An isolated polypeptide and its use in the manufacture of a tumor immunotherapy product

Abstract

The present application relates to the field of biological medicine, in particular to an isolated polypeptide and its use in the preparation of tumor immunotherapy products, the isolated polypeptide in the present application utilizes the mechanism of CD300LD-ECD protein competitive inhibition of CD300LD, so as to realize the purpose of inhibiting tumor development, and the tumor-bearing mice are treated with the polypeptide, which can significantly inhibit the development of tumor; at the same time, CD300LD-ECD and PD1 antibody have significant anti-tumor synergistic effect.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to an isolated polypeptide and its use in the preparation of tumor immunotherapy products. Background Technology

[0002] Immunotherapy has significantly improved the efficacy of clinical cancer treatment, but most patients still do not benefit, and the proportion of patients who achieve long-term benefit is even lower. Finding new immune checkpoint molecules is a key issue in current cancer immunotherapy. Polymorphic myeloid-derived suppressor cells (PMN-MDSCs) are an important cell population among myeloid cells in the tumor immune system. PMN-MDSCs are a type of neutrophils that are pathologically induced and widely present in various tumors. They can suppress the function of effector cells such as T cells and NK cells, promote tumor development, invasion, and metastasis, and play a crucial role in the formation of the tumor immunosuppressive microenvironment. Summary of the Invention

[0003] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide an isolated polypeptide and its use in the preparation of tumor immunotherapy products, in order to solve the problems in the prior art.

[0004] To achieve the above and other related objectives, the present invention provides an isolated polypeptide comprising a functional fragment of the CD300LD protein, wherein the functional fragment of the CD300LD protein is the extracellular region of the CD300LD protein.

[0005] In one embodiment, the extracellular region of the CD300LD protein is derived from the mammalian CD300LD protein or a mutant thereof. The mammal is preferably a rodent, even-toed ungulate, perissodactyl, lagomorph, or primate. The rodent is preferably a mouse. The primate is preferably a monkey, ape, or human.

[0006] In one embodiment, the amino acid sequence of the extracellular region of CD300LD is shown in SEQ ID NO.4 or SEQ ID NO.18.

[0007] In another aspect, the present invention provides a nucleic acid construct encoding the isolated polypeptide.

[0008] In one embodiment, the nucleic acid construct contains a polynucleotide as shown in SEQ ID NO.3 or SEQ ID NO.17.

[0009] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid construct is as shown in SEQ ID NO.6 or SEQ ID NO.19.

[0010] In another aspect, the present invention provides a cell line containing the nucleic acid construct or genome in which an exogenous polynucleotide, such as SEQ ID NO. 3 or SEQ ID NO. 17, is integrated.

[0011] The present invention also provides a method for preparing the isolated polypeptide, the method comprising the following steps:

[0012] a) Under expression conditions, the cell line described above is cultured to express the isolated polypeptide;

[0013] b) Isolate and purify the polypeptide described in step a).

[0014] The isolated polypeptide is used in the preparation of products for the prevention, diagnosis or treatment of tumors.

[0015] In some embodiments of the invention, the use is the use of the isolated polypeptide and anti-PD1 antibody in the preparation of products for the prevention, diagnosis or treatment of tumors.

[0016] The tumor is a CD300LD overexpressing tumor; preferably, the tumor is selected from colorectal cancer, lung cancer, liver cancer, breast cancer, esophageal cancer, head and neck cancer, skin cancer, kidney cancer, leukemia, cervical cancer, colon cancer, hepatocellular carcinoma, ovarian serous cystadenocarcinoma, endometrial cancer, thyroid cancer, melanoma, lung adenocarcinoma, head and neck squamous cell carcinoma, multifocal glioma, prostate cancer, thymic carcinoma, low-grade glioma of the brain, rectal adenocarcinoma, pheochromocytoma and paraganglioma, esophageal cancer, clear cell carcinoma of the kidney, urothelial carcinoma of the bladder, papillary cell carcinoma of the kidney, pancreatic cancer, gastric cancer, chromophobe carcinoma of the kidney, invasive breast cancer, squamous cell carcinoma of the lung, sarcoma, or acute myeloid leukemia.

