Method for screening co-culture system for improving production of oxazolmycin compounds and application thereof

Abstract

The present application provides a method for screening a co-culture system for improving the yield of oxazolmycin compounds, and the obtained co-culture system and oxazolmycin compounds obtained by the system. The present application can high-throughput screen the interaction between microorganisms, quickly obtain a culture system with enhanced expression of a target gene cluster, and provide an effective method for mining Streptomyces secondary metabolites. The co-culture system can conveniently and quickly improve the yield of oxazolmycin compounds in Longsheng Streptomyces CGMCC 4.1101, and provide a basis for the separation and identification of novel oxazolmycin compounds.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically, to a Streptomyces-Bacillus subtilis co-culture system that can promote the yield of oxazolidinyl compounds in Streptomyces longsheng CGMCC 4.1101 through high-throughput screening using a microbial co-culture coupled reporter system, and its application in the preparation of the obtained novel oxazolidinyl compounds. Background Technology

[0002] Streptomyces, as a filamentous bacterium, not only has a complex developmental and differentiation process, but also produces a wealth of secondary metabolites, such as avermectin (Campbell WC. History of avermectin and ivermectin, with notes on the history of other macrocyclic lactone antiparasitic agents[J]. Current Pharmaceutical Biotechnology, 2012, 13: 853-865), which has antiparasitic activity; salinomycin (Naujokat C, Steinhart R. Salinomycin as a drug for targeting human cancer stem cells[J]. Journal of Biomedicine and Biotechnology, 2012, 2012: 950658), which has anticancer activity; and leupeptin (Fu L, Shao S, Feng Y, et al. Mechanism of microbial metabolite leupeptin in the treatment of COVID-19 by traditional Chinese medicine), which has inhibitory activity against the novel coronavirus protease. Herbs[J].Mbio,2021:e0222021) and oxazolomycin (Oleksak P, Gonda J, Nepovimova E, et al.The oxazolomycin family:a review of current knowledge[J].RSCAadvances,2020,10:40745-40794), which have multiple activities such as antibacterial or anticancer, are among the most important sources of bioactive natural products (Selim MSM, Abdelhamid SA, Mohamed SS.Secondary metabolites and biodiversity of actinomycetes[J].Journal,Genetic Engineering&Biotechnology,2021,19:72).Meanwhile, the abundant secondary metabolic processes in Streptomyces are subject to complex and strict molecular regulation (Liu G, Chater KF, Chandra G, et al. Molecular regulation of antibiotic biosynthesis in Streptomyces[J]. Microbiology and Molecular Biology Reviews, 2013, 77: 112-143). Under natural conditions, the production of antibiotics by Streptomyces has a certain spatiotemporal dependence, and the yield is often maintained at a relatively low level. Therefore, it is necessary to increase its yield through various means in order to carry out large-scale production and application (Parekh S, Vinci VA, Strobel RJ. Improvement of microbial strains and fermentation processes[J]. Applied Microbiology and Biotechnology, 2000, 54: 287-301). Summary of the Invention

[0003] The inventors have constructed a visual gene expression reporter system—VRS-bAHL (visualization reporter system based on acyl-homoserine lactone)—based on the quorum sensing effect of acyl-homoserine lactone (AHL) signaling molecules in Gram-negative bacteria. Its key feature is the use of the cviI gene, an AHL signaling molecule synthase from Gram-negative bacteria, as a reporter gene. AHL indicator bacteria are used to detect the expression of the reporter gene. This system features a clean background, high sensitivity, ease of operation, wide applicability, and the ability to perform high-throughput visual screening.

[0004] Based on the aforementioned advantages of VRS-bAHL, this invention coupled it with microbial co-culture to establish a novel method for increasing antibiotic production by Streptomyces. A Streptomyces-Bacillus subtilis co-culture system was screened that significantly increased the yield of oxazolidinyl compounds in Streptomyces CGMCC4.1101 from Longsheng, with the yield of eight oxazolidinyl-related compounds increasing to 3.3 to 9.5 times that of Streptomyces cultured alone. Furthermore, this invention also isolated and identified novel oxazolidinyl compounds with inhibitory activity against both Gram-positive and Gram-negative bacteria.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] On one hand, the present invention provides a method for screening co-culture systems to improve the yield of oxazolidinyl compounds, characterized in that the basic bacteria used in the method is Streptomyces A, and the method includes the following steps:

[0007] a. Construct a Streptomyces A reporter strain, wherein the Streptomyces A reporter strain contains the reporter gene AHL signal molecule synthase gene cviI;

[0008] b. Use AHL indicator bacteria to screen for co-cultured bacteria that show increased expression of the target gene of Streptomyces A reporter strain after co-culturing with Streptomyces A reporter strain.

[0009] In some embodiments, the Streptomyces A is Streptomyces longshengensis CGMCC 4.1101.

[0010] In some embodiments, the reporter gene contains a DNA sequence corresponding to a ribosome binding site, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0011] In some implementations, the target gene is the structural gene oxaG, whose nucleotide sequence is shown in SEQ ID NO.5.

[0012] In some implementations, the AHL indicator bacterium is CV026.

[0013] In some embodiments, the AHL signal molecule synthase gene cviI, which contains the DNA sequence corresponding to its own ribosome binding site, is linked to the kanamycin resistance gene kanR1, which contains its own promoter. Then, a portion of the coding region of the structural gene oxaG in the oxa cluster is replaced by a homologous double crossover strategy, thereby disrupting the structural gene oxaG, but retaining the promoter region of the structural gene oxaG to drive the expression of cviI. The introduced kanamycin resistance gene is used as a screening marker for recombinant strains to obtain Streptomyces A reporter strains.

[0014] In some implementations, the step of replacing a portion of the coding region of the structural gene oxaG in the oxa cluster with a homologous double crossover strategy to disrupt the structural gene oxaG includes: amplifying cviI containing the sequence corresponding to its own ribosome binding site, amplifying the kanamycin resistance gene kanR1 containing its own promoter, amplifying the upstream homologous arm of the coding region of the structural gene oxaG in the oxa cluster, amplifying the downstream homologous arm of the coding region of oxaG, and sequentially ligating the upstream homologous arm of the coding region of oxaG, cviI, kanR1, and the downstream homologous arm of the coding region of oxaG to the EcoRV-digested pKC1139 plasmid using Gibson assembly to obtain the recombinant plasmid pKDRoxaG, which is then introduced into Streptomyces A and screened to obtain the Streptomyces A reporter strain.

[0015] In some embodiments, cviI containing the sequence corresponding to its own ribosome binding site is amplified using primers RBSI532F and RBSI532R (SEQ ID NO.13 and SEQ ID NO.14). Optionally, the nucleotide sequence of the cviI containing the sequence corresponding to its own ribosome binding site is shown in SEQ ID NO.3.

[0016] In some embodiments, the kanamycin resistance gene kanR1, which contains its own promoter, is amplified using primers PKANRF and PKANRR (SEQ ID NO.15 and SEQ ID NO.16). Optionally, the nucleotide sequence of the kanamycin resistance gene containing its own promoter is shown in SEQ ID NO.4.

