetic bead dilution buffer (50 mM Tris, 0.9 wt% NaCl, 1 wt% bovine serum albumin, 0.1 wt% Triton X-100, 0.1 wt% ProClin-300, pH 8.0) to a final concentration of 0.4 mg / mL. The nanobodies were stored at 2-8 °C for later use.

[0096] Example 6: Preparation of acridine ester (AE) labeled anti-human IgE nanobodies

[0097] The anti-human IgE nanobody (i.e., the anti-human IgE nanobody 1 or anti-human IgE nanobody 2 prepared by the method in Example 4 above) was dialyzed into 0.02M PB buffer to a final concentration of 1.0 mg / ml.

[0098] Add 10 molar amounts of acridine ester (AE) to the above buffer solution, mix thoroughly, and allow to react at room temperature in the dark for 30 min.

[0099] After 30 minutes, add one-tenth of the volume of 0.1M Tris buffer to the above solution, mix thoroughly, and let it stand at room temperature in the dark for 30 minutes.

[0100] After 30 minutes, all the acridine ester (AE)-labeled anti-human IgE nanobodies were aspirated into a dialysis bag and dialyzed at 2-8°C using 0.02 MPB buffer. The dialysate volume was approximately 1-5 L, and the medium was changed every 4 hours for a total of 3 changes. The acridine ester (AE)-labeled anti-human IgE nanobodies were then diluted to 0.1 μg / ml using reconstitution solution (20 mM Tris, 1 wt% casein, 0.1 wt% Triton X-100, 0.1 wt% ProClin-300, pH 7.0) and stored at 2-8°C for later use.

[0101] Example 7: Total IgE Allergen Detection Kit Based on Anti-Human IgE Nanobodies

[0102] The anti-human IgE nanobody conjugated with magnetic beads obtained in Example 5 and the acridinium ester (AE)-labeled human IgE nanobody obtained in Example 6 can be used to prepare a total IgE allergen detection kit. The kit contains anti-human IgE nanobody 1 conjugated with magnetic beads and acridinium ester (AE)-labeled human IgE nanobody 2, or contains anti-human IgE nanobody 2 conjugated with magnetic beads and acridinium ester (AE)-labeled human IgE nanobody 1.

[0103] Taking the anti-human IgE nanobody 1 conjugated with magnetic beads prepared in Example 5 and the acridinium ester (AE)-labeled human IgE nanobody 2 prepared in Example 6 as examples, the total IgE antibody concentration of the test samples was detected on a chemiluminescence analyzer (Shenzhen Yingkai Biotechnology Co., Ltd. Shinei2910 fully automated chemiluminescence immunoassay analyzer). The detection procedure is as follows: Figure 3 As shown. The reaction principle of total IgE detection based on anti-human IgE nanobodies (magnetic particle chemiluminescence method) is as follows: the sample to be tested, anti-human IgE nanobodies coupled with magnetic beads, and acridine ester (AE) labeled anti-human IgE nanobodies react. After the reaction, magnetic separation and washing are performed to remove unbound portions. Then, a luminescent substrate solution is added to induce a rapid chemiluminescence reaction. The chemiluminescence intensity is detected by a detection instrument, and the total IgE antibody content in the sample is directly proportional to the chemiluminescence intensity. This detection method uses a double-antibody sandwich method, and the specific steps are as follows:

[0104] S1. Preparation of calibrators

[0105] IgE was taken and prepared into calibrators with concentrations of 2 IU / mL, 20 IU / mL, 100 IU / mL, 500 IU / mL, 1000 IU / mL, and 5000 IU / mL using quality control diluent (KH2PO4 2mM, Na2HPO4 8mM, NaCl 136mM, KCl 2.6mM).

[0106] S2. Sample to be tested: plasma or serum.

[0107] S3. Take a reaction tube and add 10 μL of calibrator, 10 μL of quality control material, and 10 μL of test sample to each reaction tube. Then add 40 μL of anti-human IgE nanobody 1 (Example 5) coupled with magnetic beads and 20 μL of anti-human IgE nanobody 2 (Example 6) labeled with acridinium ester (AE) to each reaction tube. Stir and mix well and react at 37°C for 15 minutes.