[0017] A pharmaceutical composition comprising the isolated polypeptide and one or more pharmaceutically acceptable carriers or excipients.

[0018] As described above, the present invention includes a polypeptide comprising CD300LD-ECD and its use in the preparation of tumor immunotherapy products, which has the following beneficial effects: competitive inhibition of CD300LD by CD300LD-ECD can significantly inhibit tumor development and exhibit a significant anti-tumor synergistic effect with PD1 antibody, providing a new targeted drug for tumor immunotherapy. Attached Figure Description

[0019] Figure 1 Purification of mouseCD300LD-ECD protein. A: Schematic diagram of mCD300LD-ECD-hFc protein and control hFc protein. B: SDS-PAGE of purified protein, where 1 is mCD300LD-ECD-hFc and 2 is control hFc protein.

[0020] Figure 2 MouseCD300LD-ECD significantly inhibited the development of the B16-F10 tumor model. A: B16-F10 tumor cells were subcutaneously inoculated into WT mice; starting from day 7 post-inoculation, protein was injected via the tail vein every two days for a total of four times. Tumor growth curves in mice of different treatment groups. B and C: Tumor tissues were harvested from mice in different treatment groups in A on day 15, and PMN-MDSC and CD8+ were analyzed in the tumors. + The proportion of T cells. *p<0.05,**p<0.01,***p<0.001.

[0021] Figure 3 Upregulation of hCD300LD expression in tumor patient samples. A: Immunohistochemical staining of CD300LD in melanoma samples (Bar = 200um). B: Expression level of CD300LD mRNA in peripheral blood immune cells of colorectal cancer patients. C: Analysis of CD300LD mRNA expression levels in tumor samples (red) and control normal tissues (blue) in different tumor types in the TCGA database. *p<0.05,**p<0.01,***p<0.001.

[0022] Figure 4 The expression level of hCD300LD is negatively correlated with the survival of melanoma patients. A: Correlation analysis of CD300LD and patient survival. B: Correlation analysis of the CD300LD signature gene and patient survival.

[0023] Figure 5 Construction of hCD300LD humanized mice. A: Schematic diagram of hCD300LD humanized mouse construction. B: PCR identification and analysis of wild-type and humanized mouse genotypes. CE: Tumor growth curves (C) of subcutaneous tumor formation in wild-type mice, CD300LD knockout mice, and CD300LD humanized mice after B16-F10 cells were seeded; tumors were isolated on day 16, and PMN-MDSC (D) and CD8+ were analyzed. + The proportion of T cells (E). *p<0.05,**p<0.01,***p<0.001.

[0024] Figure 6hCD300LD-ECD significantly inhibited tumor development. A: Schematic diagram of hCD300LD-ECD-hFc protein and control hFc protein. B: SDS-PAGE of purified protein, where 1 is hCD300LD-ECD-hFc and 2 is control hFc protein. C: B16-F10 tumor cells were subcutaneously inoculated into CD300LD humanized mice; starting from day 7 post-inoculation, the protein was administered via tail vein injection every two days for a total of four times. Tumor growth curves in mice of different treatment groups. *p<0.05,**p<0.01,***p<0.001.

[0025] Figure 7 hCD300LD-ECD significantly prolonged mouse survival. B16-F10 cells were subcutaneously inoculated into CD300LD humanized mice to induce tumor formation, followed by drug treatment at appropriate time points. hCD300LD-ECD-hFc or hFc was administered via tail vein injection at a dose of 200 μg protein / mouse on day 7 post-inoculation, once every 2 days for a total of 4 times. PD1 antibody was administered via tail vein injection at a dose of 200 μg protein / mouse on day 8 post-inoculation, once every 2 days for a total of 3 times. A: Tumor growth curve. B: Mouse survival curve. *p<0.05,**p<0.01,***p<0.001. Detailed Implementation

[0026] Unless otherwise defined below, all technical and scientific terms used in this invention shall have the meaning commonly understood by one of ordinary skill in the art to which this invention pertains.

