Influenza virus backbone

Abstract

The present invention provides an influenza virus that exhibits enhanced growth in Vero cells. The influenza virus includes PA, NP, and NS gene segments having selected nucleotides and encoding proteins having amino acid sequences with selected amino acids. The present invention also provides a pharmaceutical preparation containing the influenza virus, and a method of eliciting an immune response in a mammal by administering the influenza virus to the mammal, and a method of producing the influenza virus.

Description

[0001] Cross-references to related applications

[0002] This patent application claims the benefit of U.S. Provisional Patent Application 63 / 054,676, filed July 21, 2020, which is incorporated herein by reference in its entirety.

[0003] Statement regarding federally sponsored research or development

[0004] This invention was carried out with government support from the National Institutes of Health, under license number AI109925. The government holds certain rights to this invention.

[0005] Incorporating electronic materials by reference

[0006] The computer-readable nucleotide / amino acid sequence list submitted concurrently with this document and identified as follows: a 46,917-byte ASCII (text) file named “755023SequenceListing.txt”, created on July 20, 2021, is incorporated herein by reference in its entirety. Background of the Invention

[0008] Influenza, or "flu," is a highly contagious viral infection that claims the lives of hundreds of thousands of people worldwide each year. Based on the classification of the core proteins of the influenza virus, there are four types of influenza viruses (namely, A, B, C, and D), although seasonal epidemics are most commonly caused by circulating influenza A and B viruses.

[0009] Although vaccines are the best way to prevent influenza, they must be frequently reformulated because the influenza virus is prone to antigenic drift and antigenic shift. Furthermore, because influenza viruses typically exhibit high mutation and evolution rates, vaccine strains may not match circulating strains, resulting in minimal vaccine efficacy. However, when the circulating influenza virus matches the influenza vaccine well, vaccination can reduce the risk of influenza-related illness in the general population by 40%–60%. Therefore, researchers have been investigating vaccines that can induce cross-protective immunity across different influenza subtypes. One such example is a vaccine containing a live attenuated influenza virus that does not express the functional M2 protein (e.g., the M2SR vaccine for influenza A).

[0010] Influenza vaccines are preferably propagated in Madin-Darby canine kidney (MDCK) cells and African green monkey (Vero) cells because mammalian cell cultures offer advantages over egg-based production. These advantages include lower cost, faster production time, and a reduced risk of antigenic mutations in the virus. For example, M2SR vaccines are propagated in Vero cells that stably express the M2 protein. However, vaccine production in cell cultures often results in poor yields. Furthermore, MDCK cells are generally more accommodative than Vero cells, making vaccine production in Vero cells relatively less efficient.

[0011] Modifications to the viral backbone, namely the six internal gene segments consisting of PB1, PB2, PA, NP, M, and NS, have been shown to enhance vaccine production. For example, the high-yield influenza A virus vaccine backbone “PR8-HY” developed and described by Ping et al., Nature Communications, 6:8148 (2015), and the high-yield influenza B virus vaccine backbone developed and described by Ping et al., PNAS, 113(51):E8296-E8305 (2016) contain specific amino acid mutations in the PB1, PB2, PA, NP, and NS1 proteins, and are expected to improve titers of large-scale epidemic and seasonal influenza vaccines in cell and egg culture systems. However, these modifications described in the art are ineffective in increasing viral growth in Vero cells, especially under preferred production conditions. Therefore, there is a need to enhance viral growth in Vero cells so that vaccines can be produced more efficiently and effectively. Summary of the Invention

[0012] This invention provides an enhanced influenza virus grown in Vero cells. The influenza virus comprises gene segments encoding proteins such as PB1, PB2, PA, NP, and NS1 proteins, wherein at least the PA, NP, and NS gene segments have amino acid sequences containing selected amino acids. Specifically, the PA gene segment contains thymine at nucleotide position 2272. The NP protein contains serine at position 40, asparagine or glycine at position 161, threonine at position 204, and optionally valine at position 93. The NS gene segment contains guanine at nucleotide position 39, and the NS gene segment encodes the NS1 protein containing glutamine at position 176.

[0013] The present invention also provides a pharmaceutical preparation comprising the influenza virus; a method for inducing an immune response in a mammal, comprising administering the influenza virus to the mammal; and a method for generating the influenza virus.

[0014] Brief description of several views in the attached diagram.

[0015] Figure 1 This is a graph depicting the growth of influenza BM2SR4 CA12 BM2SR HA and NP mutations in BM2Vero P3 relative to time (days).

[0016] Figure 2 This is a graph depicting the growth of the influenza B NP mutant in animal-free (AOF) culture medium relative to time (days post-infection).

[0017] Figure 3 This is a set of Sanger sequence chromatogram data, indicating that in subsequent passages, the frequency of the mutant NS569_570insA in the influenza B skeleton increased from about 20% to about 50% of the mutants.

[0018] Figure 4 This is a graph depicting the growth of WA / 02 / 2019N209S and K420E HA in BM2Vero P3 in AOF relative to time (days after inoculation).

[0019] Figure 5 This is a graph depicting the growth of the influenza BM2SR4 CA12 HA2 mutation in BM2Vero P3 relative to time (days).

[0020] Figure 6 This is a graph depicting the growth of the influenza B CA12 N211T HA2 mutant in AOF relative to time (days post-infection).

[0021] Figure 7A This is a graph depicting the titer of anti-influenza B-Vic HA in mouse serum relative to time (days post-immunization) after immunization with monovalent BM2SR-Vic, monovalent BM2SR-Yam, bivalent BM2SR, trivalent BM2SR+M2SR-H1N1, trivalent BM2SR+M2SR-H3N2, and tetravalent M2SR or sucrose phosphate glutamate buffer (“SPG”; control).

[0022] Figure 7B It is a graph depicting the titer of anti-influenza B-Yam HA in the serum of mice immunized with monovalent BM2SR-Vic, monovalent BM2SR-Yam, bivalent BM2SR, trivalent BM2SR+M2SR-H1N1, trivalent BM2SR+M2SR-H3N2, tetravalent M2SR, or SPG (control) as a function of time (days post-immunization).

[0023] Figure 8This is a graph depicting the percentage change in body weight of mice immunized with monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, or SPG (control) after challenge with B / Malaysia / 2506 / 2004 (Vic) virus relative to time (days post-challenge).

[0024] Figure 9 It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the percentage change in body weight of mice immunized with high doses or SPG (control) relative to time (days after vaccination).

[0025] Figure 10A It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the serum IgG ELISA titer against influenza B-Vic HA in mice immunized with high doses or SPG (control) relative to time (days after vaccination).

[0026] Figure 10B It describes the use of monovalent BM2SR-Vic, BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the serum IgG ELISA titer against influenza B-Yam HA in mice immunized with high doses or SPG (control) relative to time (days after vaccination).

[0027] Figure 10C It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the serum IgG ELISA titer against influenza A / H1 HA in mice immunized with high doses or SPG (control) relative to time (days after vaccination).

[0028] Figure 10D It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, FluzoneTM Quadrivalent, Fluzone TM A graph showing the serum IgG ELISA titer against influenza A / H3 HA in mice immunized with high doses or SPG (control) relative to time (days after vaccination).

[0029] Figure 11A It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the IgG ELISA titer in bronchoalveolar lavage fluid of mice immunized with high doses or SPG (control) relative to HA1 test antigens (A / H1, A / H3, B / Yam, or B / Vic).

[0030] Figure 11B It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the anti-influenza HA1 IgA ELISA titer in the bronchoalveolar lavage fluid of mice immunized with high doses or SPG (control) relative to HA1 test antigens (A / H1, A / H3, B / Yam, or B / Vic).

[0031] Figure 12 It describes the use of monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUMIST. TM Quadrivalent, Fluzone TM Quadrivalent, Fluzone TM A graph showing the percentage change in body weight of mice immunized with high doses or SPG (control) after challenge with influenza B / Malaysia / 2506 / 2004 (Vic) relative to time (days after challenge).

[0032] Figure 13A This is a graph depicting the BM2SR-Vic virus titer in the nasal wash of ferrets from BM2SR-Vic donor ferrets and ferrets in direct and aerosol contact with them, relative to time (days post-inoculation). The detection limit is 1.67 log TCID. 50 / mL (dashed line).

[0033] Figure 13BThis is a graph depicting the titer of wild-type influenza B (Vic) virus in the nasal wash of ferrets from influenza B (Vic) donor ferrets and ferrets that had direct and aerosol contact with them, relative to time (days post-inoculation). The viral titer, group mean, and standard error of the mean are plotted for each ferret. The detection limit is 1.67 log TCID. 50 / mL (dashed line).

[0034] Figure 14A This is a graph depicting the serum anti-influenza A / H1 HAI titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 7.5.

[0035] Figure 14B This is a graph depicting the serum anti-influenza A / H3 HAI titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 7.5.

[0036] Figure 14C This is a graph depicting the serum anti-influenza B / Yam HAI titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 7.5.

[0037] Figure 14D This is a graph depicting serum anti-influenza A / Vic HAI titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 7.5.

[0038] Figure 15A This is a graph depicting the serum anti-influenza A / H1 PRNT titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 15.

[0039] Figure 15B This is a graph depicting the serum anti-influenza A / H3 PRNT titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 15.

[0040] Figure 15C This is a graph depicting the serum anti-influenza B / Yam PRNT titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 15.

[0041] Figure 15DThis is a graph depicting the serum anti-influenza A / Vic PRNT titers relative to time (study days) in the 13 ferret groups immunized as described in Table 10. The mean titer for each group is plotted. The limit of detection is 15.

[0042] Figure 16 This is a graph depicting the titer of the challenge virus in the nasal turbinates on day 3 after challenge with influenza B / Vic influenza as described in Example 14. The mean titer for each group is plotted. The detection limit is 1.3 log FFU / g.

[0043] Figure 17 This is a graph depicting the titers of the challenge virus in nasal washes on days 1, 3, 5, and 7 after challenge with influenza B / Vic as described in Example 14. The mean titer for each group is plotted. The limit of detection is 1.6 log TCID. 50 / mL.

[0044] Figure 18A This depicts the frequency (per 10) of PBMCs producing IFN-γ following stimulation with the A / Singapore / INFIMH-16-0019 / 2016 virus, harvested on days 28 and 37 post-vaccination. 6 A diagram showing the formation of spots in individual cells.

[0045] Figure 18B This depicts the frequency (per 10⁻⁹) of PMBCs producing IFN-γ after stimulation with the HA peptide pool in cells harvested on days 28 and 37 post-vaccination. 6 A diagram showing the formation of spots in individual cells.

[0046] Figure 19A It is a graph depicting the average percentage change in body weight for each ferret group after stimulation with influenza B / Vic.

[0047] Figure 19B It is a graph depicting the average body temperature change in each ferret group after being stimulated with influenza B / Vic. Invention Details

[0049] The influenza virus of this invention can be any type of influenza virus. For example, the influenza virus can be any subtype of influenza B virus (e.g., Victoria or Yamagata). In some embodiments, the influenza virus can be a seasonal influenza B virus. In some embodiments, the influenza virus can be a recombinant influenza virus. As used herein, a recombinant influenza virus (e.g., a reassortant influenza virus) is an influenza virus containing genetic material (e.g., a heterologous gene segment) derived from a genetically different (i.e., different) influenza virus (e.g., a heterologous gene segment). The influenza virus can also be an isolated influenza virus.

[0050] As used herein, the term "gene segment" refers to a nucleotide sequence that encodes a viral protein. A gene segment can be represented by a cDNA (complementary DNA) sequence that encodes viral RNA (vRNA), namely SEQ ID NO:8-12 and 18, which encode one or more viral proteins.

[0051] As used herein, the term "backbone" refers to the influenza gene segment encoding PB1, PB2, PA, NP, NS1 and / or NS2, as well as the M protein. The gene segments of this invention encode proteins having selected amino acids.

[0052] As used herein, the term "selected amino acid" refers to a specific amino acid at a specific position in an amino acid sequence. In some embodiments, the selected amino acid is the result of a genetic mutation in the parental amino acid sequence. Except for the position corresponding to the selected amino acid, the parental amino acid sequence may be identical to the amino acid sequence containing the selected amino acid.

[0053] Influenza virus

[0054] (A) Skeletal proteins

[0055] In one embodiment of the invention, the influenza virus comprises PA, NP, and NS gene segments, wherein (a) the PA gene segment contains thymine at nucleotide position 2272; (b) the NP gene segment encodes an NP protein having an amino acid sequence comprising selected amino acids, wherein the selected amino acids comprise serine at position 40, asparagine or glycine at position 161, threonine at position 204, and optionally valine at position 93; and (c) the NS gene segment contains guanine at nucleotide position 39, and wherein the NS gene segment encodes an NS1 protein having an amino acid sequence comprising selected amino acids, wherein the selected amino acids comprise glutamine at position 176.

[0056] The PB1 (polymerase basic protein 1) gene segment of the present invention can encode a protein containing at least one selected amino acid, i.e., the PB1 protein. The selected amino acid can be obtained by mutating a parental PB1 sequence, for example, a sequence identical to the PB1 amino acid sequence of the present invention except for the position corresponding to the selected amino acid. The PB2 (polymerase basic protein 2) gene segment of the present invention can also encode a protein containing at least one selected amino acid, i.e., the PB2 protein.

[0057] The PA (polymerase acid protein) gene segment of the present invention can also encode a protein containing at least one selected amino acid, i.e., a PA protein. In a preferred embodiment, the gene segment contains thymine at position 2272 of the nucleotide sequence.

[0058] The NP (nucleoprotein) gene segment of the present invention can also encode a protein containing at least one selected amino acid, i.e., an NP protein. In a preferred embodiment, the NP segment contains thymine at position 177, adenine at position 540, and thymine at position 670, and the NP gene segment encodes a protein having selected amino acids, said protein containing serine at position 40, asparagine or glycine at position 161, threonine at position 204, and optionally valine at position 93.

[0059] The NS (non-structural) gene segment of the present invention can also encode a protein containing at least one selected amino acid, namely NS1 and / or NS2 proteins. In a preferred embodiment, the NS segment contains guanine at position 39 and cytosine at position 570, and the NS gene segment encodes an NS protein (NS1 protein) having selected amino acids, which contains glutamine at position 176.

[0060] In one embodiment of the invention, the influenza virus includes a PB1 gene segment encoding a protein having selected amino acids, namely a PB1 protein. The PB1 gene segment may have the nucleotide sequence represented by SEQ ID NO:8. The PB1 gene segment may encode a protein having the amino acid sequence of SEQ ID NO:13, namely the PB1 protein. In another aspect of this embodiment, the influenza virus may include a PB2 gene segment encoding a protein having selected amino acids, namely a PB2 protein. The PB2 gene segment may have the nucleotide sequence represented by SEQ ID NO:9. The PB2 gene segment may encode a protein having the amino acid sequence of SEQ ID NO:14, namely the PB2 protein. In another aspect of this embodiment, the influenza virus may include an NP gene segment encoding a protein having selected amino acids at positions 40, 116, and 204, namely serine at position 40, asparagine or glycine at position 161, threonine at position 204, and optionally valine at position 93, namely the NP protein. The NP gene segment may have the nucleotide sequence represented by SEQ ID NO:11. The NP gene segment may encode a protein having the amino acid sequence of SEQ ID NO:16, i.e., the NP protein. In another aspect of this embodiment, the influenza virus may also include an NS gene segment encoding a protein having a selected amino acid at position 176, i.e., glutamine at position 176, i.e., the NS1 and / or NS2 proteins. The NS gene segment may contain guanine at position 39 and cytosine at position 570. The NS gene segment may have the nucleotide sequence represented by SEQ ID NO:12. The NS gene segment may encode a protein having the amino acid sequence of SEQ ID NO:17, i.e., the NS1 and / or NS2 proteins. In another aspect of this embodiment, the influenza virus may include a PA gene segment encoding a protein, i.e., the PA protein. The PA gene segment may have the nucleotide sequence represented by SEQ ID NO:10. The PA gene segment may encode a protein having the amino acid sequence of SEQ ID NO:15, i.e., the PA protein.

[0061] Compared to influenza viruses that are identical under the same conditions except for the absence of selected amino acids, the selected amino acids in the embodiments, particularly in most proteins of the backbone, impart enhanced growth properties to the influenza virus. For example, the influenza virus of the present invention exhibits enhanced growth in Vero cells.

[0062] The influenza virus of the present invention may also include an M (matrix protein) gene segment. In one embodiment of the invention, the M gene segment may be a mutant gene segment from an influenza B virus, such that the virus lacks expression of a functional BM2 protein. This virus is referred to herein as "BM2SR" virus. BM2SR virus is a single-replicating influenza B virus. The M gene segment of the BM2SR virus may be represented by SEQ ID NO:18. The M gene segment may encode a protein having the amino acid sequence of SEQ ID NO:20, such as a truncated BM2 protein. The BM2SR virus can replicate in Vero cells (i.e., BM2VeroA cells) that stably express the BM2 protein to allow for multi-cycle replication. The high yield in Vero cells is independent of mutations in the M gene segment. Therefore, the influenza virus of the present invention may include an M gene segment encoding a functional M2 protein.

[0063] (B) Surface proteins

[0064] In another embodiment of the invention, the influenza virus comprises NA (neuraminidase) and HA (hemagglutinin) gene segments. In one embodiment, the HA gene segment may encode an HA protein having an amino acid sequence containing at least one selected amino acid (e.g., an amino acid mutation) in the HA1 subunit of the protein and / or at least one selected amino acid (e.g., an amino acid mutation) in the HA2 subunit of the protein. For example, at least one amino acid mutation in the HA2 subunit may be glutamic acid at position 61. In another embodiment, at least one amino acid mutation in the HA2 subunit may be glutamic acid at position 112. Amino acid mutations can be present in any subtype or lineage of influenza B virus (i.e., Victoria or Yamagata). In a preferred embodiment, the amino acid mutation in the HA2 subunit may be glutamic acid at position 61 in the Victoria lineage of influenza B virus. In another preferred embodiment, the amino acid mutation in the HA2 subunit may be glutamic acid at position 112 in the Yamagata lineage of influenza B virus. Such mutations may also contribute to enhancing viral growth during production.

[0065] In one embodiment of the invention, the PA, NP, and NS gene segments are derived from a single influenza virus strain. In another embodiment of the invention, the PB1, PB2, PA, NP, and NS gene segments are derived from a single influenza virus strain. In one embodiment, the HA gene segment may be derived from an influenza virus strain from which the PA, NP, and NS gene segments originate. In another embodiment, the HA gene segment may be derived from an influenza virus strain from which the PB1, PB2, PA, NP, and NS gene segments originate. Similarly, the NA gene segment may be derived from an influenza virus strain from which the PA, NP, and NS gene segments originate. In another embodiment, the NA gene segment may be derived from an influenza virus strain from which the PB1, PB2, PA, NP, and NS gene segments originate. Therefore, the influenza virus of the present invention can be a seasonal influenza virus (e.g., influenza B virus).

[0066] (C) Characteristics of the influenza virus

[0067] Regardless of the type of influenza virus, the influenza virus backbone of this invention endows the influenza virus with high growth characteristics, particularly in Vero cells. The influenza virus of this invention exhibits high yield even in manufacturing processes using low multiples of infection (MOI) (e.g., 0.001). MOI refers to the average number of reagents (e.g., viruses) per infection target (e.g., cells). Lower MOIs are used when multiple infection cycles are required (e.g., viral vaccine production). The FDA enforces current Good Manufacturing Practices and generally requires the use of the lowest MOI that still produces high yields of virus. This is because master seed stock is expensive, and toxicity from non-infectious particles and excess cellular proteins can reduce virus production.

[0068] In another embodiment of the invention, the influenza virus is genetically stable, such that selected amino acids of the backbone proteins, particularly PB1, PB2, PA, NP, and NS1 proteins, are highly conserved, even when propagating at low MOI. For example, in one embodiment of the invention, the selected amino acids are conserved in at least one of the PB1, PB2, NP, and NS proteins after at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more than ten consecutive passages in a Vero cell line. In one embodiment, the Vero cell line may comprise Vero cells stably expressing the BM2 ion channel protein of influenza B virus (i.e., BM2VeroA cells). In a preferred embodiment of the invention, the selected amino acids are conserved in at least one of the NP and NS proteins after at least ten consecutive passages in Vero cells stably expressing the BM2 ion channel protein of influenza B virus. BM2 is considered a functional counterpart of influenza A virus M2. In such an embodiment, the selected amino acids can be conserved even when the influenza virus is influenza A virus.

[0069] Genetically modified Vero cells (i.e., those expressing the influenza M2 or BM2 protein) behave similarly to normal Vero cells and support the growth of influenza A or B viruses comparable to those in normal Vero cells. The viral titer of M2SR virus in M2VeroA cells is comparable to that of replicating influenza virus expressing functional M2 in unmodified Vero cell lines. Furthermore, the viral titer of BM2SR virus (i.e., influenza virus containing a mutated M gene segment from influenza B virus and therefore not expressing the functional BM2 protein) in BM2Vero cells is comparable to that of replicating influenza virus expressing functional BM2 in unmodified Vero cell lines. Therefore, M2SR and BM2SR viruses behave similarly to replicating influenza viruses in M2VeroA and BM2Vero cell lines.