[0017] In some embodiments, the upstream homologous arm (optionally, the nucleotide sequence of which is shown in SEQ ID NO. 19) of the coding region of the structural gene oxaG (optionally, the nucleotide sequence of which is shown in SEQ ID NO. 5) in the oxa cluster is amplified using primers DROXAGLF and DROXAGLR (SEQ ID NO. 17 and SEQ ID NO. 18).

[0018] In some implementations, the downstream homologous arm of the oxaG coding region is amplified using primers DROXAGRF and DROXAGRR (SEQ ID NO.20 and SEQ ID NO.21) (optionally, the nucleotide sequence of which is shown in SEQ ID NO.22).

[0019] In some implementations, any available microorganism, such as bacteria or fungi, is co-cultured with Streptomyces A reporter strain, and then (e.g., by agar block method) the expression of the reporter gene in each system is compared to screen for co-culture systems that increase the yield of oxazolidinyl compounds in Streptomyces.

[0020] In some embodiments, the Streptomyces used for co-culturing with the reporter strain A are selected from Streptomyces coelicolor M1146, Streptomyces albus CGMCC 4.5716, Streptomyces virginiae ATCC 13161, Streptomyces griseus IFO 13350, Streptomyces venezuelae ISP 5230, Streptomyces fradiae FXJ 1.408, Streptomyces olivaceus FXJ 8.021, and Streptomyces FXJ. Streptomyces sp.FXJ 1.088, Streptomyces lividans TK23, Streptomyces ansochromogenes 7100, and Streptomyces luridus CGMCC 4.1115.

[0021] In some embodiments, the bacteria used for co-culturing with the reporter strain Streptomyces A, other than Streptomyces, are selected from Bacillus subtilis CGMCC 1.1630, Staphylococcus aureus CGMCC 1.89, Bacillus cereus CGMCC 1.1626, Staphylococcus epidermidis ATCC 35984, Streptococcus pneumoniae O10, Streptococcus pyogenes #2, Escherichia coli JM109, and Corynebacterium marinum CGMCC 1.6998. 1.6998), Corynebacterium glutamicum CGMCC 1.299, Rhodobacter blasticus CGMCC 1.3365, and Rhodococcus coprophilus CGMCC 4.1813.

[0022] In some embodiments, the fungi used for co-culturing with the Streptomyces A reporter strain are selected from Chaetomium SP.TAN01, Eupenicillium SP.TAN02, Aspergillus SP.TAN03, Aspergillus SP.TAN04, Aspergillus SP.TAN05, Penicillium SP.TAN06, Cladosporium SP.TAN07, Penicillium SP.TAN08, Coprinellus SP.TAN09, Phona SP.TAN10, and Aspergillus SP.TAN11.

[0023] On the other hand, the present invention provides a co-culture system for increasing the yield of oxazolidinyl compounds in Streptomyces, characterized in that the co-culture system comprises Streptomyces and Bacillus subtilis.

[0024] In some embodiments, the Streptomyces is Longsheng Streptomyces CGMCC 4.1101, and the Bacillus subtilis is Bacillus subtilis CGMCC 1.1630.

[0025] On the other hand, the present invention provides oxazolidinyl compounds isolated by increasing the yield through the above-described co-culture system.

[0026] In some embodiments, the oxazolidinyl compound comprises:

[0027] TOXA1(C 36 H 51 N3O 10 ):

[0028]

[0029] TOXA5 (C) 36 H 51 N3O9):

[0030]

[0031] TOXA7 (C) 36 H 51 N3O9):

[0032]

[0033] definition

[0034] CV026: A mutant strain obtained by transposonizing Chromobacterium violaceum CV31532. The cviI gene and the repressor gene for violacein biosynthesis in CV026 are destroyed, resulting in the inability to synthesize AHL. However, when exogenous C6-HSL or other structurally similar AHL are present, the production of violacein can be activated. Therefore, CV026 is widely used for the detection of C6-HSL or other structurally similar AHL.

[0035] cviI: This invention uses two types of cviI, as shown in Example 1 when constructing plasmid pP. hrdB The cviI used in Example 2 does not contain the sequence corresponding to its own ribosome binding site and is numbered SEQ ID NO.2; the plasmid pKDRoxaG used in Example 2 contains the sequence corresponding to its own ribosome binding site and is numbered SEQ ID NO.3.

[0036] Ribosome binding site (RBS): refers to a short ribosome binding site on the mRNA transcribed from DNA, before the start codon. However, for the sake of clarity, some literature directly refers to the DNA sequence corresponding to the RBS as the ribosome binding site. Here, for the sake of accuracy, we use the expression "ribosome binding site corresponding sequence".

[0037] Kanamycin resistance genes: This invention uses two kanamycin resistance genes, both amplified from plasmid pCS26-Pac, but with slightly different lengths, named kanR1 and kanR2 respectively. kanR1 is used to construct plasmid pKDRoxaG, and kanR2 is used to construct integrative plasmid pIJ10500K.

[0038] Beneficial effects

[0039] The yield-enhancing strategy involved in this invention benefits from the low background interference, high sensitivity, and wide applicability of the novel visualization report system VRS-bAHL constructed in our laboratory. It is particularly suitable for screening microbial co-culture systems, thereby conveniently, quickly, and with high throughput enhancing the expression of specific gene clusters in the target host. When different microorganisms coexist, they often inhibit or promote each other. Traditional habitat-overlapping co-culture methods often lead to the gradual elimination of one with a survival advantage by another. However, the microplate solid medium adjacency inoculation co-culture method established in this invention allows different microorganisms to be distributed in adjacent but non-overlapping areas, maximizing their growth and thus generating mutual influence. The microbial co-culture system screened in this invention can significantly improve the CGMCC of *Streptomyces longshengensis*. The yield of oxazolidinyl compounds in 4.1101 provides a foundation for the large-scale preparation and structural identification of oxazolidinyl compounds. Literature reports that 26.2 mg of monomer was prepared from 22 liters of liquid culture medium of *Streptomyces kSM-2690* when preparing KSM-2690B, which has the same structure as TOXA5. In contrast, this invention obtained approximately 20 mg of TOXA5 monomer from 2.5 liters of solid culture medium of *Streptomyces longshengensis* CGMCC 4.1101 and *Bacillus subtilis* CGMCC 1.1630. High performance liquid chromatography (HPLC) yielded the desired results. Liquid chromatography-high performance (HPLC) analysis showed that the compound reached a concentration of approximately 17.4 mg / L in the culture medium, making it the highest-yielding streptomycin culture system for oxazolidinyl KSM-2690B (TOXA5) to date. The novel oxazolidinyl compound TOXA1 obtained is expected to become a new lead compound for broad-spectrum antibacterial drugs. This invention determined the bioactivity of TOXA1, TOXA5, and TOXA7, finding that all three exhibited inhibitory activity against Gram-positive bacteria—Staphylococcus aureus, Bacillus subtilis, and Bacillus cereus. Furthermore, TOXA1 and TOXA5 also showed good inhibitory activity against the Gram-negative plant pathogen Xanthomonas cassia, with minimum inhibitory concentrations (MICs) of 50 μg / mL and 12.5 μg / mL, respectively. In addition, TOXA5 also showed inhibitory activity against the Gram-negative bacteria Pseudomonas aeruginosa and Burkholderia cepacia.