[0027] The term "polypeptide" herein refers to a polymer of amino acids without a specific length. Therefore, peptides, oligopeptides, and proteins are all included in the definition of "polypeptide," and these terms are used interchangeably throughout the specification and claims. The term "polypeptide" does not exclude post-translational modifications, including but not limited to phosphorylation, acetylation, and glycosylation.

[0028] The term "isolated polypeptide" refers to a polypeptide that is not present in a living organism, such as a human or mouse. However, an isolated polypeptide may be part of a composition or kit. The isolated polypeptide is preferably purified.

[0029] The inventors of this application have focused their research on identifying key checkpoint molecules that regulate PMN-MDSCs. Because PMN-MDSCs and neutrophils are similar in molecular subtyping but have opposite functions, their transcriptomes were first sequenced to analyze differences in membrane protein expression. Simultaneously, an sgRNA library targeting PMN-MDSC membrane proteins was constructed and screened in vivo using CRISPR-Cas9 in a mouse tumor model. Both strategies point to a novel membrane protein, CD300LD. Both human and mouse CD300LD are specifically expressed on neutrophils / PMN-MDSCs, with significant upregulation in the latter after tumor infection. Knockout of CD300LD significantly inhibited tumor development in various models, including melanoma, colon cancer, breast cancer, and lung cancer. Conditional knockout of CD300LD or Ly6G antibody-mediated clearance of PMN-MDSCs in vivo, along with mixed tumorigenesis experiments using different myeloid cell subsets, demonstrate that PMN-MDSCs specifically regulate tumor immunity through CD300LD. Therefore, CD300LD is a novel PMN-MDSC-specific tumor immunosuppressive receptor and an effective immune checkpoint molecule.

[0030] Based on the above research, the present invention provides an isolated polypeptide, wherein the isolated polypeptide comprises a functional fragment of the CD300LD protein, and the functional fragment of the CD300LD protein is the extracellular region of the CD300LD protein.

[0031] The functional fragment refers to a fragment that has the ability to bind to the ligand of the CD300LD protein.

[0032] In one embodiment, the extracellular region of the CD300LD protein is derived from the mammalian CD300LD protein or a mutant thereof. The mammal is preferably a rodent, even-toed ungulate, perissodactyl, lagomorph, or primate. The rodent is preferably a mouse. The primate is preferably a monkey, ape, or human.

[0033] In one embodiment, the amino acid sequence of the extracellular region of CD300LD is shown in SEQ ID NO.4 or SEQ ID NO.18. In some embodiments, the extracellular region of CD300LD is selected from one or more segments of the amino acid sequence shown in SEQ ID NO.4 or SEQ ID NO.18.

[0034] In some embodiments of the present invention, the mutant of the mammalian CD300LD protein refers to a polypeptide that has one or more amino acids substituted, deleted, or added to the aforementioned amino acid sequence and has equivalent activity. This mutant may have at least 80%, 85%, 90%, 93%, 95%, 97%, or 99% similarity to the aforementioned amino acids.

[0035] The isolated polypeptide also includes other peptide segments translated from the expression vector expressing the polypeptide.

[0036] Specifically, the isolated polypeptide also includes a protein purification tag.