[0070] In one embodiment of the invention, the influenza virus is capable of replicating in human cells.

[0071] Methods of generating influenza viruses

[0072] This document also provides a method for generating an influenza virus, wherein in one embodiment, the generated influenza virus, namely the recombinant influenza virus of the present invention disclosed herein, comprises PA, NP, and NS gene segments expressing proteins having selected amino acids. In another embodiment, namely another embodiment of the present invention disclosed herein, the generated influenza virus comprises PB1, PB2, NP, and NS gene segments expressing proteins having selected amino acids.

[0073] In one embodiment of the method of the present invention, the method of generating recombinant influenza virus includes continuously passaged recombinant influenza virus (e.g., first influenza virus) in Vero cells to generate the resulting influenza virus (e.g., second influenza virus). The first influenza virus may contain PA, NP, and NS gene segments that express proteins having selected amino acids, namely PA, NP, and NS1 proteins, as described in connection with the influenza virus of the present invention. For example, the first influenza virus may contain a PA gene segment containing thymine at nucleotide position 2272. The PA gene segment may encode a protein, namely the PA protein. The NP gene segment of the first influenza virus may contain thymine at position 177, adenine at position 540, and thymine at position 670, and encode a protein, namely the NP protein, which contains serine at position 40, asparagine or glycine at position 161, threonine at position 204, and optionally valine at position 93. The NS gene segment of the first influenza virus may contain guanine at nucleotide position 39 and encode a protein containing glutamine at position 176, namely the NS1 and / or NS2 proteins. In one embodiment of the invention, a second influenza virus (e.g., the resulting influenza virus) is generated after at least four or five consecutive passages of the first influenza virus in Vero cells. The first influenza virus may further contain PB1 and PB2 gene segments that express proteins, namely the PB1 and PB2 proteins having selected amino acids, as described in connection with the influenza virus of the present invention.

[0074] The influenza virus of the present invention can also be generated using standard virus rescue techniques. For example, in one embodiment of the invention, one or more plasmids containing cDNA clones of each of the eight viral gene segments (i.e., PB1, PB2, PA, NP, M, NS, HA, and NA) are transfected into eukaryotic host cells, wherein each cDNA sequence is flanked by an RNA polymerase I promoter and an RNA polymerase I terminator (i.e., the pPolI plasmid). Gene segments encoding PB1, PB2, PA, NP, and NS1 and / or NS2 proteins may encode proteins of the present invention having selected amino acids. Gene segments encoding M2 or BM2 proteins may contain mutated M2 or BM2 gene segments such that the gene segments do not encode functional M2 or BM2. Host cells may also be transfected with expression plasmids encoding viral proteins (e.g., at least one or more of PA, PB1, PB2, and NP proteins, or at least one or more of PB1, PB2, PA, NP, M, NS1, and / or NS2, HA, and NA proteins). Then, after transfecting at least one or more plasmids into host cells, eight influenza vRNAs (i.e., gene segments) are synthesized. Co-transfected viral polymerases and nucleoproteins assemble the vRNAs into functional vRNPs (i.e., viral ribonucleoprotein complexes), which are replicated and transcribed, ultimately forming the recombinant influenza virus of this invention. This plasmid-based reverse genetics system is further detailed in Neumann et al., PNAS, 96:9345-9350 (1999). The influenza virus of this invention can also be produced using other methods known in the art, such as, but not limited to, ribonucleoprotein (RNP) transfection systems, as described in U.S. Patent 9,284,533 (incorporated herein by reference).

[0075] pharmaceutical preparations

[0076] This invention provides pharmaceutical formulations (e.g., vaccines or other immunogenic compositions) comprising the recombinant virus of the invention as described herein.

[0077] The pharmaceutical formulation may also contain at least one pharmaceutically acceptable carrier or excipient. As used herein, the term "pharmaceutically acceptable carrier or excipient" refers to any component of the pharmaceutical formulation other than the influenza virus of the present invention. Pharmaceutically acceptable carriers or excipients can enhance the efficacy of the recombinant virus of the present invention or maintain the stability of the pharmaceutical formulation, and ideally do not significantly inactivate the recombinant virus of the present invention.

[0078] At least one pharmaceutically acceptable carrier or excipient can be any suitable pharmaceutically acceptable carrier or excipient, many of which are known in the art. Exemplary pharmaceutically acceptable carriers or excipients include components that maintain the pH of a pharmaceutical formulation (e.g., buffers), regulate tension (e.g., tonic modulators, such as inorganic salts), improve the stability and / or immunogenicity of proteins (e.g., viruses), improve mucosal adhesion, prevent protein aggregation, and / or preserve pharmaceutical formulations (e.g., preservatives). For example, a pharmaceutically acceptable carrier or excipient may include at least one of inorganic salts, surfactants, amino acids, polymers or polymeric compounds (e.g., proteins, polysaccharides, or hydrogels), chelating agents, sugars, polyols, and / or adjuvants (e.g., any substance that enhances a specific immune response), many of which are known in the art. A particular carrier or excipient can be used in a pharmaceutical formulation for more than one purpose; therefore, the following embodiments are not limited to the descriptions herein.

[0079] Any suitable buffer may be present in the pharmaceutical formulation. In one embodiment, the buffer comprises at least one of imidazole buffer, potassium phosphate buffer, phosphate-buffered saline (PBS), Durbeco phosphate-buffered saline (DPBS) (e.g., 1×DPBS), histidine buffer, sodium citrate buffer, and sucrose phosphate glutamate (SPG). PBS and / or DPBS formulations may contain, for example, sodium chloride, potassium chloride, potassium dihydrogen phosphate, and disodium hydrogen phosphate, and may optionally further contain calcium chloride and / or magnesium chloride. In some embodiments, PBS and / or DPBS formulations contain about 136.9 mM sodium chloride, about 2.67 mM potassium chloride, about 1.47 mM potassium dihydrogen phosphate, and about 8.1 mM disodium hydrogen phosphate, although any suitable PBS and / or DPBS formulation (many of which are known in the art) may be used as a buffer in the pharmaceutical formulation.

[0080] Buffers can be present in pharmaceutical preparations at any suitable concentration. Buffers can be present in pharmaceutical preparations at concentrations of about 0.1 mM or higher, about 1 mM or higher, about 10 mM or higher, about 20 mM or higher, about 30 mM or higher, about 40 mM or higher, about 50 mM or higher, about 60 mM or higher, about 70 mM or higher, about 80 mM or higher, about 90 mM or higher, about 100 mM or higher, about 120 mM or higher, about 140 mM or higher, about 160 mM or higher, about 180 mM or higher, about 200 mM or higher, about 250 mM or higher, about 300 mM or higher, about 350 mM or higher, about 400 mM or higher, about 450 mM or higher, or about 500 mM or higher. Optionally or additionally, the buffer may be present in the pharmaceutical formulation at a concentration of about 1000 mM or less, about 500 mM or less, about 450 mM or less, about 400 mM or less, about 350 mM or less, about 300 mM or less, about 250 mM or less, about 200 mM or less, about 180 mM or less, about 160 mM or less, about 140 mM or less, about 120 mM or less, about 100 mM or less, about 90 mM or less, about 80 mM or less, about 70 mM or less, about 60 mM or less, about 50 mM or less, about 40 mM or less, about 30 mM or less, about 20 mM or less, about 10 mM or less, or about 1 mM or less. The buffer may be present in the pharmaceutical formulation at any concentration within the range defined by any of the foregoing endpoints. For example, the buffer may be present in the pharmaceutical preparation at concentrations of about 0.1 mM to about 1000 mM, about 0.1 mM to about 500 mM, about 0.1 mM to about 100 mM, about 1 mM to about 1000 mM, about 1 mM to about 500 mM, about 1 mM to about 100 mM, about 100 mM to about 1000 mM, about 100 mM to about 500 mM, etc.

[0081] In a further embodiment, the buffer is present in the pharmaceutical formulation at a concentration percentage (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). The buffer may be present in the pharmaceutical formulation at a concentration percentage of about 0.1% or higher, about 1% or higher, about 5% or higher, about 10% or higher, about 15% or higher, about 20% or higher, about 30% or higher, about 40% or higher, or about 50% or higher. Optionally or additionally, the buffer may be present in the pharmaceutical formulation at a concentration percentage of about 60% or lower, about 50% or lower, about 40% or lower, about 30% or lower, about 20% or lower, about 15% or lower, about 10% or lower, about 5% or lower, or about 1% or lower. The buffer may be present in the pharmaceutical formulation at any concentration percentage within the range defined by any of the foregoing endpoints. For example, the buffer may be present in the pharmaceutical formulation at concentration percentages of about 0.1% to about 60%, about 1% to about 60%, about 10% to about 60%, about 0.1% to about 50%, about 1% to about 50%, about 10% to about 50%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 40%, about 40% to about 50%, etc.

[0082] Buffers can maintain the pH of a pharmaceutical preparation at any suitable pH. Buffers can maintain the pH of a pharmaceutical preparation at, for example, about 4 or higher, about 4.5 or higher, about 5 or higher, about 5.5 or higher, about 6 or higher, about 6.5 or higher, about 7 or higher, or about 7.5 or higher. Optionally or additionally, buffers can maintain the pH of a pharmaceutical preparation at, for example, about 8 or lower, about 7.5 or lower, about 7 or lower, about 6.5 or lower, about 6 or lower, about 5.5 or lower, about 5 or lower, or about 4.5 or lower. Buffers can maintain the pH of a pharmaceutical preparation within a range defined by any of the foregoing endpoints. For example, buffers can maintain the pH of a pharmaceutical preparation at a pH of about 4 to about 8, about 4.5 to about 8, about 5 to about 8, about 5.5 to about 8, about 6 to about 8, about 6.5 to about 8, about 7 to about 8, about 7.5 to about 8, about 4 to about 7.5, about 5 to about 7.5, about 6 to 7.5, about 7 to 7.5, about 4 to 7, about 5 to 7, about 6 to about 7, etc.

[0083] Any suitable tonic modifier may be present in the pharmaceutical formulation. In some embodiments, one or more inorganic salts are present in the pharmaceutical formulation as tonic modifiers. The inorganic salt may be at least one of sodium chloride (NaCl), magnesium sulfate (MgSO4), and magnesium chloride (MgCl2). The tonic modifier, such as the inorganic salt, may be present in the pharmaceutical formulation in any suitable amount. The tonic modifier, such as the inorganic salt, may be present in amounts of about 0.1 mM or higher, about 0.2 mM or higher, about 0.4 mM or higher, about 0.6 mM or higher, about 0.8 mM or higher, about 1 mM or higher, about 1.2 mM or higher, about 1.4 mM or higher, about 1.6 mM or higher, about 1.8 mM or higher, about 2 mM or higher, about 3 mM or higher, about 4 mM or higher, about 5 mM or higher, about 6 mM or higher, about 7 mM or higher, about 8 mM or higher, or about 9 mM. It exists in the pharmaceutical formulation at concentrations of about 10 mM or higher, about 20 mM or higher, about 30 mM or higher, about 40 mM or higher, about 50 mM or higher, about 100 mM or higher, about 200 mM or higher, about 300 mM or higher, about 400 mM or higher, about 500 mM or higher, about 600 mM or higher, about 700 mM or higher, about 800 mM or higher, about 900 mM or higher, about 1000 mM or higher, or about 1500 mM or higher. Optionally or additionally, a tension modifier, such as an inorganic salt, may be present in concentrations of approximately 2000 mM or lower, approximately 1500 mM or lower, approximately 1000 mM or lower, approximately 900 mM or lower, approximately 800 mM or lower, approximately 700 mM or lower, approximately 600 mM or lower, approximately 500 mM or lower, approximately 450 mM or lower, approximately 400 mM or lower, approximately 350 mM or lower, approximately 300 mM or lower, approximately 250 mM or lower, approximately 200 mM or lower, approximately 150 mM or lower, approximately 100 mM or lower, approximately 50 mM or lower, approximately 45 mM or lower, or approximately 40 mM or lower. The tonic modulator, such as an inorganic salt, may be present in the pharmaceutical formulation at concentrations of approximately 35 mM or less, approximately 30 mM or less, approximately 25 mM or less, approximately 20 mM or less, approximately 10 mM or less, approximately 9 mM or less, approximately 8 mM or less, approximately 7 mM or less, approximately 6 mM or less, approximately 5 mM or less, approximately 4 mM or less, approximately 3 mM or less, approximately 2 mM or less, approximately 1.8 mM or less, approximately 1.6 mM or less, approximately 1.4 mM or less, approximately 1.2 mM or less, approximately 1 mM or less, approximately 0.8 mM or less, approximately 0.6 mM or less, approximately 0.4 mM or less, or approximately 0.2 mM or less.For example, tension modifiers, such as inorganic salts, can be present in concentrations of approximately 0.1 mM to approximately 2000 mM, approximately 0.1 mM to approximately 1500 mM, approximately 0.1 mM to approximately 1000 mM, approximately 0.1 mM to approximately 500 mM, approximately 0.1 mM to approximately 250 mM, approximately 0.1 mM to approximately 100 mM, approximately 0.1 mM to approximately 50 mM, approximately 0.1 mM to approximately 10 mM, approximately 1 mM to approximately 2000 mM, approximately 1 mM to approximately 1500 mM, approximately 1 mM to approximately 1000 mM, approximately 1 mM to approximately 500 mM, approximately 1 mM to approximately 250 mM, approximately 1 mM to approximately 100 mM, approximately 1 mM to approximately 50 mM, and approximately 1 mM to approximately 10 mM. The concentrations of M, about 10 mM to about 2000 mM, about 10 mM to about 1500 mM, about 10 mM to about 1000 mM, about 10 mM to about 500 mM, about 10 mM to about 250 mM, about 10 mM to about 100 mM, about 10 mM to about 50 mM, about 100 mM to about 2000 mM, about 100 mM to about 1500 mM, about 100 mM to about 1000 mM, about 100 mM to about 500 mM, about 100 mM to about 250 mM, about 500 mM to about 2000 mM, about 500 mM to about 1500 mM, about 500 mM to about 1000 mM, etc., are present in the pharmaceutical preparation.

[0084] In a further embodiment, the inorganic salt is present in the pharmaceutical formulation at a concentration percentage (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). The tonic modifier, such as the inorganic salt, is present in the pharmaceutical formulation at a concentration percentage of about 0.1% or higher, about 1% or higher, about 2% or higher, about 3% or higher, about 4% or higher, about 5% or higher, about 6% or higher, about 7% or higher, about 8% or higher, about 9% or higher, or about 10% or higher. Optionally or additionally, the tonic modifier, such as the inorganic salt, may be present in the pharmaceutical formulation at a concentration percentage of about 10% or lower, about 9% or lower, about 8% or lower, about 7% or lower, about 6% or lower, about 5% or lower, about 4% or lower, about 3% or lower, about 2% or lower, or about 1% or lower. Tonic modifiers, such as inorganic salts, may be present in pharmaceutical formulations at any concentration percentage within the range defined by any of the foregoing endpoints. For example, tonic modifiers, such as inorganic salts, may be present in pharmaceutical formulations at concentration percentages of about 0.1% to about 1%, about 0.1% to about 2%, about 0.1% to about 5%, about 0.1% to about 10%, about 1% to about 2%, about 1% to about 5%, about 1% to about 10%, about 2% to about 10%, about 3% to about 10%, about 4% to about 10%, about 5% to about 10%, etc.

[0085] Any suitable surfactant may be present in the pharmaceutical formulation. In some embodiments, the surfactant may comprise at least one of polysorbate 20, polysorbate 80, sodium deoxycholate, and poloxamer 188. The surfactant may be present in the pharmaceutical formulation in any suitable amount. In some embodiments, the surfactant is present in the pharmaceutical formulation as a concentration percentage (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). Surfactants may be present in pharmaceutical formulations at concentrations of about 0.01% or higher, about 0.02% or higher, about 0.03% or higher, about 0.04% or higher, about 0.05% or higher, about 0.06% or higher, about 0.07% or higher, about 0.08% or higher, about 0.09% or higher, about 0.1% or higher, about 0.2% or higher, about 0.3% or higher, about 0.4% or higher, about 0.5% or higher, about 0.6% or higher, about 0.7% or higher, about 0.8% or higher, about 0.9% or higher, or about 1% or higher. Optionally or additionally, the surfactant may be present in the pharmaceutical formulation at a concentration percentage of about 1% or less, about 0.9% or less, about 0.8% or less, about 0.7% or less, about 0.6% or less, about 0.5% or less, about 0.4% or less, about 0.3% or less, about 0.2% or less, or about 0.1% or less. The surfactant may be present in the pharmaceutical formulation at any concentration percentage within the range defined by any of the foregoing endpoints. For example, the surfactant may be present in the pharmaceutical formulation at concentration percentages of about 0.01% to about 1%, about 0.01% to about 0.1%, about 0.05% to about 1%, about 0.05% to about 0.1%, about 0.1% to about 1%, about 0.1% to about 0.5%, about 0.2% to about 1%, about 0.5% to about 1%, etc.

[0086] Any suitable amino acid may be present in the pharmaceutical formulation. In some embodiments, the amino acid may be one or more of arginine, glutamic acid, asparagine, histidine, and glycine. The amino acid may be present in the pharmaceutical formulation in any suitable amount. The amino acid may be present in the pharmaceutical formulation at a concentration of about 1 mM or higher, about 2 mM or higher, about 3 mM or higher, about 5 mM or higher, about 6 mM or higher, about 7 mM or higher, about 8 mM or higher, about 9 mM or higher, or about 10 mM or higher. Optionally or additionally, the amino acid may be present in the pharmaceutical formulation at a concentration of about 100 mM or lower, about 90 mM or lower, about 80 mM or lower, about 70 mM or lower, about 60 mM or lower, about 50 mM or lower, about 0 mM or lower, about 30 mM or lower, about 20 mM or lower, or about 10 mM or lower. Amino acids may be present in pharmaceutical preparations at any concentration within the range defined by any of the foregoing endpoints. For example, amino acids may be present in pharmaceutical preparations at concentrations of about 1 mM to about 10 mM, about 1 mM to about 50 mM, about 1 mM to about 100 mM, about 5 mM to about 50 mM, about 10 mM to about 50 mM, about 20 mM to about 50 mM, etc.

[0087] In some embodiments, amino acids are present in the pharmaceutical formulation at a concentration percentage (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). Amino acids may be present in the pharmaceutical formulation at a concentration percentage of about 0.1% or higher, about 0.2% or higher, about 0.3% or higher, about 0.4% or higher, about 0.5% or higher, about 0.6% or higher, about 0.7% or higher, about 0.8% or higher, about 0.9% or higher, about 1% or higher, about 2% or higher, about 3% or higher, about 4% or higher, or about 5% or higher. Optionally or additionally, amino acids may be present in the pharmaceutical formulation at a concentration percentage of about 10% or lower, about 9% or lower, about 8% or lower, about 7% or lower, about 6% or lower, about 5% or lower, about 4% or lower, about 3% or lower, about 2% or lower, or about 1% or lower. Amino acids may be present in the pharmaceutical formulation at any concentration percentage within the range defined by any of the foregoing endpoints. For example, amino acids may be present in the pharmaceutical formulation at concentration percentages of about 0.1% to about 10%, about 0.2% to about 10%, about 0.5% to about 10%, about 0.1% to about 5%, about 0.1% to about 2%, about 0.2% to about 2%, about 0.5% to about 1%, etc.

[0088] Any suitable polymer or polymeric compound may be present in a pharmaceutical formulation. The polymer or polymeric compound may be, for example, a protein, polysaccharide, hydrogel, or any other suitable polymer or polymeric compound, many of which are known in the art. For example, the polymer or polymeric compound may be recombinant human serum albumin (rHSA), serum albumin (SA), gelatin, hydroxyethyl starch (HES), chitosan, dextran (DEX70K, DEX40K), and polyvinylpyrrolidone (PVP40K).

[0089] Polymers or polymeric compounds may be present in pharmaceutical formulations in any suitable amount. Polymers or polymeric compounds may be present in pharmaceutical formulations at concentration percentages (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). Polymers or polymeric compounds may be present in pharmaceutical formulations at concentration percentages of about 0.1% or higher, about 0.2% or higher, about 0.3% or higher, about 0.4% or higher, about 0.5% or higher, about 0.6% or higher, about 0.7% or higher, about 0.8% or higher, about 0.9% or higher, about 1% or higher, about 2% or higher, about 3% or higher, about 4% or higher, or about 5% or higher. Optionally or additionally, the polymer or polymeric compound may be present in the pharmaceutical formulation at a concentration percentage of about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less. The polymer or polymeric compound may be present in the pharmaceutical formulation at any concentration percentage within the range defined by any of the foregoing endpoints. For example, the polymer or polymeric compound may be present in the pharmaceutical formulation at concentration percentages of about 0.1% to about 10%, about 0.2% to about 10%, about 0.5% to about 10%, about 0.1% to about 5%, about 0.1% to about 2%, about 0.2% to about 2%, about 0.5% to about 2%, about 0.1% to about 1%, about 0.2% to about 1%, about 0.5% to about 1%, etc.