[0040] The yield-increasing strategy of this invention is applicable not only to the oxa gene cluster of oxazole-like compounds biosynthesizing in *Streptomyces longshengensis* CGMCC 4.1101, but also to different types of target gene clusters or genes in other microorganisms or higher plants and animals to which VRS-bAHL is applicable; the microbial co-culture system described in this invention is not limited to the above-mentioned culture conditions, but is also applicable to other feasible culture media or culture methods, such as co-culture in liquid culture media; the potential application areas of the oxazole-like compound TOXA1 described in this invention are not limited to the inhibition of pathogenic microorganisms, but are also applicable to other potential application areas, such as anticancer and antiviral applications. Attached Figure Description

[0041] To facilitate understanding of the principles, technical solutions, and product types of this invention, further explanation will be provided below with reference to the accompanying drawings.

[0042] Figure 1 This paper analyzes the principle of the Visual Reporting System (VRS-bAHL) and its feasibility in applying it to Longsheng Streptomyces CGMCC 4.1101. Figure 1 A is the principle of VRS-bAHL; Figure 1 B is a feasibility analysis of the application of VRS-bAHL in *Streptomyces longshengensis* CGMCC 4.1101. The amount of violacein produced can be represented by the size of the purple circle (shown in the figure as a dark circle around a *Streptomyces* mycelium block on a solid culture medium). A larger purple circle indicates higher violacein production, i.e., higher AHL production, reflecting higher cviI expression in the reporter system, and thus indicating higher promoter activity (driving cviI expression) and stronger transcription of the gene controlled by this promoter in the gene cluster; conversely, the opposite is also true.

[0043] Figure 2 This study compares the gene arrangement of the oxazolidinium biosynthesis gene cluster in *Streptomyces longshengensis* CGMCC 4.1101 with that of known oxazolidinium biosynthesis gene clusters. Figure 2 A represents the gene arrangement of the oxa gene cluster, which is responsible for the biosynthesis of oxazolidins in Streptomyces longsheng CGMCC 4.1101. Figure 2 B is the gene arrangement of the ozm gene cluster in the known oxazolidin gene cluster - Streptomyces whitei JA3453.

[0044] Figure 3 This study investigated the expression of oxazolidinyl compound biosynthesis gene clusters and product analysis in Streptomyces longshengense CGMCC 4.1101. Figure 3 A is a schematic diagram of the construction strategy for reporter strain 4.1101DRoxaG; Figure 3B is an analysis of the expression of the reporter gene cviI in 4.1101DRoxaG using the agar block method, with the wild-type strain 4.1101WT of Streptomyces longsheng CGMCC 4.1101 serving as a negative control. Figure 3 C represents the HPLC analysis of fermentation products from 4.1101HcviI, a cviI-high expression strain derived from 4.1101WT, 4.1101DRoxaG, and 4.1101WT.

[0045] Figure 4 VRS-bAHL coupled microbial co-culture improves the yield of oxazolidinone compounds in Streptomyces longsheng CGMCC 4.1101. Figure 4 A is a comparison of the expression of reporter genes after co-culturing 4.1101DRoxaG with different microorganisms; Figure 4 B is an analysis of the expression of reporter genes of 4.1101DRoxaG and Bacillus subtilis CGMCC 1.1630, both individually and in co-culture. Figure 4 C represents the HPLC analysis of the products of Bacillus subtilis 4.1101WT and Bacillus subtilis CGMCC 1.1630, both alone and in co-culture.

[0046] Figure 5-7 These are the nuclear magnetic resonance spectra of TOXA1, TOXA5, and TOXA7, respectively. A in each figure represents… 1 H-NMR spectrum; B is 13 C-NMR spectrum; C is the DEPT135 spectrum; D is... 1 H- 1 H COSY spectrum; E is... 1 H- 13 C HSQC spectrum; F is 1 H- 13 C HMBC spectrum; G is 1 H- 1 H ROESY spectrum.

[0047] Figure 8 This involves the chemical structure and activity analysis of TOXA1, TOXA5, and TOXA7. Figure 8 A represents the chemical structures of TOXA1, TOXA5, and TOXA7; Figure 8 B represents the analysis of the antibacterial activity of TOXA1, TOXA5, and TOXA7. Detailed Implementation

[0048] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0049] The microorganisms used in this invention for increasing the production of oxazolidinyl compounds can be commercially available from a company or from a microbial culture center. For example, microorganisms indicated by a culture number are purchased from a culture center. Other microorganisms used in this invention for co-culturing with Streptomyces reporter strains can be any available microorganisms, such as different bacteria or fungi.

[0050] Example 1: The principle of the Visual Reporting System (VRS-bAHL) and its feasibility analysis in the application of Streptomyces longsheng CGMCC 4.1101.

[0051] The basic principle of VRS-bAHL is to use the AHL synthase gene cviI of the Gram-negative bacterium Chlorobacterium violaceum CV31532 as a reporter gene, and to use the AHL indicator bacterium CV026 to detect the expression of the reporter gene, that is, the synthesis of AHL.

[0052] This invention first verified the feasibility of applying VRS-bAHL in *Streptomyces longshengensis* CGMCC 4.1101. First, an integrative plasmid pIJ10500K with a kanamycin resistance gene marker was constructed: primers KANRF and KANRR (SEQ ID NO. 6 and SEQ ID NO. 7) were synthesized, and the DNA sequence of the kanamycin resistance gene kanR2 (SEQ ID NO. 8) was amplified from plasmid pCS26-Pac (Tahlan K, Ahn SK, Sing A, et al. Initiation of actinorhodin export in *Streptomyces coelicolor* [J]. Molecular Microbiology, 2007, 63: 951-961). After double digestion with HindIII and KpnI, the sequence was ligated to the HindIII / KpnI double-digested pIJ10500 plasmid to obtain the integrative plasmid pIJ10500K with the kanamycin resistance gene marker. Next, we constructed plasmid pP for constitutive expression of the AHL synthase gene cviI. hrdB -cviI: Using genomic DNA from Streptomyces cerevisiae M1146 as a template, the strong promoter P was amplified using primers PHRDBF and PHRDBR (SEQ ID NO. 9 and SEQ ID NO. 10). hrdB The DNA sequence (SEQ ID NO.1) was obtained and digested with NdeI; using the genomic DNA of Chlorella vulgaris CV31532 as a template, the DNA sequence (SEQ ID NO.2) of cviI, which does not contain the sequence corresponding to its own ribosome binding site, was amplified using primers I532F (phosphorylated) and I532R (SEQ ID NO.11 and SEQ ID NO.12), and then digested with SpeI; then the digested PhrdB The plasmid pP was obtained by ligating cviI with pIJ10500K that had been double-digested with NdeI / SpeI. hrdB -cviI. Plasmid pIJ10500K and pP were transferred via conjugation transfer (Kieser T, Bibb MJ, Buttner MJ, et al., Practical Streptomyces Genetics [M]. John Innes Foundation Norwich, 2000). hrdB -cviI was introduced into *Streptomyces longshengensis* CGMCC 4.1101 and integrated into its genome, serving as the negative control strain 4.1101NC and the positive control strain 4.1101HcviI, constitutively expressing the reporter gene (AHL synthase gene cviI). In 12-well MS solid medium, 4.1101NC and 4.1101HcviI were inoculated (5 μL of spore collection solution was directly applied) and incubated upside down for 3 days. AHL production in both strains was then detected using the AHL indicator strain CV026 via the agar block method. The results showed that only 4.1101HcviI significantly activated the production of violacein in CV026, indicating efficient expression of the reporter gene cviI. The negative control strain 4.1101NC showed no activation. This demonstrates the feasibility of using the VRS-bAHL visualization gene expression reporter system in *Streptomyces longshengensis* CGMCC 4.1101 with a clean background. Figure 1 ).