[0037] The protein purification tag is used to isolate and purify the expressed protein. Many protein purification tags exist and are commonly used in the art. Non-limiting examples of suitable protein purification tags include fluorescent protein, Fc tag, His tag, multiple (His) tag, FLAG (or DDK) tag, Halo tag, AcV5 tag, AU1 tag, AU5 tag, biotinylate carboxyl carrier protein (BCCP), calmodulin-binding protein (CBP), chitin-binding domain (CBD), E tag, E2 tag, ECS tag, eXact tag, Glu-Glu tag, glutathione S-transferase (GST), HA tag, HSV tag, KT3 tag, maltose-binding protein (MBP), MAP tag, Myc tag, NE tag, NusA tag, PDZ tag, S tag, S1 tag, SBP tag, Softag 1 tag, Softag 3 tag, Spot tag, Strep tag, SUMO tag, T7 tag, tandem affinity purification (TAP) tag, V5 tag, VSV-G tag, or Xa tag. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, EGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalama1, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), and red fluorescent proteins (mKate). mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred) and orange fluorescent protein (mOrange, mKO, Kusabira-Orange, monomer Kusabira-Orange, mTangerine, tdTomato) or any other suitable fluorescent protein.

[0038] The function of the extracellular region of the CD300LD protein is not affected by the protein purification tag.

[0039] The inventors' research results show that CD300LD is a novel polymorphonuclear myeloid-derived suppressor cell (PMN-MDSC) specific tumor immunosuppressive receptor. PMN-MDSCs are a type of neutrophils that are pathologically induced and widely present in various tumors. They can inhibit the function of effector cells such as T cells and NK cells, promote tumor development, invasion, and metastasis, and play a key role in tumor immunomodulation. The polypeptide isolated in this invention utilizes the mechanism of CD300LD-ECD protein competitively inhibiting CD300LD, thereby achieving the purpose of inhibiting tumor development. Treatment of tumor-bearing mice with established tumors with the isolated polypeptide can significantly inhibit tumor development; at the same time, CD300LD-ECD and PD1 antibody have a significant anti-tumor synergistic effect.

[0040] In another aspect, the present invention provides an isolated polynucleotide encoding the isolated polypeptide.

[0041] In one embodiment, the sequence of the isolated polynucleotide is as shown in SEQ ID NO.3 or SEQ ID NO.17.

[0042] In some embodiments of the present invention, the isolated polynucleotide may also be a polynucleotide with equivalent activity that has undergone substitution, deletion, or addition of one or more nucleotides in the aforementioned nucleotide sequence. The polynucleotide sequence after substitution, deletion, or addition may have 80%, 85%, 90%, 93%, 95%, 97%, or 99% or more similarity to the aforementioned polynucleotide.

[0043] In some embodiments of the present invention, the amino acid sequence of the isolated polypeptide is shown in SEQ ID NO.20 or SEQ ID NO.21.

[0044] Another aspect of the present invention provides a nucleic acid construct containing the isolated polynucleotide.

[0045] In some embodiments of the present invention, the nucleic acid construct is constructed by inserting the isolated polynucleotide into the multiple cloning site of the expression vector. The expression vector in the present invention generally refers to various commercially available expression vectors well known in the art, such as bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors.

[0046] In some embodiments of the present invention, the expression vector is selected from the pCMV-hFc expression vector.

[0047] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid construct is as shown in SEQ ID NO.6 or SEQ ID NO.19.

[0048] In another aspect, the present invention provides a cell line containing the nucleic acid construct or the genome in which the exogenous polynucleotide is integrated.

[0049] In some embodiments of the present invention, the cell line is obtained by transfecting the nucleic acid construct into a host cell. Any cell suitable for expression via an expression vector can serve as the host cell; for example, the host cell can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. In one embodiment, the host cell is a 293e cell.

[0050] The present invention also provides a method for preparing the isolated polypeptide, the method comprising the following steps:

[0051] a) Under expression conditions, the cell line described above is cultured to express the isolated polypeptide;

[0052] b) Isolate and purify the polypeptide described in step a).

[0053] The isolated polypeptide is used in the preparation of products for the prevention, diagnosis or treatment of tumors.

[0054] In this invention, the term "prevention" includes preventative measures that can lead to desired pharmaceutical and / or physiological effects. These effects are preferably defined as medically preventing or delaying the onset of disease and / or reducing the risk of disease progression or worsening.

[0055] In this invention, the term "diagnosis" can refer to determining the presence of a certain disease based on the expression level of Cd300ld.