[0108] S4. After the reaction is complete, perform magnetic separation, discard the supernatant, add 500μL of washing solution, stir and mix well, perform magnetic separation again, and discard the supernatant again.

[0109] S5. Repeat the cleaning steps of S4 for a total of three times;

[0110] S6. Then add 100 μL of excitation solution A and excitation solution B to the reaction tube respectively, stir and mix well, and place the reaction tube on the photoelectric disk to read the value and measure the luminescence value.

[0111] S7. Using calibrators, fit the standard curve through a four-parameter mode. The operating software of the fully automated chemiluminescence immunoassay analyzer inputs the luminescence value into the four-parameter formula to calculate the concentration of total IgE antibody in the sample to be tested.

[0112] Endogenous, inert antibodies and rheumatoid factor in patient serum / plasma can bind to immunoglobulins from other species, including heterologous antibodies used as immunoassay reagents. These antibodies can interfere with the immunoassay system, resulting in falsely high detection values ​​unrelated to the actual analyte concentration, potentially leading to misdiagnosis. This interference may be mediated by the Fc fragment of the detection antibody used. To verify the anti-interference capability of the anti-human IgE nanobody of this invention, two types of interfering samples were used to test the anti-interference capabilities of the conventional detection system and the anti-human IgE nanobody detection system of this invention, respectively. The steps are as follows:

[0113] 1. Interference Sample Preparation: Goat anti-mouse IgG (purchased from Shenzhen Feipeng) was used to prepare interference samples 1 with concentrations of 100 μg / mL, 500 μg / mL, 1000 μg / mL, and 5000 μg / mL using quality control diluent (KH2PO4 2mM, Na2HPO4 8mM, NaCl 136mM, KCl 2.6mM). Rheumatoid factor (RF) (purchased from Shenzhen Feipeng) was used to prepare interference samples 2 with concentrations of 100 IU / mL, 200 IU / mL, 500 IU / mL, and 1000 IU / mL using quality control diluent (KH2PO4 2mM, Na2HPO4 8mM, NaCl 136mM, KCl 2.6mM).

[0114] 2. The total IgE allergen detection reagent prepared using mouse anti-human IgE monoclonal antibody is used as the traditional detection system. The nanobody in Example 5 is replaced with mouse anti-human IgE monoclonal antibody 1 (purchased from Wuhan Aoke), and the nanobody in Example 6 is replaced with mouse anti-human IgE monoclonal antibody 2 (purchased from Wuhan Aoke). These two mouse anti-human IgE monoclonal antibodies replace the two anti-human IgE nanobodies in Example 7 of this invention, forming the traditional detection system. The total IgE allergen detection system prepared using the anti-human IgE nanobody 1 conjugated with magnetic beads obtained in Example 5 of this invention and the acrid ester (AE)-labeled human IgE nanobody 2 obtained in Example 6 is the anti-human IgE nanobody detection system of this invention.

[0115] 3. Testing steps: Refer to... Figure 3 The procedure described above involves using different interfering samples as test samples and following steps S1-S7 as described above. The anti-human IgE nanobody 1 conjugated with magnetic beads obtained in Example 5 of this invention and the anti-human IgE nanobody 2 labeled with acrididine ester (AE) obtained in Example 6 are used for detection. Simultaneously, the anti-human IgE nanobody 1 conjugated with magnetic beads and the anti-human IgE nanobody 2 labeled with acrididine ester (AE) of this invention are replaced with mouse anti-human IgE monoclonal antibody 1 conjugated with magnetic beads and mouse anti-human IgE monoclonal antibody 2 labeled with acrididine ester (AE), respectively, and the same steps are used to detect the interfering samples.

[0116] The detection results of the traditional detection system and the system of this invention are shown in Table 1 below:

[0117] Table 1

[0118]

[0119]

[0120] The results above show that when the concentration of interfering samples is low, the detection results obtained using the traditional detection system are relatively accurate, with no obvious false positives. However, as the concentration of interfering samples increases, the false positive rate increases, significantly affecting the accuracy of the detection results. In contrast, the anti-human IgE nanobody detection system of this invention does not interfere with the detection even in the presence of high concentrations of interfering samples, exhibiting no false positives and demonstrating strong anti-interference capabilities, thus providing more accurate diagnostic results for clinical use.