[0090] Any suitable chelating agent may be present in the pharmaceutical formulation. Chelating agents may be, for example, ethylenediaminetetraacetic acid (EDTA), ammonia oxime compounds (AOX), and / or dithiothreitol (DTT). Chelating agents may be present in the pharmaceutical formulation at any suitable concentration. Chelating agents may be present in the pharmaceutical formulation at concentrations of about 10 μM or higher, about 20 μM or higher, about 30 μM or higher, about 40 μM or higher, about 50 μM or higher, about 60 μM or higher, about 70 μM or higher, about 80 μM or higher, about 90 μM or higher, about 100 μM or higher, about 120 μM or higher, or about 150 μM or higher. Optionally or additionally, the chelating agent may be present in the pharmaceutical formulation at a concentration of about 500 μM or less, about 400 μM or less, about 300 μM or less, about 200 μM or less, about 150 μM or less, about 140 μM or less, about 130 μM or less, about 120 μM or less, about 110 μM or less, about 100 μM or less, about 80 μM or less, about 70 μM or less, about 60 μM or less, or about 50 μM or less. The chelating agent may be present in the pharmaceutical formulation at any concentration within the range defined by any of the foregoing endpoints. For example, chelating agents may be present in pharmaceutical formulations at concentrations of about 10 μM to about 500 μM, about 10 μM to about 200 μM, about 10 μM to about 150 μM, about 10 μM to about 100 μM, about 50 μM to about 500 μM, about 50 μM to about 200 μM, about 50 μM to about 150 μM, about 50 μM to about 100 μM, etc.

[0091] Any suitable sugar may be present in the pharmaceutical preparation. The sugar may be one or more of, for example, sucrose, trehalose, mannose, and lactose. The sugar may be present in the pharmaceutical preparation at any suitable concentration. The sugar may be present at concentrations of approximately 0.1 mM or higher, approximately 0.2 mM or higher, approximately 0.4 mM or higher, approximately 0.6 mM or higher, approximately 0.8 mM or higher, approximately 1 mM or higher, approximately 1.2 mM or higher, approximately 1.4 mM or higher, approximately 1.6 mM or higher, approximately 1.8 mM or higher, approximately 2 mM or higher, approximately 3 mM or higher, approximately 4 mM or higher, approximately 5 mM or higher, approximately 6 mM or higher, approximately 7 mM or higher, approximately 8 mM or higher, approximately 9 mM or higher, approximately 10 mM or higher, approximately 20 mM or higher, approximately 30 mM or higher, approximately 20 mM or higher, approximately 30 mM or higher. The drug formulation is present at concentrations of mM or higher, approximately 40 mM or higher, approximately 50 mM or higher, approximately 60 mM or higher, approximately 70 mM or higher, approximately 80 mM or higher, approximately 90 mM or higher, or approximately 100 mM or higher, approximately 200 mM or higher, approximately 300 mM or higher, approximately 400 mM or higher, approximately 500 mM or higher, approximately 600 mM or higher, approximately 700 mM or higher, approximately 800 mM or higher, approximately 900 mM or higher, approximately 1000 mM or higher, or approximately 1500 mM or higher. Optionally or additionally, sugar may be present in amounts of approximately 2000 mM or lower, approximately 1500 mM or lower, approximately 1000 mM or lower, approximately 900 mM or lower, approximately 800 mM or lower, approximately 700 mM or lower, approximately 600 mM or lower, approximately 500 mM or lower, approximately 450 mM or lower, approximately 400 mM or lower, approximately 350 mM or lower, approximately 300 mM or lower, approximately 250 mM or lower, approximately 200 mM or lower, approximately 150 mM or lower, approximately 100 mM or lower, approximately 50 mM or lower, approximately 45 mM or lower, approximately 40 mM or lower, approximately 35 mM Sugars may be present in the pharmaceutical formulation at concentrations of M or lower, about 30 mM or lower, about 25 mM or lower, about 20 mM or lower, about 10 mM or lower, about 9 mM or lower, about 8 mM or lower, about 7 mM or lower, about 6 mM or lower, about 5 mM or lower, about 4 mM or lower, about 3 mM or lower, about 2 mM or lower, about 1.8 mM or lower, about 1.6 mM or lower, about 1.4 mM or lower, about 1.2 mM or lower, about 1 mM or lower, about 0.8 mM or lower, about 0.6 mM or lower, about 0.4 mM or lower, or about 0.2 mM or lower. Sugars may be present in the pharmaceutical formulation at any concentration within the range defined by any of the foregoing endpoints.For example, sugar can be expressed in amounts from about 0.1 mM to about 2000 mM, from about 0.1 mM to about 1500 mM, from about 0.1 mM to about 1000 mM, from about 0.1 mM to about 500 mM, from about 0.1 mM to about 250 mM, from about 0.1 mM to about 100 mM, from about 0.1 mM to about 50 mM, from about 0.1 mM to about 10 mM, from about 1 mM to about 2000 mM, from about 1 mM to about 1500 mM, from about 1 mM to about 1000 mM, from about 1 mM to about 50 mM, from about 1 mM to about 250 mM, from about 1 mM to about 100 mM, from about 1 mM to about 50 mM, from about 1 mM to about 10 mM, from about 10 mM The concentrations of M to about 2000 mM, about 10 mM to about 1500 mM, about 10 mM to about 1000 mM, about 10 mM to about 500 mM, about 10 mM to about 250 mM, about 10 mM to about 100 mM, about 10 mM to about 50 mM, about 100 mM to about 2000 mM, about 100 mM to about 1500 mM, about 100 mM to about 1000 mM, about 100 mM to about 500 mM, about 100 mM to about 250 mM, about 500 mM to about 2000 mM, about 500 mM to about 1500 mM, about 500 mM to about 1000 mM, etc., are present in the pharmaceutical preparation.

[0092] In other embodiments, sugar is present in the pharmaceutical formulation at a concentration percentage (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). Sugar may be present in the pharmaceutical formulation at a concentration percentage of about 0.1% or higher, about 1% or higher, about 5% or higher, about 10% or higher, about 15% or higher, about 20% or higher, about 30% or higher, or about 40% or higher. Optionally or additionally, sugar may be present in the pharmaceutical formulation at a concentration percentage of about 50% or lower, about 40% or lower, about 30% or lower, about 20% or lower, about 15% or lower, about 10% or lower, about 5% or lower, or about 1% or lower. Sugar may be present in the pharmaceutical formulation at any concentration percentage within the range defined by any of the foregoing endpoints. For example, sugar may be present in pharmaceutical preparations at concentration percentages of about 0.1% to about 50%, about 1% to about 50%, about 10% to about 50%, about 0.1% to about 20%, about 1% to about 20%, about 10% to about 20%, about 0.1% to about 10%, about 1% to about 10%, etc.

[0093] Any suitable polyol may be present in a pharmaceutical formulation. Polyols may be, for example, sorbitol and / or mannitol. Polyols may be present in the pharmaceutical formulation at any suitable concentration. Polyols may be present in pharmaceutical formulations at concentrations of about 0.1 mM or higher, about 1 mM or higher, about 10 mM or higher, about 20 mM or higher, about 30 mM or higher, about 40 mM or higher, about 50 mM or higher, about 60 mM or higher, about 70 mM or higher, about 80 mM or higher, about 90 mM or higher, about 100 mM or higher, about 120 mM or higher, about 140 mM or higher, about 160 mM or higher, about 180 mM or higher, about 200 mM or higher, about 250 mM or higher, about 300 mM or higher, about 350 mM or higher, about 400 mM or higher, about 450 mM or higher, or about 500 mM or higher. Optionally or additionally, the polyol may be present in the pharmaceutical formulation at concentrations of about 1000 mM or less, about 500 mM or less, about 450 mM or less, about 400 mM or less, about 350 mM or less, about 300 mM or less, about 250 mM or less, about 200 mM or less, about 180 mM or less, about 160 mM or less, about 140 mM or less, about 120 mM or less, about 100 mM or less, about 90 mM or less, about 80 mM or less, about 70 mM or less, about 60 mM or less, about 50 mM or less, about 40 mM or less, about 30 mM or less, about 20 mM or less, about 10 mM or less, or about 1 mM or less. The polyol may be present in the pharmaceutical formulation at any concentration within the range defined by any of the foregoing endpoints. For example, polyols may be present in pharmaceutical preparations at concentrations of about 0.1 mM to about 1000 mM, about 0.1 mM to about 500 mM, about 0.1 mM to about 100 mM, about 1 mM to about 1000 mM, about 1 mM to about 500 mM, about 1 mM to about 100 mM, about 100 mM to about 1000 mM, about 100 mM to about 500 mM, etc.

[0094] In other embodiments, the polyol is present in the pharmaceutical formulation at a concentration percentage (e.g., volume / volume percentage (%v / v); weight / volume percentage (%w / v); or weight / weight percentage (%w / w)). The polyol may be present in the pharmaceutical formulation at a concentration percentage of about 0.1% or higher, about 1% or higher, about 2% or higher, about 3% or higher, about 4% or higher, or about 5% or higher, about 10% or higher, about 15% or higher, about 20% or higher, about 25% or higher, about 30% or higher, about 35% or higher, about 40% or higher, or about 45% or higher. Optionally or additionally, the polyol may be present in the pharmaceutical formulation at a concentration percentage of about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less. The polyol may be present in the pharmaceutical formulation at any concentration percentage within the range defined by any of the foregoing endpoints. For example, polyols may be present in pharmaceutical formulations at concentration percentages of about 0.1% to about 50%, about 1% to about 50%, about 5% to about 50%, about 10% to about 50%, about 15% to about 50%, about 0.1% to about 25%, about 1% to about 25%, about 5% to about 25%, about 10% to about 25%, about 15% to about 25%, about 0.1% to about 15%, about 1% to about 15%, about 5% to about 15%, about 10% to about 15%, about 0.1% to about 10%, about 1% to about 10%, about 5% to about 10%, about 0.1% to about 5%, about 1% to about 5%, etc.

[0095] In one embodiment, the pharmaceutical formulation comprises the influenza virus of the present invention, about 0.5 M sucrose, about 0.1 M or about 0.5 M mannose, about 0.3 M or about 0.5 M trehalose, about 50% SPG, and about 0.05% polysorbate-20. In another embodiment, the pharmaceutical formulation comprises the influenza virus of the present invention, about 0.5 M sucrose, about 0.3 M trehalose, and about 0.05% polysorbate-20.

[0096] At least one pharmaceutically acceptable carrier or excipient can be a component for binding pharmaceutical formulation ingredients (e.g., a binder). Binders can include, but are not limited to, proteins (e.g., gelatin), polymers (e.g., polyethylene glycol, polyvinylpyrrolidone), and / or polysaccharides or derivatives thereof (e.g., starch and cellulose). At least one pharmaceutically acceptable carrier or excipient can be a component that increases the volume of a pharmaceutical formulation (e.g., a bulking agent, diluent, and / or filler). Such bulking agents can include, but are not limited to, polysaccharides or derivatives thereof, sugars, and / or inorganic compounds. A pharmaceutically acceptable carrier or excipient can be a component that enhances the taste and / or appearance of a pharmaceutical formulation (e.g., a flavoring agent, sweetener, and / or color). A pharmaceutically acceptable carrier or excipient can be a component of a pharmaceutical formulation that protects against moisture by absorbing or adsorbing liquids or gases (e.g., an adsorbent). Adsorbents include, but are not limited to, starch, calcium phosphate, and / or colloidal silica. Pharmaceutically acceptable carriers or excipients may be components that promote the dissolution of pharmaceutical formulations (e.g., disintegrants), such as starch, cellulose, and / or any other polymers known in the art, or derivatives thereof (e.g., cross-linked polyvinylpyrrolidone or sodium carboxymethyl cellulose).

[0097] In some embodiments, a pharmaceutically acceptable carrier or excipient is a component (e.g., a flow aid) that reduces interparticle adhesion and / or optimizes product flow during the manufacture of the pharmaceutical formulation. Examples of flow aids include, but are not limited to, talc, colloidal silica, and corn starch. A pharmaceutically acceptable carrier or excipient can be a component that provides non-adhesive properties during the manufacture of the pharmaceutical formulation, particularly when the pharmaceutical formulation is formulated into an oral dosage form, such as reducing adhesion between the component and, for example, a punch face or lubricant (e.g., an anti-adhesion agent). For example, an anti-adhesion agent may comprise magnesium stearate. In other embodiments, a pharmaceutically acceptable carrier or excipient can be a component (e.g., a lubricant) that reduces clumping of the component during manufacture and / or reduces, for example, friction between the surface of the pharmaceutical formulation (i.e., formulated into an oral dosage form) and the mold wall. According to some embodiments, water-soluble or water-insoluble lubricants, such as magnesium stearate, stearic acid, vegetable oil, mineral oil, polyethylene glycol, and / or sodium dodecyl sulfate, may be used. Pharmaceutically acceptable carriers or excipients can be components that act as coating agents. Coating agents include, but are not limited to, gelatin- and / or cellulose-based coating agents (e.g., hydroxypropyl methylcellulose).

[0098] Other suitable binders, flavoring agents, sweeteners, coloring agents, disintegrants, flow aids, anti-adhesion agents, lubricants, and coating agents are well known and readily identified in the art.

[0099] The pharmaceutical formulation may also contain therapeutic agents (e.g., chemotherapeutic agents or anti-inflammatory agents). The pharmaceutical formulation may also contain agents that trigger an immune response isolated from the influenza virus. Such additional components, besides the influenza virus of the present invention, may be present in any suitable amount.

[0100] Before being presented to the immune system, additional components may be mixed with other components to form a drug formulation. Alternatively, the additional components may be presented to the immune system separately from the drug formulation. For example, the additional components and the drug formulation may be provided to the immune system separately (e.g., administered to the organism). When the additional components and the drug formulation are administered separately, they may be applied to the same site on the immunized organism.

[0101] In one embodiment of the pharmaceutical preparation, the pharmaceutical preparation is a viral vaccine. The viral vaccine may be a live attenuated virus vaccine or an inactivated virus vaccine (e.g., a whole-virus vaccine, a split virus vaccine, or a subunit vaccine). The viral vaccine may be formulated as a monovalent, bivalent, trivalent, or quadrivalent vaccine. For example, the vaccine may comprise multiple embodiments of the influenza virus of the present invention. In some embodiments, the vaccine may also comprise at least one influenza virus different from the influenza virus of the present invention.

[0102] Viral vaccines can be formulated into compositions for any suitable means of administration. For example, viral vaccines can be formulated into oral formulations (e.g., capsules, tablets, or oral films), sprays (e.g., nasal sprays), or any composition suitable for intranasal or parenteral administration, such as intravenous, intramuscular, or subcutaneous administration, such as aqueous or non-aqueous emulsions, solutions, or suspensions.

[0103] Methods to induce an immune response

[0104] This invention provides a method for inducing an immune response in mammals, comprising administering the influenza virus of this invention to said mammals. In one embodiment, the influenza virus, namely the influenza virus of this invention as described herein, comprises a PB1 gene segment, a PB2 gene segment, a PA gene segment, an NP gene segment, and an NS gene segment encoding proteins comprising selected amino acids, namely, PB1 protein, PB2 protein, PA protein, NP protein, and NS1 protein, respectively.

[0105] Mammals can be, for example, humans or primates, but are not limited to these.

[0106] In one embodiment of the invention, the influenza virus of the invention is administered as a pharmaceutical preparation (e.g., a vaccine or other immunogenic composition) as described herein. The pharmaceutical preparation may be administered intranasally. In another embodiment, the pharmaceutical preparation may be administered intramuscularly. The pharmaceutical preparation may also be administered subcutaneously or orally.

[0107] The dosing regimen of a pharmaceutical preparation (e.g., a viral vaccine) can be determined based on the mammal's age, weight, sex, and medical history. For example, in one embodiment, a single-dose attenuated viral vaccine for humans may contain about 10% of the influenza virus of the present invention. 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 Or 10 12 Or any range between two of the aforementioned values ​​for particle-forming units (PFU), lesion-forming units (FFU), or TCID. 50 In some implementations, the regimen for preventing or treating influenza viruses includes administering the drug formulation as a single treatment. The drug formulation may also be administered more than once; for example, the dosing regimen may include a booster dose. For instance, a booster dose of the drug formulation may be administered for a period of 7 days or longer, such as 8 days or longer, 9 days or longer, 10 days or longer, 11 days or longer, 12 days or longer, 13 days or longer, 14 days or longer, 3 weeks or longer, 4 weeks or longer, 1 month or longer, 2 months or longer, 3 months or longer, 4 months or longer, 5 months or longer, 6 months or longer, 7 months or longer, 8 months or longer, 9 months or longer, 10 months or longer, 11 months or longer, 1 year or longer, 2 years or longer, 3 years or longer, 4 years or longer, or 5 years or longer.

[0108] Implementation Plan

[0109] The present invention provides the following implementation schemes:

[0110] (1) An influenza virus comprising PA, NP and NS gene segments, wherein (a) the PA gene segment contains thymine at nucleotide position 2272; (b) the NP gene segment encodes an NP protein having an amino acid sequence comprising selected amino acids, wherein the selected amino acids are serine at position 40, asparagine or glycine at position 161, threonine at position 204 and optionally valine at position 93; and (c) the NS gene segment contains guanine at nucleotide position 39 and the NS gene segment encodes an NS1 protein having an amino acid sequence comprising selected amino acids, wherein the selected amino acids are glutamine at position 176.

[0111] (2) The influenza virus as described in embodiment 1, wherein the PA gene segment has a nucleotide sequence represented by SEQ ID NO: 10.

[0112] (3) The influenza virus as described in embodiment 1 or 2, wherein the NP gene segment has a nucleotide sequence represented by SEQ ID NO: 11.

[0113] (4) The influenza virus as described in any one of embodiments 1-3, wherein the PA gene segment encodes a PA protein having the amino acid sequence SEQ ID NO: 15.

[0114] (5) The influenza virus as described in any one of embodiments 1-4, wherein the NP gene segment encodes an NP protein having the amino acid sequence SEQ ID NO: 16.

[0115] (6) The influenza virus as described in any one of embodiments 1-5, wherein the NS gene segment has a nucleotide sequence represented by SEQ ID NO: 12.

[0116] (7) The influenza virus as described in any one of embodiments 1-6, wherein the NS gene segment encodes the NS1 protein having the amino acid sequence SEQ ID NO: 17.

[0117] (8) The influenza virus as described in any one of embodiments 1-7, wherein the selected amino acid is conserved in at least one of the NP and NS proteins after at least 10 consecutive passages in the Vero cell line.

[0118] (9) The influenza virus as described in any one of embodiments 1-8, wherein the selected amino acid is conserved in at least one of the NP and NS proteins after at least 10 consecutive passages in a Vero cell line that stably expresses the BM2 ion channel protein of influenza B virus.

[0119] (10) The influenza virus as described in any one of embodiments 1-9, wherein the influenza virus is a recombinant influenza virus.

[0120] (11) The influenza virus as described in any one of embodiments 1-10, wherein the virus further comprises the PB gene segment.

[0121] (12) The influenza virus as described in any one of embodiments 1-11, wherein the virus further comprises the NA gene segment and the HA gene segment.

[0122] (13) The influenza virus as described in embodiment 12, wherein the HA gene segment encodes an HA protein having an amino acid sequence containing at least one amino acid mutation in HA2.

[0123] (14) The influenza virus as described in embodiment 13, wherein the at least one amino acid mutation in HA2 is glutamic acid at position 61.

[0124] (15) The influenza virus as described in embodiment 13, wherein the at least one amino acid mutation in HA2 is glutamic acid at position 112.

[0125] (16) The influenza virus as described in any one of embodiments 1-15, wherein the PA, NP and NS gene segments are derived from a single influenza virus strain.

[0126] (17) The influenza virus as described in embodiment 16, wherein the HA gene segment is derived from an influenza strain that is different from the single influenza strain from which the PA, NP and NS gene segments originate.

[0127] (18) The influenza virus as described in embodiment 16 or 17, wherein the NA gene segment is derived from an influenza strain that is different from the single influenza strain from which the PA, NP and NS gene segments originate.

[0128] (19) The influenza virus as described in any one of embodiments 1-18 further comprises a mutated M gene segment.

[0129] (20) The influenza virus as described in embodiment 19, wherein the influenza virus does not encode a functional M2 protein.

[0130] (21) The influenza virus as described in any one of embodiments 1-20, wherein the virus is capable of replicating in human cells.

[0131] (22) The influenza virus as described in any one of embodiments 1-21, wherein the virus has enhanced growth compared to an influenza virus that is identical in Vero cells under the same conditions except for the absence of the selected amino acids.

[0132] (23) A pharmaceutical preparation comprising the influenza virus described in any one of embodiments 1-22.

[0133] (24) The pharmaceutical preparation as described in embodiment 23, wherein the pharmaceutical preparation is a vaccine.

[0134] (25) The pharmaceutical formulation as described in embodiment 24, wherein the vaccine is formulated as a monovalent vaccine.