[0056] In this invention, the term "treatment" includes curative or palliative measures that can lead to desired pharmaceutical and / or physiological effects. Preferred effects are those that medically reduce one or more symptoms of a disease or completely eliminate the disease.

[0057] The tumor is a CD300LD overexpressing tumor. The tumor can be a solid tumor or a hematologic malignancy, more specifically, it can be colorectal cancer, lung cancer, liver cancer, breast cancer, esophageal cancer, head and neck cancer, skin cancer, kidney cancer, leukemia, cervical cancer, coad (colon cancer), lihc (hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial cancer), thca (thyroid cancer), skcm (skin melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), glm (multifocal glioma), prad (prostate cancer), th YM (thymic carcinoma), LGG (low-grade glioma), READ (rectal adenocarcinoma), PCPG (pheochromocytoma and paraganglioma), ESCA (esophageal cancer), KIRC (clear cell renal carcinoma), BLCA (urothelial carcinoma of the bladder), KIRP (papillary cell renal carcinoma), PAAD (pancreatic cancer), STAD (gastric cancer), KHI (chromophobe renal carcinoma), BRCA (invasive breast cancer), LUSC (squamous cell lung cancer), SARC (sarcoma), LAML (acute myeloid leukemia), etc.

[0058] The product must include isolated polypeptides, and the isolated polypeptides are the sole active ingredient or one of the active ingredients.

[0059] In some embodiments of the invention, the use is the use of the isolated polypeptide and anti-PD1 antibody in the preparation of products for the prevention, diagnosis or treatment of tumors.

[0060] The anti-PD1 antibody can be any antibody targeting PD1, such as Opdivo, Keytruda, or BioXcell's InVivoMab anti-mouse PD-1 (CD279), Cat#BE0273.

[0061] The product can be a single-component substance or a multi-component substance.

[0062] There are no special restrictions on the form of the product; it can be in various forms such as solid, liquid, gel, semi-liquid, or aerosol.

[0063] The product is primarily targeted at mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans. Preferred rodents are mice.

[0064] The products include, but are not limited to, pharmaceuticals, health supplements, food, and reagent kits.

[0065] The product can competitively bind to the ligand of CD300LD. However, since the product only includes the extracellular region of CD300LD and does not include the transmembrane region and the intracellular region, the extracellular region cannot transmit the signal to the intracellular space after binding with the ligand. This mimics CD300LD knockout, thereby inhibiting or completely eliminating the function of CD300LD and ultimately achieving tumor immunotherapy.

[0066] The present invention also provides a pharmaceutical composition comprising the isolated polypeptide and one or more pharmaceutically acceptable carriers or excipients.

[0067] "Pharmaceutical acceptable" means that when the molecular basis and the composition are properly administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions.

[0068] A "pharmaceutically acceptable carrier or excipient" should be compatible with the active ingredient, meaning it can be miscible with it without significantly reducing the drug's efficacy under normal circumstances. Specific examples of substances that can serve as pharmaceutically acceptable carriers or excipients include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances are used as needed to help stabilize the formulation or to improve its activity or bioavailability or to produce an acceptable taste or smell when taken orally.

[0069] In this invention, unless otherwise specified, the drug dosage form is not particularly limited and can be formulated as injections, oral liquids, tablets, lyophilized powders, capsules, pellets, sprays, etc., and can be prepared by conventional methods. The choice of drug dosage form should be matched with the route of administration.

[0070] The present invention also provides a treatment method comprising: administering to an individual a therapeutically effective amount of isolated polypeptide, or the pharmaceutical composition provided above in the present invention.

[0071] The treatment method provided by this invention can be used to treat indications including, but not limited to, tumors.

[0072] In this invention, "individual" typically includes humans and non-human primates such as mammals, dogs, cats, horses, sheep, pigs, cattle, etc., who can benefit from treatment using the aforementioned drugs, pharmaceutical compositions, formulations, kits, or combination formulations.