[0053] The specific procedure for the agar block method is as follows: Pick a single colony of CV026 into a small test tube containing 3 mL of LB liquid medium and incubate overnight at 28°C and 220 rpm with shaking. Transfer the grown bacterial solution to a large test tube containing 10 mL of LB liquid medium at an inoculation ratio of 1:100 and continue to incubate with shaking for 5-6 hours. Add the grown bacterial solution to the melted soft agar LB medium (LB medium containing 1% agar) at a ratio of 1:10. Pour the solution onto a plate and dry it in a clean bench for 30 minutes. Take an agar block from a suitable position on the solid medium plate of the strain to be tested and place it on the surface of the dried plate. After incubating for 20-40 hours, observe the production of violet bacitracin around the agar block on the medium plate.

[0054] MS medium formulation: mannitol 20 g / L, soybean flour 20 g / L, solid medium with 1.5% agar, sterilized at 115°C for 30 minutes.

[0055] The formula for soft agar LB medium is as follows: tryptone (OXOID) 10 g / L, yeast extract (OXOID) 5 g / L, NaCl 10 g / L, and 1.0% agar added to solid medium as needed. Sterilize at 121°C for 30 minutes.

[0056] The PCR reaction conditions were as follows: DNA polymerase KOD FX (1U / μL) 1μL, PCR buffer 2× PCR Buffer for KOD FX 25μL, dNTPs (2mM each) 10μL (all reagents purchased from TOYOBO, Japan), DMSO 2.5μL, 10μM primers 1.5μL each, template DNA 2.5μL (10-50ng), ddH2O 6μL, total reaction volume 50μL. PCR cycling conditions: pre-denaturation: 94℃, 5min; 30 cycles of amplification reaction (denaturation: 94℃, 30sec; annealing: 60℃, 30sec; extension: 68℃, 1kb / min, the specific extension time is determined according to the length of the amplified fragment); 68℃, 5min; 4℃, storage.

[0057] The conjugation transfer method is as follows: (1) Transform the target plasmid into Escherichia coli ET12567 / pUZ8002 competent cells, spread them on LB medium plates containing the corresponding antibiotics, and incubate them upside down at 37°C; (2) Pick the transformants into small test tubes containing 3 mL of LB liquid medium containing the corresponding antibiotics, and incubate them at 37°C with shaking at 220 rpm; (3) Transfer the grown bacterial culture at an inoculation rate of 1:100 to large test tubes containing 10 mL of LB liquid medium (for conjugation transfer, containing 0.1% glucose) containing the corresponding antibiotics, and incubate them at 37°C with shaking at 220 rpm until OD 600 Approximately 0.4-0.6; (4) Centrifuge at 4000 rpm for 5 minutes, collect the bacterial cells, wash the bacterial cells two to three times with LB medium, and then resuspend them with 500 μL of LB medium; (5) Collect an appropriate amount of fresh or frozen Streptomyces spores from Longsheng, wash them twice with LB medium, then resuspend them with 500 μL of LB medium, heat shock them in a 50℃ water bath for 5-10 minutes, cool them to room temperature, and use them within 1 hour; (6) Mix the above Escherichia coli cells and Streptomyces spores in equal volumes, spread them on MS medium plates containing 10 mM MgCl2 or 20 mM CaCl2, blow dry them, and incubate them upside down at 28℃; (7) After culturing for 16-20 hours, spread naphthylpyridinol and kanamycin on the plates to a specific final concentration, where the final concentration of naphthylpyridinol is 25 μg / mL and the final concentration of kanamycin is 50 μg / mL, blow dry them, and incubate them upside down at 28℃ for 3-7 days to obtain the corresponding recombinant strain, i.e., the conjugate.

[0058] Example 2: Expression detection and product analysis of oxazolidinyl compound biosynthesis gene clusters in *Streptomyces longshengensis* CGMCC 4.1101

[0059] This invention, through antiSMASH analysis, discovered a biosynthetic gene cluster of oxazolomycin compounds in the genome of *Streptomyces longshengensis* CGMCC 4.1101, which was named oxa. By comparing the gene arrangement and annotating the gene function of the known oxazolomycin gene cluster—the ozm gene cluster in *Streptomyces albus* JA3453 (Zhao C, Coughlin JM, Ju J, et al. Oxazolomycin biosynthesis in Streptomyces albus JA3453 featuring an "acyltransferase-less" type Ipolyketide synthase that incorporates two distinct extender units[J]. Journal of Biological Chemistry, 2010, 285: 20097-20108)—it was found that the oxa cluster in *Streptomyces longshengensis* CGMCC 4.1101 is relatively complete, but differs somewhat from ozm. Therefore, this invention decided to study oxa in order to discover novel oxazolomycin compounds (…). Figure 2 ).

[0060] To detect the expression of the oxa gene cluster and facilitate subsequent identification of its products, we first constructed a bifunctional reporter strain based on the oxa gene cluster using a homologous double crossover strategy. The specific procedures are as follows: cviI (SEQ ID NO. 3) containing the sequence corresponding to its own ribosome binding site (RBS) was amplified using primers RBSI532F and RBSI532R (SEQ ID NO. 13 and SEQ ID NO. 14); the kanamycin resistance gene kanR1 (SEQ ID NO. 4) containing its own promoter was amplified using primers PKANRF and PKANRR (SEQ ID NO. 15 and SEQ ID NO. 16); the upstream homologous arm (SEQ ID NO. 19) of the coding region of the structural gene oxaG (SEQ ID NO. 5) in the oxa cluster was amplified using primers DROXAGLF and DROXAGLR (SEQ ID NO. 17 and SEQ ID NO. 18); and the downstream homologous arm (SEQ ID NO. 22) of the coding region of oxaG was amplified using primers DROXAGRF and DROXAGRR (SEQ ID NO. 20 and SEQ ID NO. 21). The amplification was then performed using Gibson assembly (Gibson DG, Young L, Chuang RY, et al. Enzymatic assembly). The above four sequences were ligated with the EcoRV-digested pKC1139 plasmid to obtain the recombinant plasmid pKDRoxaG. Then, it was introduced into Longsheng Streptomyces CGMCC 4.1101 via conjugation transfer. Subsequently, a segment of the coding region of the structural gene oxaG was replaced by homologous double crossover, thereby destroying the gene but retaining its promoter region to drive cviI expression. At the same time, a kanamycin resistance gene was introduced as a selection marker for the recombinant strain, and finally, a bifunctional reporter strain 4.1101DRoxaG was obtained. That is, this mutant strain contains the cviI reporter gene to indicate the expression level of the structural gene oxaG, and the gene deletion mutant can be used as a negative control strain that cannot synthesize oxazolidin.