[0135] (26) The pharmaceutical formulation as described in embodiment 24, wherein the vaccine is formulated as a bivalent vaccine.

[0136] (27) The pharmaceutical preparation as described in embodiment 24, wherein the vaccine is formulated as a trivalent vaccine.

[0137] (28) The pharmaceutical preparation as described in embodiment 24, wherein the vaccine is formulated as a quadrivalent vaccine.

[0138] (29) A method for inducing an immune response in a mammal, the method comprising administering to the mammal any of embodiments 1-22 of the influenza virus or any of embodiments 23-28 of the pharmaceutical preparation thereof, thereby inducing an immune response against the influenza virus in the mammal.

[0139] (30) The method as described in embodiment 29, wherein the mammal is a human.

[0140] (31) A method for generating an influenza virus according to any one of embodiments 1-22, the method comprising continuously passaged the influenza virus in a Vero cell line. Example

[0141] The following embodiments further illustrate the invention, but should not be construed as limiting its scope in any way.

[0142] Example 1

[0143] This embodiment demonstrates the successful isolation of the growth-enhancing influenza B NP D161N mutation of an unknown lineage.

[0144] Two influenza B vaccine candidates, BM2SR strains lacking the BM2 ion channel function necessary for multi-cycle replication, were constructed in permitted BM2Vero cells constitutively overexpressing cDNA encoding BM2 from influenza B / Lee / 40 using a plasmid-based virus rescue procedure (see, e.g., Neumann et al., PNAS, 96:9345-9350 (1999)). Two segments encoding the major antigens hemagglutinin (HA) and neuraminidase (NA) were derived from the Victoria lineage (VL) strain B / Brisbane / 60 / 2008 (Bris60) and the Yamagata lineage (YL) strain B / Wisconsin / 01 / 2010 (WI01), both of which are WHO-recommended for vaccination against seasonal influenza B. The BM2-deficient segment was obtained by engineering the BM2 transmembrane H+ channel of influenza B / Florida / 4 / 2006M segment to: (1) remove the BM2 transmembrane H+ channel, (2) introduce multiple stop codons in all translation reading frames, and (3) maintain the genetic stability and correct expression of the M1 polypeptide of the native RNA structure. Five of the eight genomic segments (i.e., PA, PB1, PB2, NP, and NS) were obtained by selecting VL and YL strains with enhanced high-yield growth during in vitro Vero cell culture from the influenza B / Yamagata / 1 / 73 viral library (Ping et al., 2016, ibid.). After three passages (P3) in BM2Vero, the complete nucleotide sequence of each BM2SR strain was verified by Sanger sequencing of cDNA amplified from all eight segments by reverse transcriptase-polymerase chain reaction (RT-PCR). The sequences of all eight viral segments were identical to the sequences of the eight RNA segment expression plasmids used to rescue the virus from YL and VL.

[0145] The vaccine candidates Bris60(VL) and WI01(YL)BM2SR P3 strain were then passaged an additional 10 times at low multiple of infection (MOI), for a total of 13 passages (P13). After each passage, the 50% infectious dose (TCID) was determined by tissue culture. 50 Viral titers were determined in modified MDCK cells that allowed BM2SR replication (BM2CK, Hatta et al., J. Virol., 78(11):5576-5583(2004)). The titers were determined using MOI = 0.001 TCID. 50Equivalent / BM2Vero cell infection was performed to allow for multiple-cycle replication in each subsequent passage. After 10 passages of multi-cycle viral replication, the nucleotide sequences of both P13 strains were obtained again. The sequences of the P13 VL and YL strains were compared with those of the P3 strain to identify potential adaptive mutations. Only one mutation, either identical in VL and YL or unknown in the influenza B lineage, was identified in the viral genomes from three independent passage experiments. The unique unknown mutation is g540a in segment 5 of the influenza B genome, which encodes a substitution of aspartic acid 161 to asparagine in the nucleoprotein (NP D161N).

[0146] The initial high-yield (HY) sequence of the B / Yamagata / 1 / 73 segment differs for two segments in the VL and YL P3 strains: nucleoprotein (NP) segment 5 and non-structural protein (NS) segment 8. In P3, Bris60 (VL) encodes NP P40S / M204T, NSg38insg, while WI01 (YL)BM2SR contains NP-P40S and NS a39g, NS1-K176Q (Ping et al. 2016, ibid.). After prolonged passages, it was found that VL NP segment 5 encodes NP P40S / D161N / M204T, and YL segment 5 encodes NP P40S / D161N. The same D161N mutation is present in both strains. The segregation of the same substitution is not random, therefore D161N promotes the growth of influenza B virus in cultured Vero cells. This is contrary to the lineage-specific mutations of high-growth viruses in Vero cells (Ping et al. 2016, ibid.).

[0147] In addition to obtaining the HA and NA segments from B / CA / 12 / 2015(YL), a third passage experiment was performed using the same BM2SR single-replication vaccine viral backbone. After 6 passages, another NP segment nucleotide mutation a541g was isolated, which resulted in a similar aspartic acid 161 to glycine substitution D161G. This example demonstrates that site 161 is associated with high-yield growth in Vero cultures.

[0148] The NP D161N mutation and the HA1 N211T mutation, known to improve the growth of influenza B YL in cultures, were added to B / CA / 12 / 2015HA. HA1 N211T increased growth rate and titer. The NP D161N mutation and HA1 N211T are synergistic, and as... Figure 1 The result shows that the time to reach the maximum titer will be reduced by 1 day.

[0149] Another influenza B NP mutation, a336g, encoding NP M93V, was isolated multiple times, but only when HA and NA originated from VL. A mixture of g1164r encoding a mixture of WT and NP V369I was also isolated once.

[0150] Example 2

[0151] This example demonstrates the successful growth of an influenza B strain containing the influenza B NP D161N adaptive mutation.

[0152] Using a plasmid-based virus rescue procedure (Neumann et al., ibid.), multiple candidate influenza B BM2SR strains were constructed in permitted BM2Vero cells constitutively overexpressing cDNA encoding BM2 from influenza B / Lee / 40, lacking the BM2 ion channel function necessary for multi-cycle replication. Two segments encoding hemagglutinin (HA) and neuraminidase (NA) antigens were derived from the Victoria lineage (VL) strain B / CO / 06 / 2017 (CO06), which is recommended by the World Health Organization (WHO) for vaccination against seasonal influenza B. By engineering the M segment of influenza B / Florida / 4 / 2006 to: (1) remove the BM2 transmembrane H+ channel, (2) introduce multiple stop codons in all translation reading frames, and (3) maintain the genetic stability and correct expression of the M1 polypeptide of the native RNA structure, four of the seven or eight genomic segments (PA, PB1, PB2, and NS) were obtained by selecting VL strains with enhanced high-yield growth during in vitro Vero cell culture from the influenza B / Yamagata / 1 / 73 viral library (Ping et al., 2016, ibid.).

[0153] These six strains differed only in the segment 5 nucleoprotein (NP) and contained three high-yield mutations isolated from influenza B NP sequences obtained after passage in BM2Vero cells. Three strains carrying a single amino acid substitution in NP:P40S, D161N, or M204T were prepared. A control wild-type NP strain without NP substitutions was prepared. Finally, strains carrying two variations of D161N / M204T and strains with all three mutations were constructed. After two passages (P2) in BM2Vero, the nucleotide sequences of the NP and BM2SR segments of each strain were verified by Sanger sequencing of cDNA amplified from all eight segments by RT-PCR.

[0154] To compare growth characteristics, each virus was passaged three times in BM2Vero. Cultures were sampled daily for four consecutive days following inoculation at MOI = 0.001, and aliquots were frozen at -80°C for subsequent analysis using BM2CK TCID. 50 Analysis of the measurements. The average of three repeated measurements each day was calculated and plotted on a graph. Figure 2 Each of the individual mutations contributes to growth benefits, but the D161N mutation alone has the greatest effect. When D161N combines with M204T, the double-mutant strain achieves faster growth kinetics compared to the wild type and the single mutant. The triple mutant exhibits rapid kinetics and reaches the highest maximum titer within 4 days compared to the double mutant. Therefore, D161N is a growth-enhancing NP mutation that synergizes with other known NP substitutions to allow influenza B strains to grow more rapidly and reach even higher maximum titers.

[0155] Example 3

[0156] This example demonstrates the stability of the influenza B NS segment during culture passage.

[0157] It is known that the function of NS1 is unnecessary for influenza B virus culture in Vero cells in vitro. During passage experiments, various mutations accumulated in the NS region. However, these mutations were not completely resolved, and they were observed to be a mixture with the initiation sequence.

[0158] Many mutants are polynucleotide sequence extensions. In the sequence read of the B / Brisbane / 60 / 2008BM2SR4 P13 NS segment carrying g38insg, a mixture of polyA7 to polyA8 extensions, i.e., AAAAAAAUG (SEQ ID NO:2) to AAAAAAAAUG (SEQ ID NO:3), was found precisely in the 5' UTR (mRNA-sense) of AUG (SEQ ID NO:1). Cultured to P6 with the B / CO / 06 / 2017 strain carrying NS g38insg, it also exhibited a polyA7 to A8 extension in reverse combination with the published g38insg HY promoter mutation. These sequencing data show a complex mixture of sequences in the 5' UTR, indicating that NS g38insg is unstable in these experiments.

[0159] The B / CA / 12 / 2015BM2SR strain, carrying the g38insg NS segment, was passaged six times, and a mixture of polyA6 to polyA7 extensions at position 569 was observed in the initial WT NS1 sequence. The 569_570insA mutation produces a truncated NS1 protein with a 4-residue C-terminal extension of 176 amino acids. This mutation is located at the same polyA6 site as the previously identified NSHY mutation a570c encoding K176Q. After passage, P3, P5, and P6 genomic RNAs were extracted from the viral culture supernatant and then subjected to RT-PCR to amplify cDNAs from all eight genomic segments. Figure 3 The sequence chromatography data presented indicate that the length of the polyA segment at base pairs 570-574 in the NS region 8 increased from 5 nucleotides to 6 nucleotides over passage time. The frequency of the NS569_570insA mutation increased from approximately 20% to approximately 50% of the mutants in subsequent passages, suggesting that the mutation is beneficial for growth in Vero cells.

[0160] The NS 569_570insA mutation (SEQ ID NO:4) results in a translational frameshift in the NS1 open reading frame (ORF) after amino acid K176. The frameshift induces a fusion of four new amino acids, KGYT (SEQ ID NO:5), followed by a TAA stop codon (SEQ ID NO:6). Thus, a 176-amino acid truncated NS1 protein with a 4-residue C-terminal extension is expressed as a 180-amino acid peptide (SEQ ID NO:7, where X is any amino acid, including G, R, or V). In this embodiment, X is G. Splicing and expression of the NEP ORF are unaffected by this mutation.

[0161] The truncation of the 105 amino acids at the C-terminus of influenza B, which consists of 281 residues, may eliminate some or all of the NS1 function. NS1 has several functions, including repurposing host mRNA metabolisms such as polyadenylation and splicing, and preventing innate immune responses in host cells that depend on interferon, such as the induction of RIG-1. Cultured Vero cells lack interferon responses, which allows influenza strains, even those completely lacking NS1, to proliferate in this cell line. The deletion of the NS1 C-terminus favors the growth of the BM2SR backbone in Vero, and this mutation can enhance the production of vaccine material. The K176Q mutation can promote genetic stability at this site by inserting a G into the polyA6 run.

[0162] B / WI / 01 / 2010BM2SR4 containing K176Q was passaged to P13, yielding a mixture of NP sequences. The sequence of segment 8 was identical to the starting plasmid, which contained K176Q in approximately 70% of the sequence. The remaining sequence contained a 25 bp deletion from the NS1 ORF, 416del25, in approximately 30% of the sequence. This deletion resulted in a 135 AA NS1 truncated mutant with a 158-residue truncation after P123 followed by 12 new amino acids (AA). These data suggest that the NS segment a39g K176Q is generally more stable. Testing in BM2Vero cells showed that the combination of the NS a39g K176Q segment and the NP D161N HY mutation improved stability. The B / CA / 12 / 2015 strain, containing the NS a39g K176Q and NP P40S D161N M204T regions, was passaged 10 times in BM2Vero cells. No NS or NP mutations were observed, indicating improved stability when two HY regions were combined.

[0163] Example 4

[0164] This example demonstrates the isolation of the adaptive influenza B virus HA mutation during culture passage.

[0165] Multiple BM2SR strains from VL and YL were passaged in BM2Vero cells, and the nucleotide sequence of the HA region was determined. No silent mutations without altering the coding sequence were characterized. Eighteen mutations altering amino acids at 14 sites were identified in the HA region (Table 1). The mutations fell into two main categories. Mutations in HA1 were typically located directly at well-known N-linked glycosylation sites at N209 (WA02 VL) / N210 (CO / 06 VL) / N211 (YL) or near residues important for glycosylation enzyme recognition. Most isolated mutations were located in the HA2 coil-coil region. Two HA2 mutations stood out. The HA a1294g mutation was observed in multiple experiments passaged from the B / CO / 06 / 2017 BM2SR strain, independent of NP or NS region identity. Glycosylation site adaptation may influence the affinity of HA for binding to target Vero cells. Changes in the HA2 coil-coil are thought to affect the pH-dependent conformational changes required for HA fusion with the target cell membrane. Table 1. HA segment mutations isolated from BM2SR passages in BM2Vero cells and HA2 mutations introduced at the same site.

[0166]

[0167] * = Compared to Bris / 60 / 2008HA0 (with no change in HA2 number), the number of HA0 amino acids differs between strains due to the absence of 1, 2, or 3 amino acids in HA1 of the new strain.

[0168] @ = Introduced mutation

[0169] Compared to influenza B / Bris / 60 / 2008HA1, different influenza B lineages and strains may have different numbers of amino acids due to the sequential deletion of 1, 2, or 3 amino acids (depending on the year) in the influenza B VL HA1 gene segment and the deletion of one AA in the influenza B YL HA1 gene segment. Amino acids marked with an asterisk in Table 1 indicate that mutations can occur at different locations in different strains. Table 2 shows examples of different locations of amino acid mutations occurring in different strains. Some isolated mutations were introduced into the HA of other strains, and their growth-enhancing effects were tested.

[0170] Table 2. HAO positions of certain amino acid mutations identified in each strain in Table 1.

[0171] <![CDATA[N209S a,b,c ]]> <![CDATA[N210T a,b ]]> <![CDATA[N211T a,b ]]> <![CDATA[N212D b ]]> <![CDATA[K420E c ]]> <![CDATA[K421E a ]]> <![CDATA[K422E c ]]> <![CDATA[K423E a ]]> <![CDATA[D471G d ]]> <![CDATA[D472G a ]]> <![CDATA[D473G c ]]> <![CDATA[D474G d ]]> <![CDATA[D471E d ]]> <![CDATA[D472E d ]]> <![CDATA[D473E c ]]> <![CDATA[D474E d ]]> <![CDATA[D471N d ]]> <![CDATA[D472N d ]]> <![CDATA[D473N c ]]> <![CDATA[D474N d ]]>

[0172] a Separated at FluGen.

[0173] b From a sequence database, egg-passaged strain.

[0174] c Introduced.

[0175] d Undetermined.

[0176] Example 5

[0177] This example demonstrates the rescue effect of the influenza B virus HA adaptive mutation on the influenza B / WA / 02 / 2019M2SR(VL) strain.

[0178] Three versions of cDNA encoding the influenza HA region 5 of the WHO-recommended vaccine strain B / WA / 02 / 2019(VL) were synthesized and inserted into an RNA expression plasmid vector for virus rescue based on influenza B plasmids. The first HA version encodes the wild-type (WT) HA protein sequence obtained directly from primary isolates from influenza patients. The WT HA has an intact N209 glycosylation site in HA1. Passaging of the influenza B / WA / 02 / 2019(VL) strain in cell or egg cultures resulted in the loss of glycosylation at this site, primarily through N209S substitution (GISAID). The second plasmid encodes the mutant HA2 K61E (K421E) obtained from passage of the B / CO / 06 / 2017 strain. A double mutant of HA2K61E with added glycosylation and subtracted N209S was also constructed.

[0179] A standard plasmid-based virus rescue procedure using three types of HA plasmids was employed to construct B / WA / 02 / 2019BM2SR(VL) virus via transfection into BM2Vero cells. Both single and double mutant HA plasmids supported the rescue of BM2SR virus, but the intact WT HA sequence did not produce viable virus (LOD = log...). 10 0.67TCID 50 / mL). Two successful candidate vaccines were passaged into P2 in BM2Vero, and the HA sequence was confirmed. Figure 4 As shown in Table 3, the virus was passaged to P3 at MOI = 0.01, and aliquots were frozen daily for TCID viral titer determination. 50 Determination. A single mutant strain with the K420E (K61E HA2) mutation grew well, allowing the glycosylated strain to reach its maximum log value of 7.67 within 3 days. 10 TCID 50 / mL. The double-mutant sugar-HA strain grows faster, but reaches a similar log [value] within 2 days. 10 Peak titer of 7.50.

[0180] Table 3. Growth of the B / WA / 02 / 2019BM2SR strain with HA1 and HA2 mutations (LOD = log 10 0.67TCID 50 / mL)

[0181]

[0182] Example 6

[0183] This example demonstrates the growth of the influenza B / CA / 12 / 2015BM2SR(YL) strain with an influenza B HA adaptive mutation.

[0184] Eight versions of cDNA encoding the influenza HA region 5 of the WHO-recommended vaccine strain B / CA / 12 / 2015(YL) were synthesized and inserted into an RNA expression plasmid vector for reverse genetic rescue of influenza B, resulting in four HA mutant strains. These four HA mutant strains were derived from Vero passages containing five mutations at four HA2 residues: 1.) N51D and D61E; 2.) D90N; 3.) D112E; and 4.) D112K, all combined with the HA1 glycosylation site mutation N211T. The HA2 N51D, K61E mutations obtained through passage B / CO / 06 / 2017 promoted growth, but only when combined with N211T. The HA2 D90N and D112K mutations obtained through passages of influenza A H3N2 in Vero impaired growth, or had no effect when combined with N211T. D112E (D473E) is advantageous, conferring faster growth to maximum titer, regardless of the glycosylation site N211, as... Figure 5 As shown.

[0185] Example 7

[0186] This embodiment further demonstrates the growth of the influenza B / CA / 12 / 2015BM2SR strain with an influenza B HA adaptive mutation.

[0187] The HA2 D112 site in influenza B YL has a significant impact on growth in culture. Independent of the glycosylation site N211, the HA2 D112 mutation D473E (D112E) is beneficial for influenza BM2SR, conferring faster growth to maximum titer than other B / CA / 12 / 2015(YL) HA2112 mutants, thus leading to further substitutions of HA2 D112G and HA2 D112N. These HA2 mutations are mutations at the E112 position of the HA2 site in influenza A, which confer amantadine resistance and significantly increase the pH at which conformational changes in the HA spike protein can occur (Byrd-Leotis et al., J.Virol., 89(8):4504-4516(2015)). HA2D112G has been shown to function in every influenza A HA background tested. For influenza B, such as Figure 6 As shown, HA2D112G and HA2D112N are beneficial and, when combined with N211, synergistically enable faster growth to the maximum titer.

[0188] Example 8

[0189] This example further demonstrates the successful isolation of other adaptive influenza B HA mutations during passage culture.

[0190] Based on the previous examples, additional adaptive influenza B HA mutations were isolated during subculture. These mutations are summarized in Table 4 below.

[0191] Table 4

[0192]

[0193] Example 9

[0194] This example demonstrates that the BM2SR virus induces an antibody response against the influenza B virus formulated in a multivalent vaccine.

[0195] When formulated into monovalent, bivalent, trivalent, or quadrivalent vaccines, influenza BM2SR-Vic or BM2SR-Yam viruses (containing PB1, PB2, PA, NP, NS, and M gene segments with nucleotide sequences represented by SEQ ID NO: 8, 9, 10, 11, 12, and 18, respectively) elicit an antibody response.

[0196] Seven-week-old female BALB / c mice (N=8) were intranasally immunized with monovalent BM2SR-Vic, monovalent BM2SR-Yam, bivalent BM2SR, trivalent BM2SR-Vic+BM2SR-Yam+M2SR-H1N1, trivalent BM2SR-Vic+BM2SR-Yam+M2SR-H3N2, or quadrivalent BM2SR-Vic and BM2SR-Yam, as well as M2SR-H1N1 and M2SR-H3N2 vaccines. Control mice were immunized with SPG buffer (sucrose phosphate glutamate buffer). Twenty-eight days after vaccination, mice were intranasally immunized with a booster consisting of the same vaccine administered for the primary immunization. Serum samples were collected on days 7, 14, and 21 after primary immunization, and on days 35, 42, and 49 after booster immunization (day 28). Serum IgG antibody titers against influenza B-Vic HA and influenza B-Yam HA were determined by ELISA from serum samples.