[0121] Example 8: Specific IgE Allergen Detection Kit Based on Anti-Human IgE Antibody Nanobodies

[0122] The anti-human IgE nanobody conjugated with magnetic beads obtained in Example 5 and the acridine ester (AE)-labeled human IgE nanobody obtained in Example 6 can also be used to prepare a specific IgE allergen detection kit. The kit contains allergen antigen 2 conjugated with magnetic beads, and also contains acridine ester (AE)-labeled human IgE nanobody 1 or acridine ester (AE)-labeled human IgE nanobody 2.

[0123] Taking house dust mite allergens as an example, the method for detecting house dust mite-specific IgE using the anti-human IgE antibody nanobody of this invention is as follows: The nanobody in Example 5 is replaced with a house dust mite allergen (purchased from Greer), and the house dust mite allergen conjugated with magnetic beads is prepared according to the same procedure as in Example 5. (Refer to...) Figure 4 The procedure described above utilizes magnetic beads conjugated with house dust mite allergens and acridine ester (AE)-labeled anti-human IgE nanobodies to detect the content of house dust mite-specific IgE antibodies in test samples using a chemiluminescence analyzer (Shenzhen Yingkai Biotechnology Co., Ltd.'s Shine i2910 fully automated chemiluminescence immunoassay analyzer). The reaction principle of the anti-human IgE nanobodies-based detection of house dust mite-specific IgE antibodies (magnetic particle chemiluminescence method) is as follows: the test sample, house dust mite allergen conjugated with magnetic beads, and acridine ester (AE)-labeled anti-human IgE nanobodies are reacted. After the reaction, magnetic separation and washing are performed to remove unbound portions. Then, a luminescent substrate solution is added to induce a rapid chemiluminescence reaction. The intensity of the chemiluminescence is detected by the instrument, and the content of allergen-specific IgE antibodies in the test sample is directly proportional to the chemiluminescence intensity. This detection method uses an indirect method, and the specific detection steps are as follows:

[0124] S1. Preparation of calibrators

[0125] House dust mite-specific IgE (purchased from the National Institutes for Food and Drug Control) was used to prepare calibrators with concentrations of 0 IU / mL, 0.35 IU / mL, 3.5 IU / mL, 17.5 IU / mL, 50 IU / mL, and 100 IU / mL using quality control dilution buffer (KH2PO4 2mM, Na2HPO4 8mM, NaCl 136mM, KCl 2.6mM).

[0126] S2. Take a reaction tube, add 10 μL of calibrator and 10 μL of test sample to each reaction tube, and add 40 μL of house dust mite allergen conjugated with magnetic nanobeads and 20 μL of acridine ester (AE) labeled anti-human IgE nanobody 1 or acridine ester (AE) labeled anti-human IgE nanobody 2 (Example 6) to each reaction tube. Stir and mix well, and react at 37°C for 15 minutes.

[0127] S3. After the reaction is complete, perform magnetic separation, discard the supernatant, add 500μL of washing solution, stir and mix well, perform magnetic separation again, and discard the supernatant again.

[0128] S4. Repeat the cleaning steps in S3 for a total of three times;

[0129] S6. Then add 100 μL of excitation solution A and excitation solution B to the reaction tube respectively, stir and mix well, and place the reaction tube on the photoelectric disk to read the value and measure the luminescence value.

[0130] S7. Using calibrators, the standard curve is fitted through a four-parameter mode. The operating software of the fully automated chemiluminescence immunoassay analyzer inputs the luminescence value into the four-parameter formula to calculate the concentration of house dust mite-specific IgE antibody in the sample to be tested.