[0061] Subsequently, this invention selected 12-well microplates and used MS solid medium to invert the reporter strain 4.1101DRoxaG (directly inoculated with 5 μL of spore collection solution). After an appropriate time, the expression of the reporter gene cviI was detected using the AHL indicator strain CV026 via the agar block method. The wild-type strain of *Streptomyces longshengensis* CGMCC 4.1101 (4.1101WT) was selected as a negative control. The results showed that after 3 days of culture, 4.1101DRoxaG significantly activated the biosynthesis of violacein in CV026, while the control strain 4.1101WT showed no activation. This indicates that the promoter of the structural gene oxaG can drive the expression of cviI under the above culture conditions. Subsequently, HPLC analysis was performed on the extracts of wild-type strain 4.1101WT, reporter strain 4.1101DRoxaG, and the 4.1101-derived cviI-high-expressing strain 4.1101HcviI fermented on MS solid medium for 3 days. The results showed that the peaks of eight compounds produced in 4.1101WT disappeared in 4.1101DRoxaG, while the differential peaks in 4.1101HcviI remained. This indicates that the disappearance of the differential peaks was due to the destruction of the structural gene oxaG rather than the expression of the reporter gene cviI. Therefore, we speculate that these differential peaks may be products related to the oxa gene cluster, and named them TOXA1-TOXA8, respectively. Figure 3 However, the yields of these compounds are very low, which is not conducive to further separation and purification.

[0062] The PCR reaction conditions were the same as in Example 1; the culture medium formulation was the same as in Example 1; the conjugation transfer experiment was performed as in Example 1, except that the final concentration of apramycin used was 75 μg / mL; the agar block method was performed as in Example 1.

[0063] Gibson one-step cloning kit was purchased from YEASEN. The reaction conditions were as follows: 10 μL of 2×Hieff Clone MultiSEnzyme Premix, x ng of each fragment (x = 0.02 × fragment base number), and ddH2O to a total volume of 20 μL. After mixing, the mixture was placed at 50 °C for 50 min and then transformed into competent cells.

[0064] The homologous double crossover screening process is as follows: After the obtained conjugates are expanded and cultured on MS medium plates containing apramycin, they are transferred to MS medium plates containing apramycin and cultured at 37°C. The resulting single crossover mutants are transferred to MS medium plates without antibiotics and cultured at 28°C for two generations. After that, the spores are collected, diluted, and spread on MS medium plates without antibiotics. Then, single colonies are picked for resistance verification. Colonies that have lost apramycin resistance are selected for PCR verification. The correct colonies are the target strains, which are then expanded and used for subsequent experiments.

[0065] Extraction and analysis of oxazolidinyl compounds in *Streptomyces longshengensis* CGMCC 4.1101: After incubating the strain upside down in 12-well plates on MS medium for 3 days, the strain was chopped and transferred to 5 mL centrifuge tubes. An equal volume of methanol was added, and the mixture was incubated overnight at 4°C. The incubator was then sonicated in an ice-water bath for 30 min. The supernatant was collected, filtered, and used for HPLC analysis. The chromatographic column used was a Zorbax SB-C18, 4.6 × 250 mm, 5 μm; the mobile phase was acetonitrile and water containing 0.1% formic acid; the flow rate was 1 mL / min; and the detection wavelength was 280 nm. Specific conditions are shown in Table 1.

[0066] Table 1. HPLC separation conditions of oxazolidinone compounds in Streptomyces longshengensis

[0067] Acetonitrile (%) 37 37 100 100 37 37 Water containing 0.1% formic acid (%) 63 63 0 0 63 63

[0068] Example 3: VRS-bAHL coupled microbial co-culture enhances the yield of oxazolidinone compounds in Streptomyces longsheng CGMCC4.1101

[0069] To facilitate the large-scale preparation of TOXAs, we attempted to couple VRS-bAHL with microbial co-culture to construct a method for increasing antibiotic production targeting specific gene clusters. Specifically, we enhanced the expression level of the oxa gene cluster in *Streptomyces longshengensis* CGMCC 4.1101 through microbial co-culture, and used the VRS-bAHL reporter system for high-throughput screening. Ultimately, we obtained a microbial co-culture system that could promote the enhanced expression of gene clusters involved in the biosynthesis of oxazolidinyl compounds in *Streptomyces longshengensis*, and used it to increase the yield and preparation of TOXAs. The specific process is as follows: MS medium was selected, and various microorganisms, such as Streptomyces, other bacteria besides Streptomyces, and fungi, were co-cultured with reporter strain 4.1101DRoxaG in 12-well plates. 5 μL of spore suspension of the reporter strain was directly inoculated, and 5 μL of spore suspension of the co-culture strain (Streptomyces and fungi) or 5 μL of overnight culture of other bacteria in LB medium was inoculated at adjacent wells. After inverted culture for 3 days, the expression of the reporter gene in each co-culture system was detected by the agar block method and compared with that of 4.1101DRoxaG cultured alone (the area of ​​the purple bacitracin band induced by agar blocks in each culture system was calculated using ImageJ software, and the area of ​​the purple bacitracin band of the negative control (NC) – 4.1101DRoxaG cultured alone – was set to 1, and the other co-culture systems were normalized compared to it). The results showed that when 4.1101DRoxaG was cultured with Bacillus subtilis CGMCC… When co-cultured with 1.1630, the area of ​​the purple bacitracin ring generated by CV026 activated by the agar block increased significantly by 46%, indicating that the yield of AHL in the reporter strain was significantly increased. This suggests that Bacillus subtilis CGMCC 1.1630 likely enhanced the expression of the key structural gene oxaG.

[0070] Subsequently, the reporter strain 4.1101DRoxaG and Bacillus subtilis CGMCC 1.1630 were cultured separately and co-cultured, and the production of AHL was detected by the agar block method. This further confirmed that the AHL production in 4.1101DRoxaG was significantly increased after co-culture compared with that in the case of single culture, that is, the expression of the reporter gene cviI was enhanced. Subsequently, HPLC analysis and peak area comparison were performed on the products of *Streptomyces longshengensis* CGMCC4.1101 wild-type 4.1101WT and *Bacillus subtilis* CGMCC 1.1630 in 12-well plates and on MS medium, both individually and in co-culture. Co-culture revealed that the yields of all eight TOXAs were significantly increased, with the following fold increases compared to those obtained from individual culture: TOXA1, 4.6 times; TOXA2, 4.0 times; TOXA3, 4.1 times; TOXA4, 4.4 times; TOXA5, 9.3 times; TOXA6, 5.1 times; TOXA7, 9.5 times; and TOXA8, 3.3 times. This provided a foundation for further isolation, purification, and structural identification.

[0071] The culture medium formulation used was the same as in Example 1; the operation of the agar block method was the same as in Example 1; the extraction and analysis of oxazolidinyl compounds in *Streptomyces longshengensis* CGMCC4.1101 was the same as in Example 2; the different microorganisms used for co-culture are shown in Table 2.

[0072] Table 2 shows the strains used in co-culturing with 4.1101DRoxaG.