[0197] The obtained data on anti-influenza B-Vic HA were in Figure 7A The obtained data on anti-influenza B-Yam HA antibodies were in... Figure 7B The results showed that all vaccines were able to raise anti-influenza virus antibodies above the SPG control, and these increases were comparable across vaccine formulations. These results also indicated that there was no interference between the monovalent components when formulating multivalent vaccines.

[0198] Example 10

[0199] This example demonstrates that intranasal administration of monovalent or quadrivalent M2SR vaccines protects mice from lethal influenza B virus not present in the vaccine.

[0200] Seventy days after the first immunization (6 weeks after the booster immunization), mice were administered a lethal dose of influenza B / Malaysia / 2506 / 2004 (Vic) virus (>10 mice at 50% lethal dose (MLD)). 50 )) BALB / c female mice as described in Example 9 were challenged. All mice immunized with either monovalent BM2SR-Vic (Influenza B / CO / 06 / 2017) or BM2SR-Yam (Influenza B / Phuket / 3073 / 2013) and the quadrivalent M2SR vaccine survived after challenge. Mice immunized with monovalent BM2SR-Vic, monovalent BM2SR-Yam, and the quadrivalent M2SR vaccine remained healthy and did not experience weight loss. The obtained weight loss data showed that Figure 8 In the control mice immunized with SPG alone, body weight decreased within 10 days post-challenge, and 4 out of 8 mice were infected. Lungs were obtained from 3 mice in each group on day 3 post-challenge, and viral load was determined by plaque assay in MDCK cells. As shown in Table 5, viral titers in the lungs of mice immunized with the monovalent BM2SR-Vic, monovalent BM2SR-Yam, and quadrivalent M2SR vaccines were below the detection limit (less than 76 plaque-forming units (PFU) per lung). Viral load (mean 6.86 log PFU / g) was detected in the SPG-only control mice. These results indicate that the monovalent and quadrivalent BM2SR vaccines confer cross-protection and limit replication of challenge viruses that do not match any vaccine component.

[0201] Table 5. Titer of the challenge virus in the lungs 3 days after challenge.

[0202]

[0203] Example 11

[0204] This example demonstrates that bivalent, trivalent, or quadrivalent M2SRs containing BM2SR components offer advantageous safety profiles compared to the superior protection against influenza viruses not included in the vaccine, as provided by licensed intranasal and licensed intramuscular inactivated influenza vaccines. The antigenically distinct monovalent BM2SR-Vic and monovalent BM2SR-Yam vaccines provided antigenically matched protection against lethal influenza B virus in mice.

[0205] Seven-week-old female BALB / c mice (N=13) were immunized with one of the following vaccines: monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent FGHY-M2SR, or FLUMIST. TM Quadrivalent (AstraZeneca, Wilmington, DE), FLUZONE TMQuadrivalent (Sanofi, Bridgewater, NJ) or Fluzone TM High dose (Sanofi). The strain components for each vaccine are shown in Table 6. BM2SR, M2S, and FLUMIST. TM Intranasal administration, and two types of FLUZONE TM The vaccine was administered intramuscularly. Control group mice were immunized intranasally with SPG. Any changes in body weight of the mice were observed 14 days post-immunization.

[0206] Table 6: Strain components of each vaccine

[0207]

[0208] The obtained weight loss data is shown in Figure 9 In China, monovalent BM2SR-Vic, monovalent BM2SR-Yam, tetravalent M2SR, and FLUZONE are used. TM Quadrivalent, Fluzone TM Mice immunized with the high dose or the SPG control did not experience weight loss during the 14-day period. These data suggest that the BM2SR vaccine has the same safety profile as licensed influenza vaccines.

[0209] Mice were immunized with a booster immunization on day 28 following the primary immunization. The booster immunization consisted of the same vaccine administered to the mice in the primary immunization. Serum samples were collected weekly after both the primary and booster immunizations, and the combined serum IgG titers against each vaccine component were determined by ELISA. The obtained serum IgG ELISA titers against influenza B-Vic HA are shown below. Figure 10A The obtained serum IgG ELISA titers against influenza B-Yam HA are shown in the figure. Figure 10B The obtained serum IgG ELISA titers against influenza A / H1 HA are shown in [the table / image / etc.]. Figure 10C The obtained serum IgG ELISA titers against influenza A / H3 HA are shown in [the table / image / etc.]. Figure 10D The results showed that all vaccines were able to increase serum IgG titers against influenza B-Vic HA and influenza B-Yam HA to above the SPG control, and these increases were comparable across vaccine formulations. (FLUZONE) TM tetravalent and FLUZONE TM High doses resulted in lower serum IgG titers against influenza B HA antigen compared to live vaccines.

[0210] Tracheal-lung lavage fluid was obtained from four mice / groups on day 49 after primary immunization (day 21 after booster immunization), and IgG and IgA titers were measured by ELISA to evaluate mucosal immune response. The obtained IgG titer data are shown below. Figure 11A The obtained IgA titer data are shown in... Figure 11B Middle. Tetravalent M2SR and FLUMIST TM The tetravalent vaccine elicited IgG and IgA titers against all tested antigens. Mice immunized with monovalent BM2SR-Vic and BM2SR-Yam showed IgG and IgA titers against the B-Vic and B-Yam HA antigens, but not against the H1 or H3 HA antigens. (The last sentence appears to be incomplete and possibly refers to a separate, unrelated statement about FLUZONE.) TM tetravalent and FLUZONE TM In the high-dose vaccine immunization group, IgG titers against all four antigens were elevated; however, no IgA antibody titers against any antigen were detected. These data suggest that the BM2SR vaccine elicits similar results to the licensed live attenuated influenza vaccine FLUMIST. TM A quadrivalent vaccine elicits a mucosal immune response, while licensed intramuscular influenza vaccines do not elicit any mucosal immune response.

[0211] Six weeks after booster immunization, mice were challenged with a lethal dose of influenza B / Malaysia / 2506 / 2004 (Vic). Four out of eight mice immunized with SPG as a control were infected on day 10 post-challenge, while all vaccine-treated mice survived. Changes in body weight following challenge were as follows: Figure 12 As shown. Mice receiving the monovalent BM2SR, tetravalent M2SR, and licensed vaccines remained healthy without weight loss, while surviving immunized mice lost approximately 25% of their body weight. (Except for FLUZONE) TM In addition to the quadrivalent vaccine, no challenge virus was detected in the lungs of the vaccinated groups on day 3 post-challenge (Table 7). BM2SR-Yam provided protection against lethal infection of influenza B / Malaysia, Victoria lineage. No infectious virus was detected in the lungs of mice immunized with BM2SR-Vic or BM2SR-Yam, or in any multivalent vaccine containing one or more BM2SR components (Table 7). Infectious virus was detected in the lungs of the original mimic-immunized mice. Virus was also detected in the nasal turbinates after challenge. The BM2SR groups (monovalent, bivalent, trivalent, or quadrivalent) had ≥2 log fewer viruses in the nasal turbinates than the mimic-immunized mice, indicating that intranasal administration of the vaccine compared to intramuscular administration (FLUZONE) was beneficial. TM The tetravalent and high-dose versions offer better protection against the excitatory virus, as shown in Table 7. Furthermore, BM2SR-Yam (monovalent or formulated with H1N1 or H3N2) provides better protection than FLUZONE. TM High dose (containing Yam) or Fluzone TM Tetravalent (containing Vic and Yam) provides better protection against Victoria lineage excitation.

[0212] These data suggest that intranasal administration of the BM2SR vaccine provides better protection against provocation in mice than intramuscular administration of the licensed inactivated vaccine.

[0213] Table 7. Viral titers in mouse organs after influenza B / Malaysia / 2506 / 2004 (Vic)

[0214]

[0215] Example 12

[0216] This example demonstrates that the production of BM2SR virus is scalable in BM2Vero cells used for production.

[0217] BM2Vero cells (Vero cells stably expressing influenza B BM2 protein) were cultured in a humidified incubator at 37°C and 5% CO2 atmosphere using OptiVero medium (InVitria, Aurora, CO). Cell stacks were infected in OptiVero medium with BM2SR-Vic virus encoding the HA and NA genes of influenza B / Colorado / 06 / 2017 (Vic) or BM2SR-Yam virus encoding the HA and NA genes of influenza B / California / 12 / 2015 (Yam) at a multiplicity of infection (MOI) of 0.01. TM Approximately 242 million cells were cultured in five culture chambers (CS5; Corning, Corning, NY) (2-4 chambers per batch). After 2-3 days at 35°C and 5% CO2, when the HA titer of the supernatant reached at least 32 HAU / 50 μL, the culture medium was harvested and cells and cell debris were removed by low-speed centrifugation. The supernatant was further clarified and sterilized by vacuum filtration through a 0.2 μM pore PES membrane. The clarified supernatant was then treated with a nonspecific RNA and DNA nuclease (BENZONASE). TM Enzonase (5 units / mL) was used to treat residual cellular RNA and DNA at 37°C for 2 hours. Then, a 235 cm⁻¹ solution was used. 2 300kDMWCO modified polyethersulfone (mPES) MIDIKROS TM Hollow fiber filter module (Repligen, Waltham, MA) purifies benzenease via tangential flow filtration (TFF). TMBenzonase digested the material. The material was concentrated 10 to 20 times. Then, contaminating host cell proteins (HCPs) and residual DNA fragments were removed by percolation using at least 15 column volumes of SPG. The purified virus in the SPG buffer was further concentrated 10 to 100 times by ultracentrifugation at 25,000 rpm in a 25% sucrose phosphate-buffered saline (PBS) pad. The resulting viral pellet was resuspended in SPG, aliquoted, and then rapidly frozen in liquid N2 and stored at -80°C.

[0218] The sequence homology of the concentrated and purified BM2SR-Vic and BM2SR-Yam genes was compared with the sequence homology of the reference sequence in the viral seed stock. Viral RNA extracted from the purified virus was subjected to RT-PCR to generate cDNA, which was then subjected to Sanger sequencing. Analysis of the ORF encoded by the eight viral segments showed that all segments had 100% nucleotide sequence identity with the reference.

[0219] Infection with 50% tissue culture dose (TCID) 50 The infection titers of concentrated and purified BM2SR-Vic and BM2SR-Yam viruses were determined using at least three independent measurements in BM2CK cells (MDCK cells stably expressing influenza B BM2). In this procedure, serial dilutions of the vaccine sample were applied to replicated BM2CK cells in 96-well plates and cultured for 4 days at 35°C under a 5% CO2 atmosphere. Four days post-inoculation, cell monolayers were visually inspected and scored against CPE. Virus titers were calculated using the Reed & Muench method and expressed as TCID. 50 / mL. Additionally, HA activity was tested in aliquots of the supernatant from each well to verify the viral titer determined by CPE. As shown in Table 8, after concentration and purification, the BM2SR virus consistently reached 10. 8.6 High titers above TCID50 / mL.

[0220] Table 8. Virus titers after concentration and purification

[0221]

[0222] To confirm that the BM2SR vaccine virus maintained a replication-deficient phenotype after concentration and purification, the presence of any replicating virus was evaluated by performing three consecutive passages in MDCK cells, which were permissible for wild-type influenza virus but not for BM2SR virus. In the first round of infection, the test virus was serially diluted and inoculated onto a cell monolayer. The infected cells were then cultured for 4 days at 35°C under a 5% CO2 atmosphere. The supernatant of the infected cell culture was then transferred to a fresh MDCK monolayer and incubated for 4 days at 35°C under a 5% CO2 atmosphere. For the third and final rounds of passage, the culture medium of the infected cells was transferred to another fresh MDCK monolayer and incubated for another 4 days at 35°C under a 5% CO2 atmosphere. CPE of the MDCK cells was observed after each 4-day incubation at 35°C, and HA activity in the culture supernatant was measured to confirm the presence of progeny virions. For each round of infection, the replication-deficient reference virus B / California / 12 / 2015 BM2SR batch was used as a positive control. The negative control inoculum consisted solely of culture medium. The results showed that the control proceeded as expected, and no infectious progeny were detected after inoculating normal cells with any of the four test samples. Therefore, it is demonstrated that the BM2SR vaccine viral preparation is non-replicating and cannot replicate.

[0223] The sterility of the vaccine formulations was verified using a WHO-standard procedure based on the pharmaceutical formulation. The vaccine formulations were inoculated under aseptic conditions into three types of liquid culture media: Luria-Bertani broth (LB), trypsin-soy broth (TSB), and thioglycolate (TGM). Cultures were grown at 37°C (LB and TSB) and ambient temperature (TGM). Cultures were allowed to grow for 14 days, after which microbial growth was visually assessed. All tested formulations showed negative microbial growth under all growth conditions.

[0224] Example 13

[0225] This embodiment demonstrates that the BM2SR skeleton is attenuated, does not detach, and does not spread in ferret models.

[0226] M2SR viruses are recombinant influenza A viruses that do not express the functional M2 protein, encoding, for example, the HA and NA genes of influenza A / Brisbane / 10 / 2007-like A / Uruguay / 716 / 2007 (H3N2) or A / California / 07 / 2009 (H1N1pdm). BM2SR viruses are recombinant influenza B viruses that do not express the functional BM2 protein, encoding, for example, the HA and NA genes of B / Brisbane / 60 / 2008 (Victoria) or B / Wisconsin / 01 / 2010 (Yamagata). A tetravalent M2SR, also referred to herein as M2SR Quad, consists of two M2SR viruses encoding the HA and NA genes of A / H1N1, A / H3N2, B / Victoria, and B / Yamagata, and two BM2SR viruses.

[0227] Animals and Animal Care. Male ferrets purchased from Triple F Farms were placed in the study. The animals were approximately 4 months old at the start of the study. The supplier certified that the animals were healthy and free of antibodies against infectious diseases. Upon arrival, the animals were individually housed in hanging wire cages with slatted bottoms, suspended from waste trays lined with paper. Animal rooms and cages were cleaned and disinfected prior to animal acceptance, in accordance with recognized animal care practices and relevant standard operating procedures. Certified Teklad Global Ferret Diet #2072 (Teklad Diets, Madison, WI) and water were provided as needed and changed at least three times a week. Fluorescent lighting in the animal rooms was maintained on a 12-hour light / dark cycle. During the study, room temperature and relative humidity were maintained within their respective protocol limits and within the ranges of 20.0–25.0°C and 30–63%, respectively.

[0228] Animal isolation and randomization. Ferrets were isolated for 7 days prior to randomization and observed daily. Based on daily observations of the indicator animals' general good health, the ferrets were released from isolation for randomization and testing. After isolation, the ferrets were weighed and their weights were calculated based on the average values ​​of similar groups (TOXDATA). TM 2.1.E.11 version (PDS Pathology Data Systems, Inc., Basel, Switzerland) Ferrets were assigned to treatment groups using a computerized randomization procedure based on their body weight. Within each group, all weights were within 20% of their mean. Animals selected for the study were assigned permanent identification numbers via ear tags and transponders, and individual cage cards were also used to identify the study animals by their individual numbers and groups. The assigned identification numbers were unique throughout the study.

[0229] Pre-study animal procedures. All animal procedures were performed in a biosafety level-2 facility according to protocols approved by the Animal Care and Use Committee at the IIT Institute. Ferrets were monitored for 3 days prior to vaccination to measure weight and establish baseline body temperature. Temperature readings were recorded daily via a subcutaneously implanted transponder (BioMedic data systems, Seaford, DE) in each ferret. Blood was collected prior to the start of the study, and serum was tested for influenza antibodies. Serum samples prior to vaccination were treated with receptor-destroying enzymes (RDE) to remove nonspecific inhibitors, then serially diluted and tested for definitive amounts of influenza A / California / 07 / 2009 (H1N1 pdm), A / Switzerland / 9715293 / 2013 (H3N2), B / Brisbane / 60 / 2008 (Victoria lineage), and B / Wisconsin / 01 / 2010 (Yamagata lineage), and mixed with 0.5% turkey erythrocytes or 0.75–1.0% guinea pig erythrocytes. Antibody titer was defined as the lowest serum dilution that caused inhibition of hemagglutination. Only ferrets with HAI (hemagglutination inhibition) titers below 40 were considered seronegative and used in this study. The study animals were randomly assigned to the groups described below.

[0230] To evaluate the attenuation effect of the BM2SR vaccine virus, on day 0 of the study, a group of three ferrets were anesthetized and intranasally injected with a single dose of 1×10⁻⁶. 8.2 TCID 50 The B / CO / 06 / 2017(Vic) BM2SR virus. A single target dose of 1×10⁻⁶ is used. 7.4 TCID 50Wild-type B / Brisbane / 60 / 2008 (Vic) virus was inoculated into a control group (3 ferrets). Body weight was recorded daily following exposure on day 0, and body temperature was monitored for changes in body temperature 6 hours post-exposure, then daily thereafter. Survival checks were recorded twice daily. On day 3, animals (3 animals per group) were euthanized, and tissue samples were collected from the following areas: nasal turbinates, trachea, lungs, kidneys, olfactory bulb, brain, liver, spleen, and intestines. A portion of the collected samples was fixed in buffered neutral formalin for histological evaluation, and another portion was stored at ≤-65°C for virus titration. The tissues collected for titration include: the right nasal turbinate, the upper third of the trachea, the right cranial lung lobe (if it is of sufficient size) or a lobe with gross lesions (if only one lobe has lesions, that lobe is processed for histology, and the viral titer is determined from any other lobe. If lesions are present in multiple lobes, one lobe is collected for viral titer and another for histology), the right kidney, the right olfactory bulb, the right brain, the right lobe of the liver, the right half of the spleen (the distal part of the spleen is observed upon opening the abdominal cavity), the small intestine, and the large intestine.

[0231] Although using 1×10 7.4 TCID 50 One ferret vaccinated with wild-type influenza B / Brisbane / 60 / 2008 (Vic) had an elevated body temperature (2.2°C) on day 1 post-vaccination, but two other ferrets vaccinated with wild-type virus, along with those vaccinated with 1×10⁻⁶ virus, showed no improvement. 8.2 TCID 50 Three ferrets inoculated with the BM2SR virus of B / CO / 06 / 2017(Vic) did not develop fever within 3 days of administration. The ferrets used in the study did not lose or gain more than 2.8% of their body weight. All six ferrets were euthanized, and viral load in organs was titrated. As shown in Table 9, wild-type influenza B / Brisbane / 60 / 2008(Vic) was detected in the upper respiratory tract, including the nasal turbinates and trachea, and in the brain. No virus was detected in any organs of the ferrets inoculated with the BM2SR virus.

[0232]

[0233] To assess the likelihood of BM2SR propagation in the ferret model, a 1×10⁻⁶ m² / h² ... 8.2 TCID 50 Dosage level of influenza B / CO / 06 / 2017 (Vic) BM2SR vaccine or 1×10 7.4 TCID 50The control wild-type influenza B / Brisbane / 60 / 2008 (Vic) virus was intranasally inoculated into the original donor ferrets. Twenty-four hours later, each donor ferret was placed in the same net cage (double-feeding) with one original ferret (direct contact). The additional original ferret (aerosol contact) was placed in a separate adjacent net cage (single-feeding) in the transmission room, 10–12 cm away from the donor cage. This distance prevented aerosol contact from physical contact with infection and direct contact, allowing only airborne and respiratory droplets to be shared between the ferrets. The ferrets' body temperature, weight, and clinical signs were monitored daily for 7 days post-inoculation. Nasal washes were collected from all inoculated donor ferrets on days 1, 3, 5, 7, and 9, and from all contact ferrets on days 2, 4, 6, 8, and 10. Nasal washes and serum were collected from all ferrets on day 14.

[0234] At any point in time, no virus was detected in the nasal washes of the three BM2SR vaccine virus donor ferrets and those from direct and aerosol contact with the ferrets. Figure 13A No ferrets in the BM2SR vaccine virus group exhibited fever, weight loss, or any clinical symptoms. Wild-type influenza B (Bris / 60 / 2008) was detected in nasal washes from wild-type virus donor ferrets on days 1, 3, and 5 post-vaccination. Figure 13B Although no ferrets showed changes in body temperature, weight, or clinical symptoms, all ferrets that had direct and aerosol contact with the wild-type virus donor ferrets were infected and shed the virus.

[0235] These data demonstrate that the test setup was appropriate and that the replicable and transmissible virus was proven to be replicable and transmissible. In the same test setup, the BM2SR virus did not replicate in ferrets and was undetectable in animals in direct and aerosol contact, indicating that the BM2SR virus is highly attenuated and does not replicate in ferrets, therefore it is non-transmissible. BM2SR remained attenuated in the ferret model, where ferrets inoculated with BM2SR did not show clinical signs of disease and no viral replication was observed in the respiratory tract or other organs. Furthermore, BM2SR was undetectable in animals in direct or aerosol contact, indicating that BM2SR is non-transmissible.

[0236] Example 14

[0237] This embodiment demonstrates that the immune responses induced by the trivalent M2SR vaccine (also referred to herein as M2SR Tri-Yam) and the quadrivalent M2SR vaccine (also referred to herein as M2SR Quad) provide protective efficacy against epidemic-induced viruses in both primate and pre-immunized ferret models.

[0238] Animal care, isolation, randomization, and pre-study procedures are as outlined in Example 13.