[0073] In this invention, "therapeutic effective dose" generally refers to a dosage that, after an appropriate period of administration, can achieve the therapeutic effect on the diseases listed above. Specifically, when the isolated polypeptide or pharmaceutical composition is administered to a subject, the dosage varies depending on the patient's age and weight, disease characteristics and severity, and route of administration, and may be referenced to the results of animal experiments and various other factors; the total dosage should not exceed a certain range.

[0074] In some embodiments, the dosage of the isolated polypeptide or pharmaceutical composition described herein is from about 0.001 mg / kg to about 500 mg / kg (e.g., from about 0.001 mg / kg to about 200 mg / kg; from about 0.01 mg / kg to about 200 mg / kg; from about 0.01 mg / kg to about 150 mg / kg; from about 0.01 mg / kg to about 100 mg / kg; from about 0.01 mg / kg to about 50 mg / kg; from about 0.01 mg / kg to about 10 mg / kg; from about 0.01 mg / kg to about 5 mg / kg; from about 0.01 mg / kg to about 5 mg / kg; from about 0.01 mg / kg to about 5 mg / kg). The dosage can be divided into several doses: approximately 1 mg / kg; approximately 0.01 mg / kg to approximately 0.5 mg / kg; approximately 0.01 mg / kg to approximately 0.1 mg / kg; approximately 0.1 mg / kg to approximately 200 mg / kg; approximately 0.1 mg / kg to approximately 150 mg / kg; approximately 0.1 mg / kg to approximately 100 mg / kg; approximately 0.1 mg / kg to approximately 50 mg / kg; approximately 0.1 mg / kg to approximately 10 mg / kg; approximately 0.1 mg / kg to approximately 5 mg / kg; approximately 0.1 mg / kg to approximately 1 mg / kg; approximately 0.1 mg / kg to approximately 0.5 mg / kg. The total daily dose can be divided and administered in multiple fractions throughout the day or by providing continuous delivery. It can be administered daily (e.g., as a single dose or as two or more fractions) or non-daily (e.g., every other day, every two days, every three days, once a week, twice a week, once every two weeks, once a month). In some embodiments, the administration time of the isolated peptides or pharmaceutical compositions described herein is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer. In another embodiment, the dosing cessation period is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. In one embodiment, an individual is given a therapeutically isolated peptide or pharmaceutical composition for a period of time, followed by separate time periods. In another embodiment, the therapeutically isolated peptide or pharmaceutical composition is given for a first time period, dosing is stopped for a second time period following the first time period, then dosing is restarted for a third time period, and then dosing is stopped for a fourth time period following the third time period.In one embodiment, the dosing period is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. In another embodiment, the discontinuation period is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer.

[0075] In some embodiments, the methods described herein may further include administration in combination with the isolated peptides described herein to one or more additional therapies (e.g., one or more additional therapeutic agents and / or one or more treatment regimens).

[0076] In some embodiments, the methods described herein may further include administering one or more additional cancer therapies. One or more additional cancer therapies may include, but are not limited to: surgery, radiation therapy, chemotherapy, toxin therapy, immunotherapy, cryotherapy, cancer vaccines (e.g., HPV vaccine, hepatitis B vaccine, Oncophage, Provenge), and gene therapy, as well as combinations thereof. Immunotherapy includes, but is not limited to, adoptive cell therapy, stem cell and / or dendritic cell derivatization, blood transfusion, irrigation, and / or other therapies, including but not limited to cryotherapy of tumors.

[0077] In some embodiments, the one or more additional cancer therapies are chemotherapy, which may include administering one or more additional chemotherapy agents.

[0078] In some embodiments, the other chemotherapeutic agents are immunomodulatory molecules, such as immune checkpoint inhibitors. In some of these embodiments, the immune checkpoint inhibitors target immune checkpoint receptors selected from the following: CTLA-4, PD-1, PD-L1, PD-1–PD-L1, PD-1–PD-L2.