[0073]

[0074]

[0075] Example 4: Isolation, purification, structural identification, and activity analysis of oxazolidinyl compounds (TOXAs) from *Streptomyces longshengensis* CGMCC 4.1101

[0076] To identify the chemical structures of TOXAs produced by *Streptomyces longshengensis* CGMCC 4.1101, we conducted large-scale co-culture and product extraction with *Bacillus subtilis* CGMCC 1.1630. The extract was separated by two rounds of HPLC to obtain three monomers: TOXA1, TOXA5, and TOXA7. High-resolution mass spectrometry analysis showed the relative molecular weights [M+Na] of TOXA1, TOXA5, and TOXA7. + The values ​​are 708.3482, 692.3519, and 692.3514, respectively, from which their molecular formulas can be deduced as C0. 36 H 51 N3O 10 C 36 H 51 N3O9 and C 36 H51 N3O9, combined with nuclear magnetic resonance analysis (Tables 3, 4, and 5), Figure 5 , Figure 6 and Figure 7 The chemical structures of these compounds were determined, and they are all oxazolomycin compounds. TOXA5 and TOXA7 are structurally identical to the previously reported compounds KSM-2690B and KSM-2690C (Otani T, Yoshida K, Kubota H, et al. Novel triene-beta-lactone antibiotics, oxazolomycin derivative and its isomer, produced by Streptomycess p. KSM-2690[J]. Journal of Antibiotics, 2000, 53: 1397-1400), while TOXA1 is a novel oxazolomycin compound (…). Figure 8 ).

[0077] Subsequently, this invention selected three Gram-positive bacteria and three Gram-negative bacteria respectively, and determined the antibacterial activities of TOXA1, TOXA5, and TOXA7. It was found that all three had inhibitory activities against Gram-positive bacteria - Staphylococcus aureus CGMCC 1.89, Bacillus subtilis CGMCC 1.1630, and Bacillus cereus CGMCC 1.1626. Moreover, TOXA1 and TOXA5 also had good inhibitory activities against Gram-negative plant pathogen Xanthomonas campestris Xcc 8004, with minimum inhibitory concentrations (MICs) of 50 μg / mL and 12.5 μg / mL, respectively. In addition, TOXA5 also exhibits inhibitory activity against Gram-negative bacteria, specifically Pseudomonas aeruginosa PA14 and Burkholderia cepacia CGMCC 1.1813. Figure 8 ).

[0078] Large-scale co-culture was performed using 90mm diameter petri dishes and MS solid medium plates. Wild-type *Streptomyces longshengensis* strain and *Bacillus subtilis* were inoculated near each other (using cotton swabs to apply *Streptomyces* spores or *Bacillus subtilis* bacterial suspension). After incubation upside down for 3 days, extraction was performed using the same method as in Example 2. The extract was concentrated and dissolved in a mixture of methanol and water in equal proportions before HPLC separation. The separation was performed in two rounds under the following conditions: a semi-preparative reversed-phase Zorbax SB-C18 column (9.4×250mm, 5μm) was used; the mobile phase in the first round of HPLC contained 0.1% formic acid in water, while the second round did not; the composition and proportion of the mobile phase were the same as in Table 1 of Example 2; the flow rate was 3 mL / min; and the detection wavelength was 280 nm.

[0079] Table 3 TOXA1 1 H and 13 C NMR data

[0080]

[0081]

[0082] Table 4 TOXA5 1 H and 13 C NMR data

[0083]

[0084]

[0085]

[0086] Table 5 TOXA7 1 H and 13 C NMR data

[0087]

[0088]

[0089] sequence list

[0090] Constitutive promoter P of SEQ ID NO.1 Streptomyces coelicolor hrdB

[0091] ccgccttccg ccggaacggc ggggtccggg cacgccaaac ccctcctgtg gctgtggccggccaccgccg tcaccttcgg accccgtgga gccgctcccg gttccacggg gtccgaaggt gtgatgagcaggctgcgcct tcctcgcgcg gccgcaaggt acgagttgat gaccttgttt atccgcatct gaccaattttgatcgcttac ggggtgtgac tcgggccacg cggattgggc gtaacgctct tgggaacaac acgatgacctaagaggtgac agccgcggag ggaatacgga cgccgttcac ggcgctgtgc atctccccgg cccgcccgcaccgtcggccc attcccaagc cggtggtcgg cccctgtccg ccgtggacgg ggccggaagc cgtttttcaacgttccgaga ggttgttc

[0092] SEQ ID NO.2 is the nucleotide sequence of the AHL signaling molecule synthase gene cviI from *Chromobacterium violaceum* CV31532, which does not contain the DNA sequence corresponding to its self-ribosome binding site.

[0093] gtgaaaaagt tctactcgtt gcaattggat ggtttggtgt tggaccgggt cgaagacgaaagcacgatgc tcgacctgct ggcgttcaga cacaagattt tccgggagaa tctgcgttgg ctgccggtgtgcggcaatgg cttggatagg gatgaatacg acgccatttc cgataatctg gcgatctgcc tggatggccaggtggtgggg tcggtcaggt ttactccggg aaccgagcgt tatatgttgg aaaaggactt ttccaggctattggtgccgg acgagatttt gtacaaaggg ggggcaagcg cggagatctc gcgtttcgcg gtggacacggaaacgctggg caggaaactg accgcttccg cttcccgatt gctgtatctc agcttgtggc aatgggcggagtggaacgag atccgctgga tgtatttcgt ggtagagccg tctatgtacc gccggctggt cgcgcttggtttccccatcc ggcccgtggg ggtcccgcga ccgcttgacg gcggagtgct gtccatggcc ggctatttcgactggggcca gatccgcggc gaggtcattc gttcgctacg gtcgagggtg gcattgccag atgcatgcccagcacaatgg cgtgagtacg attattcgca ttga

[0094] The nucleotide sequence of the cviI AHL signal molecule synthase gene from *Chromobacterium violaceum* CV31532, whose SEQ ID NO. 3 comprises the DNA sequence corresponding to its own ribosome binding site

[0095] aaccaaaatt aggaggcttg agtgaaaaag ttctactcgt tgcaattgga tggtttggtgttggaccggg tcgaagacga aagcacgatg ctcgacctgc tggcgttcag acacaagatt ttccgggagaatctgcgttg gctgccggtg tgcggcaatg gcttggatag ggatgaatac gacgccattt ccgataatctggcgatctgc ctggatggcc aggtggtggg gtcggtcagg tttactccgg gaaccgagcg ttatatgttggaaaaggact tttccaggct attggtgccg gacgagattt tgtacaaagg gggggcaagc gcggagatctcgcgtttcgc ggtggacacg gaaacgctgg gcaggaaact gaccgcttcc gcttcccgat tgctgtatctcagcttgtgg caatgggcgg agtggaacga gatccgctgg atgtatttcg tggtagagcc gtctatgtaccgccggctgg tcgcgcttgg tttccccatc cggcccgtgg gggtcccgcg accgcttgac ggcggagtgctgtccatggc cggctatttc gactggggcc agatccgcgg cgaggtcatt cgttcgctac ggtcgagggtggcattgcca gatgcatgcc cagcacaatg gcgtgagtac gattattcgc attga

[0096] The nucleotide sequence of kanamycin resistance gene kanR1 containing its own promoter in SEQ ID NO. 4

[0097] aagggcctcg tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttagacgtcggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac tggatggctttcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag acaggatgag gatcgtttcgcatgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgactgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttctttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc tatcgtggctggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgctattgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta tccatcatggctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc gaccaccaag cgaaacatcgcatcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcaggggctcgcgc cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgaggat ctcgtcgtgacccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtggccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga agagcttggcggcgaatggg ctgaccgcttcctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc atcgccttctatcgccttct tgacgagttc ttctgagcgg gactctggg

[0098] SEQ ID NO.5 Nucleotide sequence of the structural gene oxaG in the oxa gene cluster of *Streptomyces longshengensis* CGMCC4.1101.