[0239] Table 10. Experimental Design

[0240]

[0241] The experimental design is shown in Table 10. On day 0 of the study, ferrets were pre-infected with wild-type virus, or by intranasal administration of M2SR Tri-Yam, M2SR Quad, or FLUMIST. TM Tetravalent (also referred to as FLUMIST in this article) TM Quad), PBS, or via intramuscular injection of FLUZONE TM Tetravalent (also referred to as FLUZONE in this article) TM Ferrets were inoculated with M2SR Quad. On day 30 of the study, M2SR Tri-Yam, M2SR Quad, and FLUMIST were administered intranasally. TM Quad and PBS or via intramuscular injection of FLUZONE TM Quad ferrets were vaccinated. The strain composition of each vaccine is shown in Table 6. Serum was collected from all animals from day -8 to day -3, 28, 37, 51, and 65 of the study following vaccination / exposure. Peripheral blood mononuclear cells (PBMCs) were also collected from all animals on days 28 and 37 of the study. On day 72 of the study, ferrets were challenged with B / Brisbane / 60 / 2008 (B Victoria lineage). Ferret weight, temperature, and clinical signs were monitored for 14 days post-challenge. Nasal washes were collected from all challenged ferrets (except those designated for organ collection) on days 1, 3, 5, and 7 post-challenge (days 73, 75, 77, and 79 of the study) and the samples were stored at ≤-65°C for virus titration. On day 75 of the study, four ferrets from each group were euthanized and necropsies were performed. Nasal turbinates, trachea, and lungs were collected for virus titer analysis. On day 86 of the study, all remaining animals were finally bled to recover serum.

[0242] Serum HAI and PRNT (plaque reduction neutralization assay) titers were determined against influenza A / Montana / 50 / 2016 (H1N1), A / Singapore / INFIMH-16-0019 / 2016 (H3N2), B / California / 12 / 2015 (Yam), and B / Colorado / 06 / 2017 (Vic). Figure 14A -D and Figure 15A-D) to demonstrate the functional activity of the antibodies. Vaccination with M2SR Tri-Yam containing BM2SR-Yam induced anti-influenza HAI and neutralizing antibodies against all vaccine components in primitive animals. M2SRTri-Yam booster in primitive animals after a second dose induced cross-strain influenza B antibody production (anti-BVictoria). Animals receiving a single dose or two consecutive doses of M2SR Quad produced HAI and neutralizing antibodies against all four strain components. Furthermore, the amount of antibodies produced from M2SR Quad was comparable to that produced from M2SR Tri-Yam, indicating that the addition of a second BM2SR component had no effect on vaccine performance and that the M2SR Quad formulation did not show strain interference ( Figure 14A -D and Figure 15A -D).

[0243] M2SR Quad and FLUMIST TM Quad induced HAI and neutralizing antibodies in primitive animals, while FLUZONE TM The Quad vaccine failed to induce corresponding antibodies even after two consecutive doses. However, compared to M2SR Quad, FLUMIST... TM Pre-immunized animals vaccinated with Quad showed lower HAI and production of neutralizing antibodies against several strains. Animals receiving two doses of FLUMIST showed significantly lower HAI compared to those receiving two doses of M2SR Quad. TM Quad animals also inhibit antibody production ( Figure 14A -D and Figure 15A These results indicate that the M2SR Quad is insensitive to pre-existing influenza immunity.

[0244] As a marker of cellular immune response, influenza-specific IFN-γ secretion from whole blood PBMCs was measured using ferret-specific enzyme-linked immunospot (ELISpot) assays. In pre-immunized animals receiving the M2SR Quad vaccine, 9 out of 10 ferrets showed an increased cellular immune response following H3N2 influenza virus stimulation, compared to FLUMIST. TM Quad only scored 6 / 10, while FLUZONE TM Quad is only 2 / 10 ( Figure 18A Similar responses were observed after stimulation with H1N1 HA peptide, with M2SR Quad confirming increased cellular immune responses in 10 out of 10 animals, while FLUMIST... TM Quad and Fluzone TM Quad increases much less frequently (6 / 10 and 2 / 10 respectively). Figure 18BThese results indicate that M2SR induces a strong T cell response in addition to an antibody response.

[0245] Following influenza B-Vic challenge, the original animals receiving the simulated treatment exhibited approximately 5-6% transient weight loss and fever. A single dose of FLUZONE was administered. TM The Quad ferrets were comparable to the simulated-treatment animals, exhibiting approximately 4-5% transient weight loss, while the M2SR Tri-Yam and M2SR Quad groups showed no weight loss. In the pre-immunized vaccine groups, FLUZONE... TM Quad ferrets showed similar weight loss and temperature increase as the simulated group, while the Quad M2SR group did not show any weight loss or temperature increase (Figure 19).

[0246] Nasal wash was collected on days 1, 3, 5, and 7 post-initiation and administered via TCID. 50 Measurement in MDCK cells titration ( Figure 17 M2SR Tri-Yam provided protection against cross-lineage influenza B virus in virgin ferrets, showing reduced viral titers on all sampling days and reaching undetectable levels prior to control ferrets. Viral titers in virgin ferrets receiving M2SR Quad were comparable to or slightly lower than those with M2SR Tri-Yam, further demonstrating no interference in the M2SR Quad formulation. In pre-immunized ferrets, M2SR Quad and FLUMIST... TM Quad rapidly controlled viral replication, with only low levels detected on day 3 post-initiation. In contrast, those receiving FLUZONE... TM Ferrets infected with Quad virus shed the virus at high levels until day 5 after infection. This occurred after receiving two doses of M2SR Quad or FLUMIST. TM Decreased viral levels in nasal wash were also observed in Quad's ferrets, while those that received two doses of FLUZONE... TM The titer in Quad ferrets remained high 5 days after challenge. Figure 17 ).

[0247] Respiratory organs (nasal turbinates, trachea, and lungs) were collected from four ferrets in each group on day 3 post-infection, and viral titers were measured in MDCK cells by plaque assay. No influenza B challenge virus was recovered from the lungs or trachea of ​​any ferret in any vaccinated group. M2SR Tri-Yam provided protection against cross-lineage influenza B virus in the original ferrets, demonstrated by a reduction in viral titers in the nasal turbinates, particularly after two consecutive doses. Viral titers were further reduced in the original ferrets that received M2SR Quad. In pre-immunized ferrets, M2SR and FLUMIST... TMQuad vaccination showed no detectable viral titers on day 3 post-challenge. Interestingly, with FLUZONE... TM High and high antibody titers observed in HAI and PRNT serological analyses of pre-immunized ferrets vaccinated with Quad did not prevent provocative viral growth in the nasal turbinates. Furthermore, although viral titers were observed in ferrets treated with two doses of M2SR Quad or FLUMIST... TM The ferret in Quad is still undetectable, but received two doses of FLUZONE. TM The ferrets in Quad were not protected.

[0248] This example demonstrates that intranasal administration of either M2SR Tri-Yam or M2SR Quad formulations was independent of any vaccine-related adverse events (e.g., fever, weight loss, or clinical signs) in ferret models. The M2SR Tri-Yam vaccine induced cross-lineage influenza B antibody production and post-challenge protection in the original animals. HAL and neutralizing responses to all four strain components remained high in M2SR Quad ferrets, indicating no interference with the M2SR multivalent formulation. Furthermore, compared to the licensed vaccine FLUMIST... TM Unlike Quad, M2SR Quad antibody production was not reduced in pre-immunized animals. In ferrets vaccinated with M2SR Quad, influenza-specific cellular immune responses were higher and more frequent, further linking it to the currently licensed vaccine FLUMIST. TM Quad and Fluzone TM Distinguish it from Quad.

[0249] All references cited in this article, including publications, patent applications and patents, are incorporated herein by reference to the extent that each reference is individually and specifically indicated as being incorporated herein by reference and discussed in its entirety.

[0250] In the context of describing this invention (especially in the context of the appended claims), the terms “a,” “an,” “the,” and “at least one,” and similar designations, should be interpreted as encompassing both the singular and the plural, unless otherwise stated herein or obviously contradicted by the context. The use of a list of one or more items following the term “at least one” (e.g., “at least one of A and B”) should be understood to mean one of the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise stated herein or obviously contradicted by the context. Unless otherwise stated, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”). Unless otherwise indicated herein, the descriptions of numerical ranges herein are intended only as a way of referring to each individual value falling within the range, and each individual value is incorporated into the specification as if it were described separately herein. Unless otherwise indicated herein or obviously contradicted by the context, all methods described herein can be performed in any suitable order. Unless otherwise claimed, the use of any and all examples or exemplary language (such as "such as") provided herein is intended only to better illustrate the invention and does not constitute a limitation on the scope of the invention. No language in the specification should be construed as indicating that any unclaimed element is essential for carrying out the invention.

[0251] This document describes preferred embodiments of the invention, including the best modes known to the inventors for carrying out the invention. Variations of those preferred embodiments will become apparent to those skilled in the art upon reading the foregoing description. The inventors expect those skilled in the art to appropriately employ such variations, and the inventors intend to practice the invention in ways different from those specifically described herein. Therefore, the invention includes all modifications and equivalents of the subject matter recited in the appended claims as permitted by applicable law. Furthermore, unless otherwise indicated herein or otherwise clearly contradicted by the context, the invention covers any combination of the foregoing elements in all possible variations.