[0079] In some of these implementation schemes, the immune checkpoint inhibitor is selected from: pembrolizumab (PD-1), nivolumab (PD-1), atezolizumab (formerly known as MPDL3280A) (PD-L1), MEDI4736 (PD-L1), avelumab (PD-L1), PDR001 (PD-1), BMS-986016, MGA271, Lirilumab, IPH2201, Emactuzumab, INCB024360, Galunisertib, Ulocuplumab, BKT140, Bavituximab, CC-90002, Bevacizumab, MNRP1685A, and MGA271.

[0080] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0081] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0082] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0083] Example 1: Construction and purification of mouse CD300LD-ECD

[0084] Previous results from the applicant showed that CD300LD is a key receptor for PMN-MDSC to inhibit tumor immunity, and that knocking out CD300LD significantly inhibited the development of various tumor models. Therefore, this invention constructs the extracellular region of CD300LD to competitively inhibit CD300LD using this protein, verifying the role of CD300LD-ECD protein in tumor development. This example describes the construction and purification of mouse CD300LD-ECD protein.

[0085] Materials and Methods:

[0086] 1-1) Construction of CD300LD-ECD-hFc fusion expression vector: First, PCR amplification was performed using the following PCR amplification primers.

[0087] Extracellular region fragment of mouse CD300LD:

[0088] For:5'tgcggccgcgaattcatgtggcagttctctgctct 3'(SEQ ID NO.1),

[0089] Rev:5'cctgctgagcagcatctacgtcgacatcgagggc 3'(SEQ ID NO.2)

[0090] PCR conditions: 95℃ for 5 min, (95℃ for 30 s, 58℃ for 30 s, 72℃ for 60 s, 30 cycles), 72℃ for 10 min, 4℃

[0091] 10min

[0092] The nucleotide sequence of the extracellular region fragment of mouse CD300LD is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4. The cloning was performed using a one-step cloning reagent (…). Using the One-Step PCR Cloning Kit (NR005-01A), insert the fragment into the pCMV-hFc vector (nucleotide sequence as shown in SEQ ID NO.5) according to the reagent instructions.

[0093] 1-2) Protein expression and purification: pCMV-mCD300LD-ECD-hFc plasmid (nucleotide sequence as shown in SEQ ID NO. 6) or pCMV-hFc plasmid was transfected into 293e cells using PEI transfection. After 96 hours, the cell supernatant was collected and filtered through a 0.45 μm filter. The protein was purified by protein A affinity chromatography. The buffer was replaced with PBS using a PD-10 desalting column (GE). Finally, the protein was concentrated to 1 mg / ml using a protein concentrator column (AMICON).

[0094] result:

[0095] The amino acid sequence of the extracellular region fragment of the prepared mouse CD300LD was verified to be consistent with the design. hFc was used as a control in the experiment. Figure 1 A is a schematic diagram of the structure of CD300LD-ECD-hFc and hFc. Figure 1 B shows the SDS-PAGE results of purified CD300LD-ECD-hFc protein and hFc protein.

[0096] Example 2: Mouse CD300LD-ECD significantly inhibited the development of the established B16-F10 tumor model.

[0097] To evaluate the tumor-inhibiting function of CD300LD-ECD in mice, this embodiment uses the B16-F10 tumor mouse model, and CD300LD-ECD is applied during the tumor-established stage to detect its effect on tumor development.

[0098] Materials and Methods:

[0099] 2-1) B16-F10 cell culture: B16-F10 cells were placed in DMEM medium (10% FBS, 1% Penicillin-Streptomycin) and cultured at 37°C with 5% CO2. The cells were passaged every 2 days at a ratio of 1:3.

[0100] 2-2) B16-F10 melanoma mouse model: B16-F10 cells (at a ratio of 1.5 × 10⁻⁶) were used to create a mouse model of melanoma. 5 Cells / mouse cells were subcutaneously injected into mice, and tumor size was measured every 2-3 days to plot a tumor growth curve; the tumor volume was 1000 cm³. 3 The mice were declared dead, and their survival curves were plotted.