[0099] atggaagacc cggccgcgcg actggccgtg ctgggagccg gtgtcatggg cgtcagcatcacgacgctcg ccctcggcca gggcgtcccg gtgctcctgg tcgagaccga cccgcagaag cgggcgggggcccgcgccag gatcgagcgc gagctgcgga cggcacacct cctgggggcc cgtccggacg ttccgcagggtcagttggag atcaccgact cgctcggcga ctgccgcgac gccgacgcgg tgatcgaagc ggtcaccgaggacgccgggc tcaaggtcaa ggcactgacc gaggccggtg cgatgaccgg ccccggcacc gtgctggtgaccaacacctc ctccatcccg gtggacgagc tggcgaccca actgccgtat cccgagcggc tggtcggcgtccacttcatg aacccctcgt acctgatccg gacggtcgag gtcatccgcg gcgcccgcac cggcgagccggccgtggagg ccgtccggcg ggtgctcgcg gcactcgacc ggcgcggcgt cttcgtcggc gacggccccggcttcgtcac cagccgggtg ctgcaccgca tgatcaacga cgcggcgcgg gtcgtacagg agggccgggccaccgccgag gacgtggaca ccctgatgca cgactgcctg gggcaccgca ccgggccgct gcgcaccgccgacctgatcg gcctggacaa cctcgtggac tccctgtggg tcctgcacca gcgcaccggc gacgaggggtgccgcccctg cgacctgctg ctgcagaagg tgcgcgacgg cgagcacggc cgcaagaacg gccgcggcttctacacctac ccgggcgcgg tggtctga

[0100] Primer KANRF for amplifying kanamycin resistance gene kanR2 containing its own promoter in SEQ ID NO. 6

[0101] cccaagcttaagggcctcgtgatacgc

[0102] SEQ ID NO.7 Primer KANRR amplifies the kanamycin resistance gene kanR2, which contains its own promoter.

[0103] ggggtaccggctaatgcacccagtaagg

[0104] SEQ ID NO.8 is the nucleotide sequence of the kanamycin resistance gene kanR2, which contains its own promoter.

[0105] aagggcctcg tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttagacgtcggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac tggatggctttcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag acaggatgag gatcgtttcgcatgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgactgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttctttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc tatcgtggctggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgctattgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta tccatcatggctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc gaccaccaag cgaaacatcgcatcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcaggggctcgcgc cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgaggat ctcgtcgtgacccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtggccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga agagcttggcggcgaatggg ctgaccgcttcctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc atcgccttctatcgccttct tgacgagttc ttctgagcgg gactctgggg ttcgagagct cgcttggact cctgttgatagatccagtaa tgacctcaga actccatctg gatttgttca gaacgctcgg ttgccgccgg gcgttttttattggtgagaa tccaagcact agggacagta agacgggtaa gcctgttgat gataccgctg ccttactgggtgcattagcc

[0106] SEQ ID NO.9 Amplification of strong promoter P hrdB Primer PHRDBF

[0107] ggaattccatatgccgccttccgccggaac

[0108] SEQ ID NO.10 Amplifies the strong promoter P hrdB primer PHRDBR

[0109] gaacaacctctcggaacgttgaa

[0110] Primer I532F (phosphorylated) was used to amplify cviI that does not contain the DNA sequence corresponding to its own ribosome binding site, as specified in SEQ ID NO. 11.

[0111] gtgaaaaagttctactcgttgc

[0112] Primer I532R for amplifying cviI that does not contain the DNA sequence corresponding to its own ribosome binding site, SEQ ID NO.12.

[0113] ggactagttcaatgcgaataatcgtactca

[0114] Primer RBSI532F for amplifying cviI containing the DNA sequence corresponding to its self-ribosome binding site, as specified in SEQ ID NO.13.

[0115] aaccaaaatt aggaggcttg agtg

[0116] Primer RBSI532R for amplifying cviI containing the DNA sequence corresponding to its self-ribosome binding site, SEQ ID NO.14.

[0117] tcaatgcgaa taatcgtact cacg

[0118] SEQ ID NO.15 Primer PKANRF amplifies the kanamycin resistance gene kanR1, which contains its own promoter.

[0119] caatggcgtg agtacgatta ttcgcattga aagggcctcg tgatacgcct

[0120] SEQ ID NO.16 Primers PKANRR amplify the kanamycin resistance gene kanR1, which contains its own promoter.

[0121] cccagagtcc cgctcagaag

[0122] SEQ ID NO.17 Primer DROXAGLF for amplifying the upstream homologous arm of the coding region of the structural gene oxaG in the oxa cluster.

[0123] gactctagag gatccgcggc cgcgcgcgat cgccccactt gctgtaactg c

[0124] SEQ ID NO.18 Primer DROXAGLR for amplifying the upstream homologous arm of the coding region of the structural gene oxaG in the oxa cluster.

[0125] ctttttcact caagcctcct aattttggtt ggtgatctcc aactgaccct gc

[0126] Nucleotide sequence of the upstream homologous arm of the coding region of the structural gene oxaG in SEQ ID NO.19

[0127] cgccccactt gctgtaactg cggccgtctt tcgcctcggg gtggaagtgc gaatccacgtcccaacggtc ggcgggcacc tcgctgatgc agttccggcc gtcggcgata ttgcgccaca gttcgtccggcgtgcgggcc gaagggtagc gcccggccag cccgatgacc gcgatatcca cgtcggccgc ggtatccggagcggtgggag agccctgctg ctgtacggca gccagcaatt tcaggagaag agcacgcttg tcgtccatagaccttcgtct cgcccgggtg acatagctga acggatatct cgaccggcca ccgcaccgcg ccgtgccgtcaggcagggca gcgctcggta gacattcaaa tgaacaccaa cgaaaacttc aggacttgcg tcgcggaaggcgacgtacgg gcctgctaaa aggcccttgc attggtatgg ggagaactgc cttcgggctt catggccgacagagcccaga caggcggact gcagcaaccc agcatcctca acccccgttg acacactgtc gtcagcagctcaggcggaag gcgcccgcct gctcctctga gacgggaacg taacatcgat tctcaagggg tggcaagtgattcgatcaag ggacatctcg accgactccg ggtctcacct ggagtattac ccggacgccg caggtcacggccagtgcgtc ggcaactccc ccgggcatag tccgaaagtt caccagcgga accggagcgg gctttccggaacgaacgatt ccgagaccaa ctcagaacaa tcatgctacg gtccagactc cggcggaccc aagtggagggttatgacttc gcatcgcaga cccccacgca ttacacccgt gtaattcacg gaacgaagca ctccggattcctcgaccggc gcgtccgcacactggattcg acacccgggc cgggcaaggg gcagcgctcc ccgccccggcccgttcaccc gcgcccgccg cgggtcacac ccctgtcggc cccttgagga attcggtccg cacccggaccgccactttca aactttcaac aaatcacaaa cctcgaccta ctgcctgagc aatgcaatta attgtgctgtcaaccgctag gtaacggagg tatgcggtga caatggaaga cccggccgcg cgactggccg tgctgggagccggtgtcatg ggcgtcagca tcacgacgct cgccctcggc cagggcgtcc cggtgctcct ggtcgagaccgacccgcaga agcgggcggg ggcccgcgcc aggatcgagc gcgagctgcg gacggcacac ctcctgggggcccgtccgga cgttccgcag ggtcagttgg agatcacc