[0252] Sequencing conventions are based on DNA involving four nucleotides: adenine (a), guanine (G), cytosine (C), and thymine (T). When RNA or influenza viruses are involved, T stands for uracil (U). sequence list <110> FluGen, Inc. <120> Influenza virus skeleton <130> 755023 <150> 63 / 054,676 <151> 2020-07-21 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 3 <212> RNA <213> Influenza B virus <400> 1 aug 3 <210> 2 <211> 9 <212> RNA <213> Influenza B virus <400> 2 aaaaaaaug 9 <210> 3 <211> 10 <212> RNA <213> Influenza B virus <400> 3 aaaaaaaaug 10 <210> 4 <211> 1100 <212> DNA <213> Influenza B virus <400> 4 agcagaagca gaggatttgt ttagtcactg gcaaacggga aaaaaatggc ggacaacatg 60 accacaacac aaattgaggt gggtccggga gcaaccaatg ccactataaa ctttgaagca 120 ggaattttgg agtgctatga aaggctttca tggcaaagag cccttgacta ccctggtcaa 180 gaccgcctaa acagactaaa gagaaaatta gaatcaagaa taaagactca caacaaaagt 240 gagcctgaaa gtaaaaggat gtctcttgaa gagagaaaag caattggggt aaaaatgatg 300 aaagtgctcc tatttatgaa cccatctgct ggaattgaag ggtttgagcc atactgtatg 360 aaaaatttcct cccatagcaa ctgcccaac tgcattggg ccgattaccc cccacaca 420 sgaaagtgcc ttgatgacat agagaagaa ccggagaatg ttgatgaccc aactgaaata 480 gtattaaggg acatgaaaaaatgca agghaaaga taaagag agtaacact 540 cagaaagaag ggaagttccg tttgacaata aaaagggat atacgtaatg tgttgtcctt 600 gagagtgttg gtaaacggaa cattcctcaa gcacctaat ggatacaagt ccttatcaac 660 tctgcataga ttgaatgcat atgaccagag tggaggctt gttgctaac tgttgctac 720 tgatgatctt acagtggagg atgagaga tggcatcgg atcctcact cactcttcga 780 gcgttttaat gaaggacatt caaagccaat tcgagcagct gaactgcgg tgggagtctt 840 atcccaattt ggtcaagagc accgattc accagaggag ggagacaattt agactggtta 900 cggaagaact ttatcttta agtaaaagaa ttgatgaata catattgttc cacaaacag 960 taatagctaa cagctccata atagctgaca tgattgtatc atttacatta ttggaaacat 1020 tgtatgagat gaaggatgtg gttgaagtgt acagcaggca gtgcttgtga atttaaaata 1080 aaaatcctct tgttactact 1100 <210> 5 <211> 4 <212> PRT <213> Influenza B virus <400> 5 Lys Gly Tyr Thr 1 <210> 6 <211> 3 <212> DNA <213> Influenza B virus <400> 6 taa 3 <210> 7 <211> 180 <212> PRT <213> Influenza B virus <220> <221> misc_feature <222> (126)..(126) <223> Xaa can be any amino acid. <400> 7 Met Ala Asp Asn Met Thr Thr Thr Gln Ile Glu Val Gly Pro Gly Ala 1 5 10 15 Thr Asn Ala Thr Ile Asn Phe Glu Ala Gly Ile Leu Glu Cys Tyr Glu 20 25 30 Arg Leu Ser Trp Gln Arg Ala Leu Asp Tyr Pro Gly Gln Asp Arg Leu 35 40 45 Asn Arg Leu Lys Arg Lys Leu Glu Ser Arg Ile Lys Thr His Asn Lys 50 55 60 Ser Glu Pro Glu Ser Lys Arg Met Ser Leu Glu Glu Arg Lys Ala Ile 65 70 75 80 Gly Val Lys Met Met Lys Val Leu Leu Phe Met Asn Pro Ser Ala Gly 85 90 95 Ile Glu Gly Phe Glu Pro Tyr Cys Met Lys Asn Ser Ser Asn Ser Asn 100 105 110 Cys Pro Asn Cys Asn Trp Ala Asp Tyr Pro Pro Thr Ser Xaa Lys Cys 115 120 125 Leu Asp Asp Ile Glu Glu Glu Pro Glu Asn Val Asp Asp Pro Thr Glu 130 135 140 Ile Val Leu Arg Asp Met Asn Asn Lys Asp Ala Arg Gln Lys Ile Lys 145 150 155 160 Glu Glu Val Asn Thr Gln Lys Glu Gly Lys Phe Arg Leu Thr Ile Lys 165 170 175 Lys Gly Tyr Thr 180 <210> 8 <211> 2369 <212> DNA <213> Influenza B virus <400> 8 agcagaagcg gagcctttaa gatgaatata aatccttatt ttctcttcat agatgtaccc 60 atacaggcag caatttcaac aacattccca tacaccggtg ttccccctta ttcccatgga 120 acgggaacag gctacacaat agacaccgtg atcagaacac atgagtactc aaacaaggga 180 aaacagtaca tttctgatgt tacaggatgt acaatggtag atccaacaaa tgggccatta 240 cccgaagaca atgagccgag tgcctatgca caattagatt gcgttctgga ggctttggat 300 agaatggatg aagaacatcc aggtctgttt caagcagcct cacagaatgc catggaggca 360 ctaatggtca caactgtaga caaattaacc caggggagac agacttttga ttggacagta 420 tgcagaaacc aacctgctgc aacggcactg aacacaacaa taacctcttt taggttgaat 480 gatttgaatg gagccgacaa gggtggatta gtaccctttt gccaagatat cattgattca 540 ttggacagac ctgaaatgac tttcttctca gtaaagaata taaagaaaaa attgcctgct 600 aaaaacagaa agggtttcct cataaagaga ataccaatga aggtaaaaga cagaataacc 660 agagtggaat acatcaaaag agcattatca ttaaacacaa tgacaaaaga tgctgaaaga 720 ggcaaactaa aaagaagagc gattgccacc gctggaatac aaatcagagg gtttgtatta 780 gtagttgaaa acttggctaa aaatatctgt gaaatctag aacaaagtgg ttgccagta 840 ggtggaaacg agagaaggc caactgtca aatgcagtgg ccaaatgct cagtaactgc 900 ccaccaggag ggatcagcat gagataca ggagacata ccaaatggaa tgaatgctta 960 aatccaagaa tctttttggc tatgactgaa agaatacca gagacagccc aatttggttc 1020 cgggattttt gtagtatagc accggtcttg ttctccaata aaatagccag attgggaaaa 1080 gggtttatga taacaagcaaaaaaaga ctgaggctc aaataccttg tcctgatctg 1140 tttagtatac cattagaag attaatgaa gaaacaaggg CAAATtgaa aaagctgaaa 1200 ccattcttca atgagaagg aacggcatct tgtcgcctg ggatgatt gggaatgtttt 1260 atatgctat ctaccgtgtt gggagtagcc gcactaggta tcaaaacat tggaacaaaa 1320 gatacttat gggatggact gcaatcttct gatgattttg ctctgtttgt taatgcaaaa 1380 gatgagaga catgtatgga aggaataac gactttacc gaacatgtaa actattggga 1440 aaacatga gcaaaagaa aagttactgt atgaactg gatgttttga attackacc 1500 atgttctaca gagatggatt tgtatctaat tttgcaatgg aacttccttc atttggattt 1560 gctggagtaa atgaatcagc agaatggca atgaatga cataataa gaacaatg 1620 atcaacaatg ggatgggtcc agcaacagca aacagcca tacaattatt catagctgat 1680 tatagataca cctacaatg ccacagggga gattchaag tggaggaaa gagaatgaaa 1740 attaaagg agctatgga aaacactaaa ggaagagatg gtctgttagt agcagatggt 1800 gggcctaaca tttacaattt gagaaacttg catatcccag aaatagtatt aaagtacaac 1860 ctaatggacc ctgaataca agggcggtta cttcatccctc aaaatccctt tgtaggacat 1920 ttgtctattg agggcatca agaggcagat ataccccag cacatggtcc agtaagaaa 1980 atggactatg atgcggtgtc tggaactcat agttggagaa ccaaaggaa cagatctata 2040 ctaaaacactg atcagaggaa catgattctt gaggacaat gctacgctaa gtgttgcaac 2100 cttttgagg cctgttttaa cagtgcatca tacaggaac cagtaggtca gcacagcatg 2160 cttgaggcta tggcccacag attagaatg gatgcacgac taggattga attagaat 2220 atgtcaaagg atgattttga gaaagcaatg gctcaccttg gtgagattgg gtacatataa 2280 gcttcgaaga tgtctatggg gttattggtc atcattgaat acatgcggta cacaaatgat 2340 taaaatgaaa aaaggctcgt gtttctact 2369 <210> 9 <211> 2396 <212> DNA <213> Influenza B virus <400> 9 agcagaagcg gagcgttttc aagatgacat tggctaaaat tgaattgtta aaacaactgt 60 taagggacaa cgaagccaaa acagtattga aacaaacaac ggtagaccaa tataacataa 120 taagaaaatt caatacatca agaattgaaa agaacccttc attaaggatg aagtgggcca 180 tgtgttctaa ttttcccttg gctctgacca agggtgatat ggcaaataga atccccttgg 240 aatacaaggg aatacaactt aaaacaaatg ctgaagacat aggaaccaaa ggccaaatgt 300 gctcaatagc agcagttacc tggtggaata catatggacc aataggagac actgaaggtt 360 tcgaaaaggt ctacgaaagc ttctttctca gaaagatgag acttgacaat gccacttggg 420 gccgaataac ttttggccca gttgaaagag taagaaaaag ggtactgcta aaccctctca 480 ccaaggaaat gcctccagat gaagcgagca atgtgaat ggaaatattg ttccctaagg 540 aagcaggaat accaagaa tctacttgga tacataggga actgaaaa gaaaaaagag 600 aaaaattgaa aggaacgatg atactccca ttgtactggc atacatgctt gagagagaat 660 tggttgccg aagaaggttc ctgccagtgg caggagcaac atcagctgag ttcatagaaa 720 tgctacactg cttacaaggt gaaaattgga gataatata tcaccagga gggaataac 780 taactgaatc taggtctca tcaatgattg tagcttg tag aaaataatc agaagatca 840 tagtcgcatc aaacccacta gagctagctg tagaaattgc aaaacaagact gtgatagata 900 ctgaaccttt aaaatcatgt ctggcagcca tagacggagg tgatgtagcc tgtgacataa 960 tgagagctgc attaggacta aagatcagac aagacaag atttggacgg cttgaacta 1020 aggaatc agggaagga tcaaaatg agagaat attgatcgggg aacggaaacaaaaaaaaaaaall 1080 tacagaagat tggaatatgg gacggagaag aggagttcca tgtagatgt ggtgaatgca 1140 ggggaatatt aaaaagagc aaatgagaa tggaaaaact actaataat tcagccaaaa 1200 agggaggat gaagattta ataatcttgt gcatggtatt ttctcagac actaggtgt 1260 tccaggagt gagaggagaa ttaattttc ttaatcgagc aggccaactt ttatctccaa 1320 tgtaccaact ccaagatat ttttgaata ggagcaacga tctttgat caatgggggt 1380 atgaggaatc acccaaagca agtgaactac atgggataa tgaatatg atgcatctg 1440 attatacgtt gaaaggggtt gtagtaacaa aaatgtgat tgatgacttt agttctactg 1500 aaaaaaaaa agtatctata aaaaaaatc ttagtttaat aaaaagaact ggggagtca 1560 taatggggc taatgacgta agtgattag atcacaagc tcagctaatg atacatatg 1620 atacacctaa gatgtgggag atgggaaca ccaagaact ggtgcaaac acctaccaat 1680 gggtgctaaa aaatttgta acactgaagg ctcagtttct tctaggaaaa gagacatgt 1740 tccaatggga tgcatttgaa gcatttgaaa gcataatccc ccagagatg gctggccagt 1800 acagtggatt tgcaagggca gtgctcaac aaatgagaga ccaagaggtt atgaaaactg 1860 accagttcat aaagttgttg cctttctgtt tctcaccacc aaaatttagg agcaatgggg 1920 agccttatca attcttgagg cttatattga agggaggagg agaaaatttc atcgaagtaa 1980 ggaaagggtc ccctctattc tcctacaatc cacaaacaga agtcctaact atatgcggca 2040 gaatgatgtc attaaaaggg aaaattgaag atgaagaaag gaatagatca atggggaatg 2100 cagtattggc aggctttctc gttagtggca agtatgaccc agatcttgga gatttcaaaa 2160 ctattgaaga acttgaaaag ctaaaaccgg gggagaaagc aaacatctta ctttatcaag 2220 gaaagcccgt taaagtagtt aaaaggaaaa gatatagtgc tttatccaat gacatttcac 2280 aaggaattaa gagacaaaga atgacagttg agtccatggg gtgggccttg agctaatata 2340 aatttatcca ttaattcaat aaacacaatt gagtgaaaaa tgctcgtgtt tctact 2396 <210> 10 <211> 2308 <212> DNA <213> Influenza B virus <400> 10 agcagaagcg gtgcgtttga tttgccataa tggatacttt tattacaaga aacttccaga 60 ctacaataat acaaaaggcc aaaaacacaa tggcagaatt tagtgaagat cctgaattac 120 aaccagcaat gctattcaac atctgcgtcc atctggaggt ctgctatgta ataagtgata 180 tgaatttctt tgatgagaa ggaaagcat atacagcatt agaagacaa ggaaagaac 240 aaaacttgag accacatat gaagtgatg agggaatgcc aaaaacata gcatggattgg 300 ttcaagatc cttagcccaa gagcatggga tagagactcc aaggtatctg gctgatttgt 360 tcgattataa aactaagagg tttatagag ttggaataac aaagggattg gctgatgatt 420 acttctggaa aaagaaagaa aagctgggga atagcatgga actgatgata ttcagctaca 480 atcaagacta ttcgttaagt atgaatcct cattggatga ggaaggaaaa gggagagtgc 540 taagcagact cacagaactt caggctgagt taagtctgaa aaatctatgg caagttctca 600 taggagaga agatattga aaaggaatttg acttcaact tggacaaca attackaac 660 taagggatat atctgttcca gctggttttct ccaattttga aggaatgagg agctacatag 720 acaataga tcctaagga gcaatagaga gaatctagc aaggatgtct cccttagtat 780 cagttacacc taaaaagttg aaatgggagg acctaagacc ataggccct cacatttaca 840 accatgagct accagaagtt ccatataatg ccttcttct aatgtctgat gattggggc 900 tggctatat gactgaaggg aagtccaaga aaccgaagac cttagccaaa gagtgcctag 960 aaagtactc aacactacgg gatcaactg acccaatatt atatgaa agcgaaaag 1020 ctaatgaca cttcctatgg aactgtgga gggactgtgt aatacaata agtaatgagg 1080 aaacaagtaa cgaattacag aaaaccaatt atgccaagtg ggccacagga gatggattaa 1140 chattachagaa aatgaaa gagtagcaa gaggacga aacaatgtac chaaagagc 1200 ccaaaatacc taacaatgt agagtggctg cttggttca aacagagatg aatctattga 1260 gcactctgac aagtaaagg gcctggatc tgccagaat agggccagac gtagcacccg 1320 tggagcatgt agggagtga agaggaaat acttgttaa tgatcac tactgtagg 1380 cctctaccgt tatgatgaag tatgtgcttt ttcacactc attattaat gaaagcaatg 1440 ccagtaggg aaaataaaaaaaaccaaaaccaacag agtagtaat gaaaaggggg 1500 aaagttttga catgctttat ggtctagcgg ttaaagggca atctcatctg agggagata 1560 ctgatgttgt aacagttgtg actttcgaat ttagtagtac agatcccaga gtggactcag 1620 gaaagtggcc aaaatatact gtatttagaa ttggctcctt atttgtgagt gggagggaaa 1680 aatctgtata cctatattgc cgagtgaatg gtacaaataa gatccaaatg aaatgggaa 1740 tggaagctag aagatgtctg cttcaatcaa tgcaacaaat ggaagcaatt gttgaacaag 1800 1860 gtccaaaaac tttcagtatt gggactcaag aaggaaaact agtgaaagga tcctttggga 1920 1980 tggaggggtt tagtgccgaa tctaggagac ttctactgtt aattcaggca ttaaaagaca 2040 gaaagggccc ttgggtattc gacttagagg gaatgtattc tggagaa gaatgtatta 2100 gtaacaaccc ttgggtaata cagagtgcat actggtttaa tgaatggttg ggctttgaaa 2160 aagaggggag taaagtatta gaatcagtag atgaaataat ggatgaatga aagaagggca 2220 tagtgctcaa tttggtacta ttttgttcat tatgtatcta aacatccaat ataaagaatt 2280 gagaattaaa aatgcacgtg tttctact 2308 <210> 11 <211> 1843 <212> DNA <213> Influenza B virus <400> 11 agcagaagca cagcattttc ttgtgaactt caagtaccaa caaaaaactg aaaatcaaaa 60 tgtccaacat ggacattgac ggcatcaaca ctggaataat tgacaaaaca ccagaagaaa 120 taacttccgg aaccagtggg gcaaccagac caatcatcag accagcaacc cttgcctcac 180 caagcaacaa acgaaccaga aacccatccc cggaaagggc aaccacaagc agtgaagctg 240 atgtcggaag gaaaacccaa aagaaacaaa ctccgacaga gataaagaag agcgtctaca 300 atatggtagt gaaactgggt gaattctaca accagatgat ggtcaaagct ggactcaacg 360 atgacatgga gagaaaccta atccaaaatg cacatgctgt ggaaagaatt ctattggctg 420 ctactgatga caagaaaact gaattccaaa agaaaaagaa tgccagagac gtcaaagaag 480 ggaaagaaga aatagaccat aacaaaacag gaggcacctt ttacaagatg gtaagagata 540 ataaaaccat ctacttcagc cctataagaa ttaccttttt aaaagaagag gtgaaaacaa 600 tgtacaaaac caccatgggg agtgacggtt tcagtggact aaatcacatc atgattgggc 660 attcacagac gaacgatgtc tgtttccaaa gatcaaaggc actaaaaaga gttggacttg 720 acccttcatt aatcagtact tttgcaggaa gcacactccc cagaagatca ggtacaactg 780 gtgttgcgac caaaggaggt ggaactttag tggcagaagc cattcgattt ataggaagag 840 caatggcaga cagagggcta ttgagagaca tcagagccaa gacggcctat gaaaagattc 900 ttctgaatct gaaaaacaag tgctctgcgc cccaacaaaa ggctctggtt gatcaagtga 960 tcggaagtag aaatccaggg attgcagaca tagagatct caccctgctt gctcgaagta 1020 tggtcgttgt taggccctct gtagcaagca aagtggtgct tcccataagc atctatgcta 1080 aaatacctca actggggttc aacgttgaag aatactctat ggttgggtat gaagccatgg 1140 ctctttataa tatggcaaca cctgtttcca tattaagaat gggagacgat gcaaaagata 1200 aatcacaatt attcttcatg tcttgctttg gagctgccta tgaagaccta agagttctgt 1260 ctgcactaac aggcacggaa ttcaagccta ggtcagcatt aaagtgcaaa ggtttccacg 1320 ttccagcaaa ggagcaagtg gaaggaatgg gggcagctct gatgtccatc aagctccagt 1380 ttggggctcc atgaccaga tctgggggga atgaagtagg tggacgga gggtctctcc 1440 aaataagttg cagccccgtg ttgcagtag aaagacctat tgctctaagc aagcaagctg 1500 windows gctgtcaatg atattgagg gacgtgatgc agatgtcaa ggaatctac 1560 tcaatgat gatgattca atggctaaga aaaccaatgg aaatgctttc attgggaaga 1620 aaatgttcca attackcagac aaaaacaaa ccaatcccgt tgagattcca attackcaga 1680 ccatccccag ttctcttt gggagggaca cagcagagga ttatgatgac ctcgattatt 1740 aaagcaacaa atagacact atggctgtga ttgtttcagt acgtttggaa tgtggggtgtt 1800 tactcttatt gaaataatg taaaaaatgc tgttgttttct act 1843 <210> 12 <211> 1098 <212> DNA <213> slow motion <400> 12 agcagaagca gaggattgt ttagtcactg gcaacggga aaaatggcg gacacatga 60 ccacacaca aattgaggtg ggtccgggag siaccaatgc cactaaac ttgaggcag 120 gaattttgga gtgctatgaa aggctttcat ggcaaagagc ccttgactac cctggtcaag 180 accgcctaaa cagactaaag agaaaattag aatcaagaat aaagactcac aacaaaagtg 240 agcctgaaag taaaaggatg tctcttgaag agaaaagc aattggggta aaaatgatga 300 aagtgctcct atttatgaac ccatctgctg gaattgaagg gtttgagcca tactgtatga 360 aaaattcctc caatagcaac tgcccaaact gcaattgggc cgattaccct ccaacatcag 420 gaaagtgcct tgatgacata gaagagaac cggagaatgt tgatgaccca actgaaatag 480 540 600 gagtgttggt aaacggaa ttcctcaagc accctaatgg atacaagtcc ttatcaactc 660 tgcatagatt gaatgcatat gaccagagtg gaaggcttgt tgctaaactt gttgctactg 720 atgatcttac agtggaggat gaagaagatg gccatcggat cctcaactca ctcttcgagc 780 gtttaatga aggacattca aagccaattc gagcagctga aactgcggtg ggagctcttat 840 cccaatttgg tcaagagcac cgattatcac cagaggaggg agacaattag actggttacg 900 gaagaacttt atcttttaag taaaagaatt gatgataaca tattgttcca caaaacagta 960 atagctaaca gctccataat agctgacatg attgtatcat tatcattatt ggaaacattg 1020 tatgagatga aggatgtggt tgaagtgtac agcaggcagt gcttgtgaat ttaaaataaa 1080 aatcctcttg ttactact 1098 <210> 13 <211> 752 <212> PRT <213> Influenza B virus <400> 13 Met Asn Ile Asn Pro Tyr Phe Leu Phe Ile Asp Val Pro Ile Gln Ala 1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Val Pro Pro Tyr Ser His 20 25 30 Gly Thr Gly Thr Gly Tyr Thr Ile Asp Thr Val Ile Arg Thr His Glu 35 40 45 Tyr Ser Asn Lys Gly Lys Gln Tyr Ile Ser Asp Val Thr Gly Cys Thr 50 55 60 Met Val Asp Pro Thr Asn Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser 65 70 75 80 Ala Tyr Ala Gln Leu Asp Cys Val Leu Glu Ala Leu Asp Arg Met Asp 85 90 95 Glu Glu His Pro Gly Leu Phe Gln Ala Ala Ser Gln Asn Ala Met Glu 100 105 110 Ala Leu Met Val Thr Thr Val Asp Lys Leu Thr Gln Gly Arg Gln Thr 115 120 125 Phe Asp Trp Thr Val Cys Arg Asn Gln Pro Ala Ala Thr Ala Leu Asn 130 135 140 Thr Thr Ile Thr Ser Phe Arg Leu Asn Asp Leu Asn Gly Ala Asp Lys 145 150 155 160 Gly Gly Leu Val Pro Phe Cys Gln Asp Ile Ile Asp Ser Leu Asp Arg 165 170 175 Pro Glu Met Thr Phe Phe Ser Val Lys Asn Ile Lys Lys Lys Leu Pro 180 185 190 Ala Lys Asn Arg Lys Gly Phe Leu Ile Lys Arg Ile Pro Met Lys Val 195 200 205 Lys Asp Arg Ile Thr Arg Val Glu Tyr Ile Lys Arg Ala Leu Ser Leu 210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Ala Gly Ile Gln Ile Arg Gly Phe Val Leu Val Val Glu 245 250 255 Asn Leu Ala Lys Asn Ile Cys Glu Asn Leu Glu Gln Ser Gly Leu Pro 260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ser Asn Ala Val Ala Lys 275 280 285 Met Leu Ser Asn Cys Pro Pro Gly Gly Ile Ser Met Thr Val Thr Gly 290 295 300 Asp Asn Thr Lys Trp Asn Glu Cys Leu Asn Pro Arg Ile Phe Leu Ala 305 310 315 320 Met Thr Glu Arg Ile Thr Arg Asp Ser Pro Ile Trp Phe Arg Asp Phe 325 330 335 Cys Ser Ile Ala Pro Val Leu Phe Ser Asn Lys Ile Ala Arg Leu Gly 340 345 350 Lys Gly Phe Met Ile Thr Ser Lys Thr Lys Arg Leu Lys Ala Gln Ile 355 360 365 Pro Cys Pro Asp Leu Phe Ser Ile Pro Leu Glu Arg Tyr Asn Glu Glu 370 375 380 Thr Arg Ala Lys Leu Lys Lys Leu Lys Pro Phe Phe Asn Glu Glu Gly 385 390 395 400 Thr Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu 405 410 415 Ser Thr Val Leu Gly Val Ala Ala Leu Gly Ile Lys Asn Ile Gly Asn 420 425 430 Lys Glu Tyr Leu Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala Leu 435 440 445 Phe Val Asn Ala Lys Asp Glu Glu Thr Cys Met Glu Gly Ile Asn Asp 450 455 460 Phe Tyr Arg Thr Cys Lys Leu Leu Gly Ile Asn Met Ser Lys Lys Lys 465 470 475 480 Ser Tyr Cys Asn Glu Thr Gly Met Phe Glu Phe Thr Ser Met Phe Tyr 485 490 495 Arg Asp Gly Phe Val Ser Asn Phe Ala Met Glu Leu Pro Ser Phe Gly 500 505 510 Val Ala Gly Val Asn Glu Ser Ala Asp Met Ala Ile Gly Met Thr Ile 515 520 525 Ile Lys Asn Asn Met Ile Asn Asn Gly Met Gly Pro Ala Thr Ala Gln 530 535 540 Thr Ala Ile Gln Leu Phe Ile Ala Asp Tyr Arg Tyr Thr Tyr Lys Cys 545 550 555 560 His Arg Gly Asp Ser Lys Val Glu Gly Lys Arg Met Lys Ile Ile Lys 565 570 575 Glu Leu Trp Glu Asn Thr Lys Gly Arg Asp Gly Leu Leu Val Ala Asp 580 585 590 Gly Gly Pro Asn Ile Tyr Asn Leu Arg Asn Leu His Ile Pro Glu Ile 595 600 605 Val Leu Lys Tyr Asn Leu Met Asp Pro Glu Tyr Lys Gly Arg Leu Leu 610 615 620 His Pro Gln Asn Pro Phe Val Gly His Leu Ser Ile Glu Gly Ile Lys 625 630 635 640 Glu Ala Asp Ile Thr Pro Ala His Gly Pro Val Lys Lys Met Asp Tyr 645 650 655 Asp Ala Val Ser Gly Thr His Ser Trp Arg Thr Lys Arg Asn Arg Ser 660 665 670 Ile Leu Asn Thr Asp Gln Arg Asn Met Ile Leu Glu Glu Gln Cys Tyr 675 680 685 Ala Lys Cys Cys Asn Leu Phe Glu Ala Cys Phe Asn Ser Ala Ser Tyr 690 695 700 Arg Lys Pro Val Gly Gln His Ser Met Leu Glu Ala Met Ala His Arg 705 710 715 720 Leu Arg Met Asp Ala Arg Leu Asp Tyr Glu Ser Gly Arg Met Ser Lys 725 730 735 Asp Asp Phe Glu Lys Ala Met Ala His Leu Gly Glu Ile Gly Tyr Ile 740 745 750 <210> 14 <211> 770 <212> PRT <213> Influenza B virus <400> 14 Met Thr Leu Ala Lys Ile Glu Leu Leu Lys Gln Leu Leu Arg Asp Asn 1 5 10 15 Glu Ala Lys Thr Val Leu Lys Gln Thr Thr Val Asp Gln Tyr Asn Ile 20 25 30 Ile Arg Lys Phe Asn Thr Ser Arg Ile Glu Lys Asn Pro Ser Leu Arg 35 40 45 Met Lys Trp Ala Met Cys Ser Asn Phe Pro Leu Ala Leu Thr Lys Gly 50 55 60 Asp Met Ala Asn Arg Ile Pro Leu Glu Tyr Lys Gly Ile Gln Leu Lys 65 70 75 80 Thr Asn Ala Glu Asp Ile Gly Thr Lys Gly Gln Met Cys Ser Ile Ala 85 90 95 Ala Val Thr Trp Trp Asn Thr Tyr Gly Pro Ile Gly Asp Thr Glu Gly 100 105 110 Phe Glu Lys Val Tyr Glu Ser Phe Phe Leu Arg Lys Met Arg Leu Asp 115 120 125 Asn Ala Thr Trp Gly Arg Ile Thr Phe Gly Pro Val Glu Arg Val Arg 130 135 140 Lys Arg Val Leu Leu Asn Pro Leu Thr Lys Glu Met Pro Pro Asp Glu 145 150 155 160 Ala Ser Asn Val Ile Met Glu Ile Leu Phe Pro Lys Glu Ala Gly Ile 165 170 175 Pro Arg Glu Ser Thr Trp Ile His Arg Glu Leu Ile Lys Glu Lys Arg 180 185 190 Glu Lys Leu Lys Gly Thr Met Ile Thr Pro Ile Val Leu Ala Tyr Met 195 200 205 Leu Glu Arg Glu Leu Val Ala Arg Arg Arg Phe Leu Pro Val Ala Gly 210 215 220 Ala Thr Ser Ala Glu Phe Ile Glu Met Leu His Cys Leu Gln Gly Glu 225 230 235 240 Asn Trp Arg Gln Ile Tyr His Pro Gly Gly Asn Lys Leu Thr Glu Ser 245 250 255 Arg Ser Gln Ser Met Ile Val Ala Cys Arg Lys Ile Ile Arg Arg Ser 260 265 270 Ile Val Ala Ser Asn Pro Leu Glu Leu Ala Val Glu Ile Ala Asn Lys 275 280 285 Thr Val Ile Asp Thr Glu Pro Leu Lys Ser Cys Leu Ala Ala Ile Asp 290 295 300 Gly Gly Asp Val Ala Cys Asp Ile Met Arg Ala Ala Leu Gly Leu Lys 305 310 315 320 Ile Arg Gln Arg Gln Arg Phe Gly Arg Leu Glu Leu Lys Arg Ile Ser 325 330 335 Gly Arg Gly Phe Lys Asn Asp Glu Glu Ile Leu Ile Gly Asn Gly Thr 340 345 350 Ile Gln Lys Ile Gly Ile Trp Asp Gly Glu Glu Glu Phe His Val Arg 355 360 365 Cys Gly Glu Cys Arg Gly Ile Leu Lys Lys Ser Lys Met Arg Met Glu 370 375 380 Lys Leu Leu Ile Asn Ser Ala Lys Lys Glu Asp Met Lys Asp Leu Ile 385 390 395 400 Ile Leu Cys Met Val Phe Ser Gln Asp Thr Arg Met Phe Gln Gly Val 405 410 415 Arg Gly Glu Ile Asn Phe Leu Asn Arg Ala Gly Gln Leu Leu Ser Pro 420 425 430 Met Tyr Gln Leu Gln Arg Tyr Phe Leu Asn Arg Ser Asn Asp Leu Phe 435 440 445 Asp Gln Trp Gly Tyr Glu Glu Ser Pro Lys Ala Ser Glu Leu His Gly 450 455 460 Ile Asn Glu Leu Met Asn Ala Ser Asp Tyr Thr Leu Lys Gly Val Val 465 470 475 480 Val Thr Lys Asn Val Ile Asp Asp Phe Ser Ser Thr Glu Thr Glu Lys 485 490 495 Val Ser Ile Thr Lys Asn Leu Ser Leu Ile Lys Arg Thr Gly Glu Val 500 505 510 Ile Met Gly Ala Asn Asp Val Ser Glu Leu Glu Ser Gln Ala Gln Leu 515 520 525 Met Ile Thr Tyr Asp Thr Pro Lys Met Trp Glu Met Gly Thr Thr Lys 530 535 540 Glu Leu Val Gln Asn Thr Tyr Gln Trp Val Leu Lys Asn Leu Val Thr 545 550 555 560 Leu Lys Ala Gln Phe Leu Leu Gly Lys Glu Asp Met Phe Gln Trp Asp 565 570 575 Ala Phe Glu Ala Phe Glu Ser Ile Ile Pro Gln Lys Met Ala Gly Gln 580 585 590 Tyr Ser Gly Phe Ala Arg Ala Val Leu Lys Gln Met Arg Asp Gln Glu 595 600 605 Val Met Lys Thr Asp Gln Phe Ile Lys Leu Leu Pro Phe Cys Phe Ser 610 615 620 Pro Pro Lys Leu Arg Ser Asn Gly Glu Pro Tyr Gln Phe Leu Arg Leu 625 630 635 640 Ile Leu Lys Gly Gly Gly Glu Asn Phe Ile Glu Val Arg Lys Gly Ser 645 650 655 Pro Leu Phe Ser Tyr Asn Pro Gln Thr Glu Val Leu Thr Ile Cys Gly 660 665 670 Arg Met Met Ser Leu Lys Gly Lys Ile Glu Asp Glu Glu Arg Asn Arg 675 680 685 Ser Met Gly Asn Ala Val Leu Ala Gly Phe Leu Val Ser Gly Lys Tyr 690 695 700 Asp Pro Asp Leu Gly Asp Phe Lys Thr Ile Glu Glu Leu Glu Lys Leu 705 710 715 720 Lys Pro Gly Glu Lys Ala Asn Ile Leu Leu Tyr Gln Gly Lys Pro Val 725 730 735 Lys Val Val Lys Arg Lys Arg Tyr Ser Ala Leu Ser Asn Asp Ile Ser 740 745 750 Gln Gly Ile Lys Arg Gln Arg Met Thr Val Glu Ser Met Gly Trp Ala 755 760 765 Leu Ser 770 <210> 15 <211> 702 <212> PRT <213> Influenza B virus <400> 15 Met Asp Thr Phe Ile Thr Arg Asn Phe Gln Thr Thr Ile Ile Gln Lys 1 5 10 15 Ala Lys Asn Thr Met Ala Glu Phe Ser Glu Asp Pro Glu Leu Gln Pro 20 25 30 Ala Met Leu Phe Asn Ile Cys Val His Leu Glu Val Cys Tyr Val Ile 35 40 45 Ser Asp Met Asn Phe Leu Asp Glu Glu Gly Lys Ala Tyr Thr Ala Leu 50 55 60 Glu Gly Gln Gly Lys Glu Gln Asn Leu Arg Pro Gln Tyr Glu Val Ile 65 70 75 80 Glu Gly Met Pro Arg Asn Ile Ala Trp Met Val Gln Arg Ser Leu Ala 85 90 95 Gln Glu His Gly Ile Glu Thr Pro Arg Tyr Leu Ala Asp Leu Phe Asp 100 105 110 Tyr Lys Thr Lys Arg Phe Ile Glu Val Gly Ile Thr Lys Gly Leu Ala 115 120 125 Asp Asp Tyr Phe Trp Lys Lys Lys Glu Lys Leu Gly Asn Ser Met Glu 130 135 140 Leu Met Ile Phe Ser Tyr Asn Gln Asp Tyr Ser Leu Ser Asn Glu Ser 145 150 155 160 Ser Leu Asp Glu Glu Gly Lys Gly Arg Val Leu Ser Arg Leu Thr Glu 165 170 175 Leu Gln Ala Glu Leu Ser Leu Lys Asn Leu Trp Gln Val Leu Ile Gly 180 185 190 Glu Glu Asp Ile Glu Lys Gly Ile Asp Phe Lys Leu Gly Gln Thr Ile 195 200 205 Ser Lys Leu Arg Asp Ile Ser Val Pro Ala Gly Phe Ser Asn Phe Glu 210 215 220 Gly Met Arg Ser Tyr Ile Asp Asn Ile Asp Pro Lys Gly Ala Ile Glu 225 230 235 240 Arg Asn Leu Ala Arg Met Ser Pro Leu Val Ser Val Thr Pro Lys Lys 245 250 255 Leu Lys Trp Glu Asp Leu Arg Pro Ile Gly Pro His Ile Tyr Asn His 260 265 270 Glu Leu Pro Glu Val Pro Tyr Asn Ala Phe Leu Leu Met Ser Asp Glu 275 280 285 Leu Gly Leu Ala Asn Met Thr Glu Gly Lys Ser Lys Lys Pro Lys Thr 290 295 300 Leu Ala Lys Glu Cys Leu Glu Lys Tyr Ser Thr Leu Arg Asp Gln Thr 305 310 315 320 Asp Pro Ile Leu Ile Met Lys Ser Glu Lys Ala Asn Glu His Phe Leu 325 330 335 Trp Lys Leu Trp Arg Asp Cys Val Asn Thr Ile Ser Asn Glu Glu Thr 340 345 350 Ser Asn Glu Leu Gln Lys Thr Asn Tyr Ala Lys Trp Ala Thr Gly Asp 355 360 365 Gly Leu Thr Tyr Gln Lys Ile Met Lys Glu Val Ala Ile Asp Asp Glu 370 375 380 Thr Met Tyr Gln Glu Glu Pro Lys Ile Pro Asn Lys Cys Arg Val Ala 385 390 395 400 Ala Trp Val Gln Thr Glu Met Asn Leu Leu Ser Thr Leu Thr Ser Lys 405 410 415 Arg Ala Leu Asp Leu Pro Glu Ile Gly Pro Asp Val Ala Pro Val Glu 420 425 430 His Val Gly Ser Glu Arg Arg Lys Tyr Phe Val Asn Glu Ile Asn Tyr 435 440 445 Cys Lys Ala Ser Thr Val Met Met Lys Tyr Val Leu Phe His Thr Ser 450 455 460 Leu Leu Asn Glu Ser Asn Ala Ser Met Gly Lys Tyr Lys Val Ile Pro 465 470 475 480 Ile Thr Asn Arg Val Val Asn Glu Lys Gly Glu Ser Phe Asp Met Leu 485 490 495 Tyr Gly Leu Ala Val Lys Gly Gln Ser His Leu Arg Gly Asp Thr Asp 500 505 510 Val Val Thr Val Val Thr Phe Glu Phe Ser Ser Thr Asp Pro Arg Val 515 520 525 Asp Ser Gly Lys Trp Pro Lys Tyr Thr Val Phe Arg Ile Gly Ser Leu 530 535 540 Phe Val Ser Gly Arg Glu Lys Ser Val Tyr Leu Tyr Cys Arg Val Asn 545 550 555 560 Gly Thr Asn Lys Ile Gln Met Lys Trp Gly Met Glu Ala Arg Arg Cys 565 570 575 Leu Leu Gln Ser Met Gln Gln Met Glu Ala Ile Val Glu Gln Glu Ser 580 585 590 Ser Ile Gln Gly Tyr Asp Met Thr Lys Ala Cys Phe Lys Gly Asp Arg 595 600 605 Val Asn Ser Pro Lys Thr Phe Ser Ile Gly Thr Gln Glu Gly Lys Leu 610 615 620 Val Lys Gly Ser Phe Gly Lys Ala Leu Arg Val Ile Phe Thr Lys Cys 625 630 635 640 Leu Met His Tyr Val Phe Gly Asn Ala Gln Leu Glu Gly Phe Ser Ala 645 650 655 Glu Ser Arg Arg Leu Leu Leu Leu Ile Gln Ala Leu Lys Asp Arg Lys 660 665 670 Gly Pro Trp Val Phe Asp Leu Glu Gly Met Tyr Ser Gly Ile Glu Glu 675 680 685 Cys Ile Ser Asn Asn Pro Trp Val Ile Gln Ser Ala Tyr Trp 690 695 700 <210> 16 <211> 560 <212> PRT <213> Influenza B virus <400> 16 Met Ser Asn Met Asp Ile Asp Gly Ile Asn Thr Gly Ile Ile Asp Lys 1 5 10 15 Thr Pro Glu Glu Ile Thr Ser Gly Thr Ser Gly Ala Thr Arg Pro Ile 20 25 30 Ile Arg Pro Ala Thr Leu Ala Ser Pro Ser Asn Lys Arg Thr Arg Asn 35 40 45 Pro Ser Pro Glu Arg Ala Thr Thr Ser Ser Glu Ala Asp Val Gly Arg 50 55 60 Lys Thr Gln Lys Lys Gln Thr Pro Thr Glu Ile Lys Lys Ser Val Tyr 65 70 75 80 Asn Met Val Val Lys Leu Gly Glu Phe Tyr Asn Gln Met Met Val Lys 85 90 95 Ala Gly Leu Asn Asp Asp Met Glu Arg Asn Leu Ile Gln Asn Ala His 100 105 110 Ala Val Glu Arg Ile Leu Leu Ala Ala Thr Asp Asp Lys Lys Thr Glu 115 120 125 Phe Gln Lys Lys Lys Asn Ala Arg Asp Val Lys Glu Gly Lys Glu Glu 130 135 140 Ile Asp His Asn Lys Thr Gly Gly Thr Phe Tyr Lys Met Val Arg Asp 145 150 155 160 Asn Lys Thr Ile Tyr Phe Ser Pro Ile Arg Ile Thr Phe Leu Lys Glu 165 170 175 Glu Val Lys Thr Met Tyr Lys Thr Thr Met Gly Ser Asp Gly Phe Ser 180 185 190 Gly Leu Asn His Ile Met Ile Gly His Ser Gln Thr Asn Asp Val Cys 195 200 205 Phe Gln Arg Ser Lys Ala Leu Lys Arg Val Gly Leu Asp Pro Ser Leu 210 215 220 Ile Ser Thr Phe Ala Gly Ser Thr Leu Pro Arg Arg Ser Gly Thr Thr 225 230 235 240 Gly Val Ala Thr Lys Gly Gly Gly Thr Leu Val Ala Glu Ala Ile Arg 245 250 255 Phe Ile Gly Arg Ala Met Ala Asp Arg Gly Leu Leu Arg Asp Ile Arg 260 265 270 Ala Lys Thr Ala Tyr Glu Lys Ile Leu Leu Asn Leu Lys Asn Lys Cys 275 280 285 Ser Ala Pro Gln Gln Lys Ala Leu Val Asp Gln Val Ile Gly Ser Arg 290 295 300 Asn Pro Gly Ile Ala Asp Ile Glu Asp Leu Thr Leu Leu Ala Arg Ser 305 310 315 320 Met Val Val Val Arg Pro Ser Val Ala Ser Lys Val Val Leu Pro Ile 325 330 335 Ser Ile Tyr Ala Lys Ile Pro Gln Leu Gly Phe Asn Val Glu Glu Tyr 340 345 350 Ser Met Val Gly Tyr Glu Ala Met Ala Leu Tyr Asn Met Ala Thr Pro 355 360 365 Val Ser Ile Leu Arg Met Gly Asp Asp Ala Lys Asp Lys Ser Gln Leu 370 375 380 Phe Phe Met Ser Cys Phe Gly Ala Ala Tyr Glu Asp Leu Arg Val Leu 385 390 395 400 Ser Ala Leu Thr Gly Thr Glu Phe Lys Pro Arg Ser Ala Leu Lys Cys 405 410 415 Lys Gly Phe His Val Pro Ala Lys Glu Gln Val Glu Gly Met Gly Ala 420 425 430 Ala Leu Met Ser Ile Lys Leu Gln Phe Trp Ala Pro Met Thr Arg Ser 435 440 445 Gly Gly Asn Glu Val Gly Gly Asp Gly Gly Ser Gly Gln Ile Ser Cys 450 455 460 Ser Pro Val Phe Ala Val Glu Arg Pro Ile Ala Leu Ser Lys Gln Ala 465 470 475 480 Val Arg Arg Met Leu Ser Met Asn Ile Glu Gly Arg Asp Ala Asp Val 485 490 495 Lys Gly Asn Leu Leu Lys Met Met Asn Asp Ser Met Ala Lys Lys Thr 500 505 510 Asn Gly Asn Ala Phe Ile Gly Lys Lys Met Phe Gln Ile Ser Asp Lys 515 520 525 Asn Lys Thr Asn Pro Val Glu Ile Pro Ile Lys Gln Thr Ile Pro Ser 530 535 540 Phe Phe Phe Gly Arg Asp Thr Ala Glu Asp Tyr Asp Asp Leu Asp Tyr 545 550 555 560 <210> 17 <211> 281 <212> PRT <213> Influenza B virus <400> 17 Met Ala Asp Asn Met Thr Thr Thr Gln Ile Glu Val Gly Pro Gly Ala 1 5 10 15 Thr Asn Ala Thr Ile Asn Phe Glu Ala Gly Ile Leu Glu Cys Tyr Glu 20 25 30 Arg Leu Ser Trp Gln Arg Ala Leu Asp Tyr Pro Gly Gln Asp Arg Leu 35 40 45 Asn Arg Leu Lys Arg Lys Leu Glu Ser Arg Ile Lys Thr His Asn Lys 50 55 60 Ser Glu Pro Glu Ser Lys Arg Met Ser Leu Glu Glu Arg Lys Ala Ile 65 70 75 80 Gly Val Lys Met Met Lys Val Leu Leu Phe Met Asn Pro Ser Ala Gly 85 90 95 Ile Glu Gly Phe Glu Pro Tyr Cys Met Lys Asn Ser Ser Asn Ser Asn 100 105 110 Cys Pro Asn Cys Asn Trp Ala Asp Tyr Pro Pro Thr Ser Gly Lys Cys 115 120 125 Leu Asp Asp Ile Glu Glu Glu Pro Glu Asn Val Asp Asp Pro Thr Glu 130 135 140 Ile Val Leu Arg Asp Met Asn Asn Lys Asp Ala Arg Gln Lys Ile Lys 145 150 155 160 Glu Glu Val Asn Thr Gln Lys Glu Gly Lys Phe Arg Leu Thr Ile Gln 165 170 175 Arg Asp Ile Arg Asn Val Leu Ser Leu Arg Val Leu Val Asn Gly Thr 180 185 190 Phe Leu Lys His Pro Asn Gly Tyr Lys Ser Leu Ser Thr Leu His Arg 195 200 205 Leu Asn Ala Tyr Asp Gln Ser Gly Arg Leu Val Ala Lys Leu Val Ala 210 215 220 Thr Asp Asp Leu Thr Val Glu Asp Glu Glu Asp Gly His Arg Ile Leu 225 230 235 240 Asn Ser Leu Phe Glu Arg Phe Asn Glu Gly His Ser Lys Pro Ile Arg 245 250 255 Ala Ala Glu Thr Ala Val Gly Val Leu Ser Gln Phe Gly Gln Glu His 260 265 270 Arg Leu Ser Pro Glu Glu Gly Asp Asn 275,280 <210> 18 <211> 1111 <212> DNA <213> slow motion <400> 18 agcagaagca cgcactttct taaaatgtcg ctgttttggag acacaattgc ctacctgctt 60 tcattgacag aagatggaga aggcaagca gaactagcag aaaaattaca ctgttggttc 120 ggtgggaaag aatttgacct agactctgcc ttggaatgga taaaaaacaa aagatgctta 180 actgacatac agaagcact aattggcgcc tctatctgct ttttaaaacc caagaccag 240 gaagaaaaaa gagattcat cacagagccc ctcaggaa tgggacaac agcaaaaaa 300 aagaagggcc tgattctagc tgagagaaaa atgagagat gtgtgagctt ccatgaagca 360 tttgaaatag cagaaggcca tgaaagctca gcgttactat attgtctcat ggtcatgtac 420 ctgaatcctg gaaattattc aatgcaagta aaactaggaa cgctctgtgc ttgtgcgaa 480 aaacaagcat cacattcaca cagggctcat agcagagcag cgagatctc agtgcctgga 540 gtgagacgggg aaatgcagat ggtctcagct atgacacag CAAAaacaat gatggaatg 600 ggaaaaggag aagacgttca aaaactggca gagaactgc aaagcaacat tggagtattg 660 agatctcttg gggcaagtca aaagaatggg gaaggattg aaaggatgt atggaagtg 720 ctaaagcaga gctctatggg aaattcagct ctgtgaaga atacctata atgctcgaac 780 catttcagat tcttcaatt tgttagag ctaaaagggg cchaataag agacataaa 840 cagagaggta tcaattttga vakacagtta ccaaaaga atccaggcca aagaagcaat 900 gaaggaagta ctctctgaca acatggaggt attgagtgac cacatagtaa tgaggggct 960 ttctgctgaa gagatataa aaatgggtga aacagttttg gaggtagaag aattgcatta 1020 aattcaattt ttactgtact tcttactatg catttaagca aattgtaatc aatgtcagca 1080 aataaactgg aaaaagtgcg ttgtttctac t 1111 <210> 19 <211> 109 <212> PRT <213> Influenza B virus <400> 19 Met Leu Glu Pro Leu Gln Ile Leu Ser Ile Cys Ser Phe Ile Leu Ser 1 5 10 15 Ala Leu His Phe Met Ala Trp Thr Ile Gly His Leu Asn Gln Ile Arg 20 25 30 Arg Gly Val Asn Leu Lys Ile Gln Ile Arg Asn Pro Asn Lys Glu Ala 35 40 45 Ile Asn Arg Glu Val Ser Ile Leu Arg His Asn Tyr Gln Lys Glu Ile 50 55 60 Gln Ala Lys Glu Thr Met Lys Lys Ile Leu Ser Asp Asn Met Glu Val 65 70 75 80 Leu Gly Asp His Ile Val Val Glu Gly Leu Ser Thr Asp Glu Ile Ile 85 90 95 Lys Met Gly Glu Thr Val Leu Glu Val Glu Glu Leu Gln 100 105 <210> 20 <211> 11 <212> PRT <213> Influenza B virus <400> 20 Met Leu Glu Pro Phe Gln Ile Leu Ser Ile Cys 1 5 10