[0131] Taking house dust mite allergy as an example, this study evaluates the limits of detection of the traditional detection system and the anti-human IgE nanobody detection system of this invention, and then compares the sensitivity of the two detection systems. The specific method is as follows:

[0132] 1. House dust mite-specific IgE (purchased from the China National Institutes for Food and Drug Control) was collected and serially diluted using quality control diluents (KH₂PO₄ 2mM, Na₂HPO₄ 8mM, NaCl 136mM, KCl 2.6mM) to prepare sample solutions with concentrations of 2 IU / ml, 1 IU / ml, 0.5 IU / ml, 0.25 IU / ml, 0.125 IU / ml, 0.063 IU / ml, 0.031 IU / ml, 0.016 IU / ml, 0.008 IU / ml, and 0.004 IU / ml.

[0133] 2. The detection system of this invention uses house dust mite allergens conjugated with magnetic nanobeads and acridine ester (AE)-labeled anti-human IgE nanobodies 2. The conventional detection system uses a house dust mite-specific IgE allergen detection reagent prepared based on mouse anti-human IgE monoclonal antibodies. The conventional detection system is formed by replacing the acridine ester (AE)-labeled anti-human IgE nanobodies 2 of this invention with acridine ester (AE)-labeled mouse anti-human IgE monoclonal antibody 2 (purchased from Wuhan Aoke).

[0134] 3. Testing steps: Refer to... Figure 4 The procedure described in S1-S7 involves detecting the concentration of house dust mite-specific IgE at different concentrations using a chemiluminescence analyzer (Shenzhen Yingkai Biotechnology Co., Ltd.'s Shine i2910 fully automated chemiluminescence immunoassay analyzer). Simultaneously, the acridine ester (AE)-labeled anti-human IgE nanobody 2 of this invention is replaced with acridine ester (AE)-labeled mouse anti-human IgE monoclonal antibody 2, and the same procedure is used to detect house dust mite-specific IgE.

[0135] The detection results of the traditional detection system and the detection system of the present invention are shown in Table 2 below:

[0136] Table 2

[0137]

[0138] As can be seen from the results in the table above, the limit of detection (LOD) for detecting house dust mite allergens using the traditional detection system is 0.063 IU / mL, while the limit of detection (LOD) for detecting house dust mite allergens using the detection system of the present invention is 0.008 IU / mL. This shows that the anti-human IgE nanobody of the present invention can significantly improve the detection sensitivity compared with traditional antibodies.

[0139] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. An anti-human IgE nanobody, characterized in that: The anti-human IgE nanobody has the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The nucleic acid molecule encoding the anti-human IgE nanobody of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.3, and the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.

4.

4. A recombinant expression vector, characterized in that: It includes the nucleic acid molecule as described in claim 2 or 3.

5. A recombinant host cell, characterized by: It includes the recombinant expression vector as described in claim 4.

6. A method for preparing the anti-human IgE nanobody according to claim 1, characterized in that: The recombinant host cells described in claim 5 are cultured, and anti-human IgE nanobodies are obtained through expression in the recombinant host cells.

7. A chemically or biologically labeled anti-human IgE nanobody according to claim 1, characterized in that: The biomarker is a biotin label, an avidin label, or an enzyme label.

8. The conjugate prepared by coupling the anti-human IgE nanobody of claim 1 with a solid or semi-solid medium, wherein the solid medium is magnetic nanobeads, fluorescent microspheres or colloidal gold, and the semi-solid medium is agarose gel microspheres.

9. The conjugate prepared by coupling the chemically or biologically labeled anti-human IgE nanobody of claim 7 with a solid or semi-solid medium, wherein the solid medium is magnetic nanobeads, fluorescent microspheres or colloidal gold, and the semi-solid medium is agarose gel microspheres.

10. The use of the anti-human IgE nanobody of claim 1, the chemically labeled or biologically labeled anti-human IgE nanobody of claim 7, or the conjugate of claim 8 or 9 in the preparation of products for detecting human IgE antibodies, purifying human IgE antibodies, and enriching human IgE antibodies.

11. A human IgE antibody detection kit, characterized in that: This includes the anti-human IgE nanobody of claim 1, the chemically or biologically labeled anti-human IgE nanobody of claim 7, or the conjugate of claim 8 or 9.

Citation Information

Patent Citations

  • Kit and method for detecting dermatophagoides pteronyssinus allergen specificity IgE antibody

    CN105403692A

  • Allergen specificity IgE antibody detection kit and preparation method thereof

    CN115541891A