[0128] SEQ ID NO.20 Primers amplifying the downstream homologous arm of the oxaG coding region: DROXAGRF ttgacgagttcttctgagcg ggactctggg ccgcggcttc tacacctacc

[0129] Primers for amplifying the downstream homologous arm of the oxaG coding region (SEQ ID NO. 21): DROXAGRR aaacagctatgacatgatta cgaattcgat cttgaccgtg gtggcgatg

[0130] Nucleotide sequence of the downstream homologous arm of the coding region of SEQ ID NO.22oxaG

[0131] ccgcggcttc tacacctacc cgggcgcggt ggtctgatgg ccgatcaact caccctcgacgaccggctcc gggactacgt ccggcaggtc tcgctgcgcg acgacgacgt cctgcgcgac ctgcgcgccgagacggcggg catgccgatg ctccaggcga tgctggtgct gcccgaggag gcgcagttcc tcgccctcctggtccggctg accggggccg cgaaggtgct ggaggtgggc accttcaccg gctacagcag cctgtgcatggcgcgcgccc tgccgcccca cggcacggtg gtcacctgcg acaacagcga gcgctggacc cgcatcgcggcccgctactg gcagcgcgcc gaggtcgccg accggatcga cctgcggctc ggcgacgcgg ccgaaaccctcgacgccctc ctcgcgcaga gcggccccga cagcttcgac ctggccttca tcgacgccga caaggccaactactcccggt actacgagca gtccctggcg ctggtgcggc cgggcggact gctggtgctg gacaacacgctgttcttcgg ccgggtcgtc gacccggccg tgcaggaccc ggacaccctg gccatccgcg aactcaacagccggctgcgc gacgacgaac gcgtggacat ctccctgctc gccgtggcgg acggcctcac cctcatccacaagaagcccg agaggaagcc gagatgagcg agtcgaccac agagcgccgg ttcgtggcgg aagacgtcgagaccgagctg aagcagttcc tggagaagag caccaagacc agctgggcgt cggacaccga cctgttcgccgacggcggcg tctcctcgat gttcgcgatg gaactggtcg tgcacatcga gcggaccttc ggcctcgccatcgaaggacc ggacctcaggatcgacaact tccgcacggt gaacgacatg accgctctcg tgctccgcctcaccgggtcc gacgccggtg agtgacgacc tcccgggcct gatcagcgcg gaggtcggcg accgggccgcggcctgggac ctggccggca ccataccggt ggaggtgctc cgcaggctcg gcgcggcggg cgcgctgtgcgccgaggtcc ccgccgagta cggcggcccc ggcctgtcga gccgccgcaa cggcgaactc accgcccacaccggggcgct gtgcagttcg ctgcggagcg tgatgacctc ccagggcatg gcggcctgga ccatccagcggttcggcacc tgcccgcagc gcgccgaggc gctgacccgc ctcacccgcg gcgacctcgc cgccgtggcgttcagcgaac cgcaggccgg cagcgacctc tcggccatcg ccaccacggt caag

[0132] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for screening a co-cultivation system for increasing the production of an oxazolmycin compound, characterized in that, The method uses Streptomyces A as the base bacteria, and the method includes the following steps: a. Constructing a *Streptomyces* reporter strain A, wherein the *Streptomyces* reporter strain A contains the reporter gene AHL signal molecule synthase gene cviI, wherein the reporter gene AHL signal molecule synthase gene cviI is knocked into the structural gene oxaG carried by *Streptomyces* A itself, thereby disrupting the structural gene oxaG, but retaining the promoter region of the structural gene oxaG to drive the expression of the reporter gene AHL signal molecule synthase gene cviI; the *Streptomyces* A is *Streptomyces longshengensis* CGMCC 4.1101, and the nucleotide sequence of the structural gene oxaG is shown in SEQ ID NO. 5; b. Screening for co-cultured bacteria with Streptomyces A reporter strain that showed increased reporter gene expression after co-culturing with Streptomyces A reporter strain using AHL indicator bacteria, wherein the AHL indicator bacteria is CV026.

2. The method of claim 1, wherein the co-cultivation system for screening the production of oxazolmycin compounds is characterized by, The reporter gene contains a DNA sequence corresponding to a ribosome binding site, the nucleotide sequence of which is shown in SEQ ID NO.

3.

3. The method for screening co-culture systems to improve the yield of oxazolidinyl compounds according to claim 1, characterized in that, The method for constructing a reporter strain of Streptomyces A includes the following steps: The cviI gene containing its own ribosome binding site sequence was amplified, as were the kanamycin resistance gene kanR1 containing its own promoter, the upstream homologous arm of the oxaG coding region, and the downstream homologous arm of the oxaG coding region. The upstream homologous arm of the oxaG coding region, cviI, kanR1, and the downstream homologous arm of the oxaG coding region were sequentially ligated to the pKC1139 plasmid digested with EcoRV via Gibson assembly to obtain the recombinant plasmid pKDRoxaG. This plasmid was then introduced into Streptomyces A, and a reporter strain of Streptomyces A was obtained through screening.

4. The method for screening co-culture systems to improve the yield of oxazolidinyl compounds according to claim 3, characterized in that, The nucleotide sequence of the kanamycin resistance gene kanR1 is shown in SEQ ID NO.

4.

5. The method for screening co-culture systems to improve the yield of oxazolidinyl compounds according to claim 3, characterized in that, The upstream homologous arm nucleotide sequence of the oxaG coding region of the structural gene is shown in SEQ ID NO.

19.

6. The method for screening co-culture systems to improve the yield of oxazolidinyl compounds according to claim 3, characterized in that, The nucleotide sequence of the downstream homologous arm of the oxaG coding region is shown in SEQ ID NO.

22.

7. The method for screening co-culture systems to improve the yield of oxazolidinyl compounds according to claim 3, characterized in that, Microorganisms were co-cultured with Streptomyces A reporter strain, and the expression levels of reporter genes in each system were compared to screen for co-culture systems that could increase the yield of oxazolidinyl compounds.

8. The method for screening co-culture systems to improve the yield of oxazolidinyl compounds according to claim 7, characterized in that, The microorganisms used in co-culturing with Streptomyces A reporter strain are bacteria or fungi.

9. A co-culture system for increasing the yield of oxazolidinyl compounds, characterized in that, The culture system includes Streptomyces and Bacillus subtilis, wherein the Streptomyces is Longsheng Streptomyces CGMCC 4.1101 and the Bacillus subtilis is Bacillus subtilis CGMCC 1.1630.

Images