Claims

1. Influenza viruses containing PA, NP, and NS gene segments, among which (a) The PA gene segment encodes a PA protein consisting of the amino acid sequence of SEQ ID NO: 15; (b) The NP gene segment encodes an NP protein consisting of the amino acid sequence of SEQ ID NO: 16; and (c) The NS gene segment encodes the NS1 protein, which consists of the amino acid sequence of SEQ ID NO:

17.

2. The influenza virus of claim 1, wherein the PA gene segment has a nucleotide sequence represented by SEQ ID NO:

10.

3. The influenza virus of claim 1, wherein the NP gene segment has the nucleotide sequence represented by SEQ ID NO:

11.

4. The influenza virus of claim 1, wherein the NS gene segment has the nucleotide sequence represented by SEQ ID NO:

12.

5. The influenza virus of claim 1, wherein after at least 10 consecutive passages in the Vero cell line, (a) serine at position 40, asparagine at position 161, and threonine at position 204 of SEQ ID NO: 16, and / or (b) glutamine at position 176 of SEQ ID NO: 17 are conserved.

6. The influenza virus of claim 1, wherein, after at least 10 consecutive passages in a Vero cell line stably expressing the BM2 ion channel protein of influenza B virus, (a) serine at position 40, asparagine at position 161, and threonine at position 204 of SEQ ID NO: 16, and / or (b) glutamine at position 176 of SEQ ID NO: 17 are conserved.

7. The influenza virus of claim 1, wherein the influenza virus is a recombinant influenza virus.

8. The influenza virus of claim 1, wherein the virus further comprises the PB gene segment.

9. The influenza virus of claim 1, wherein the virus further comprises an NA gene segment and an HA gene segment.

10. The influenza virus of claim 9, wherein the HA gene segment encodes an HA protein consisting of an amino acid sequence containing at least one amino acid mutation in HA2, wherein the at least one amino acid mutation in HA2 is glutamic acid at position 61 or glutamic acid at position 112.

11. The influenza virus of claim 10, wherein the PA, NP and NS gene segments are derived from a single influenza virus strain.

12. The influenza virus of claim 11, wherein the HA gene segment is derived from an influenza strain that is different from the single influenza strain from which the PA, NP and NS gene segments originate.

13. The influenza virus of claim 11, wherein the NA gene segment is derived from an influenza strain that is different from the single influenza strain from which the PA, NP and NS gene segments originate.

14. The influenza virus of claim 1, further comprising a mutated M gene segment, wherein the influenza virus does not encode a functional BM2 protein.

15. The influenza virus of claim 14, wherein the M gene segment encodes a protein consisting of the amino acid sequence of SEQ ID NO:

20.

16. The influenza virus of claim 1, wherein the influenza virus is capable of replicating in human cells.

17. The influenza virus of claim 1, wherein the influenza virus has enhanced growth compared to an influenza virus that is identical under the same conditions in Vero cells except for the absence of serine at position 40, asparagine at position 161, and threonine at position 204 of SEQ ID NO: 16, and glutamine at position 176 of SEQ ID NO:

17.

18. A pharmaceutical preparation comprising the influenza virus according to any one of claims 1-17.

19. The pharmaceutical preparation of claim 18, wherein the pharmaceutical preparation is a vaccine.

20. The pharmaceutical preparation of claim 19, wherein the vaccine is formulated as a monovalent vaccine.

21. The pharmaceutical preparation of claim 19, wherein the vaccine is formulated as a bivalent vaccine.

22. The pharmaceutical preparation of claim 19, wherein the vaccine is formulated as a trivalent vaccine.

23. The pharmaceutical preparation of claim 19, wherein the vaccine is formulated as a quadrivalent vaccine.

24. Use of the influenza virus of any one of claims 1-17 or the pharmaceutical preparation of any one of claims 18-23 in the preparation of a medicament for inducing an immune response against said influenza virus in mammals.

25. The use as described in claim 24, wherein the mammal is a human.

26. A method for generating the influenza virus according to any one of claims 1-17, the method comprising continuously passaged the influenza virus in a Vero cell line.

Images