[0101] 2-3) Treatment of tumor mice with CD300LD-ECD protein: On day 7 after B16-F10 cell inoculation, the purified protein from Example 1 was injected via the tail vein at a dose of 200 μg protein / mouse; once every 2 days for a total of 4 times.

[0102] 2-4) Tumor immune microenvironment analysis: Single-cell suspensions were prepared from isolated mouse tumors, labeled with fluorescent antibodies, and analyzed by flow cytometry. Neutrophils / PMN-MDSCs were identified as CD45+. + / CD11b + / Ly6G + CD8 + T is CD45 + / CD3 + / CD8 + .result:

[0103] On day 7 after tumor cell inoculation, tumors had formed subcutaneously in mice, measuring approximately 100 mm in size. 3 Mice were randomly divided into two groups: one group was treated with CD300LD-ECD-hFc protein, and the other group was treated with hFc protein. The results showed that tumor development was significantly inhibited in the CD300LD-ECD treatment group compared to the control hFc group. Figure 2 A) The applicant's previous research demonstrated that CD300LD knockout significantly improved the tumor microenvironment, primarily through a significant reduction in PMN-MDSCs and CD8+. + T infiltration was significantly increased. Therefore, this example analyzed the tumor microenvironment of the mice. The results showed that, compared with the control group, CD300LD-ECD treatment significantly reduced PMN-MDSC and CD8+ in the tumor. + T increased significantly compared to ( Figure 2 (B and C). The above results indicate that CD300LD-ECD can mimic CD300LD knockout, significantly improve the tumor immune microenvironment, and thus inhibit tumor development.

[0104] Example 3: Upregulation of human CD300LD expression in various tumors

[0105] The applicant's previous research found that CD300LD expression was significantly upregulated in tumor-bearing mice. Therefore, this embodiment analyzes whether the expression of the human CD300LD gene changes in tumor patients.

[0106] Materials and Methods:

[0107] 3-1) Immunohistochemistry of melanoma patient samples: Melanoma patient samples were paraffin-embedded, sectioned, and labeled with anti-human CD300LD antibody (5 μg / ml final concentration) overnight at 4°C, and washed with PBS for 3 minutes × 3 times; biotin-labeled goat anti-human IgG secondary antibody (1 μg / ml final concentration) was incubated at room temperature for 10 minutes, and washed with PBS for 3 minutes × 3 times; HRP-Streptavidin (1 μg / ml final concentration) was added and incubated at room temperature for 10 minutes, and washed with PBS for 3 minutes × 3 times; after DAB staining, the samples were observed under a microscope.

[0108] 3-2) Establishment of CD300LD gene expression in immune cells from patient blood: Peripheral blood was collected from cancer patients, and immune cells were isolated from the blood using Percoll according to methods well-known in the art. Total RNA was extracted from the cells using Trizol reagent according to standard methods in the art; mRNA was reverse transcribed into cDNA using reverse transcriptase and oligo d(T)16 (Invitrogen, Cat#N8080128). Quantitative analysis of CD300LD and GAPDH expression in the samples was performed using qPCR. Specific primers and conditions are as follows:

[0109] huLD-For:5'TCCCAGGTTACTCATTGCC 3'(SEQ ID NO.7)

[0110] huLD-Rev:5'GCCTGAGCCATAAGCACACT 3'(SEQ ID NO.8)

[0111] huGAPDH-For:5'TGTGGGCATCAATGGATTTGG 3'(SEQ ID NO.9)

[0112] huGDPDH-Rev:5'ACACCATGTATTCCGGGTCAAT 3'(SEQ ID NO.10)

[0113] qPCR conditions: 95℃ for 5 min, (95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 40 cycles), 72℃ for 10 min, 4℃ for 10 min

[0114] 3-3) Expression analysis of CD300LD in different tumors: Using the TCGA database, the mRNA expression levels of CD300LD in different types of tumors and corresponding normal tissues were analyzed.

[0115] result:

[0116] Immunohistochemistry analysis of melanoma patient samples revealed significant CD300LD expression in tumor tissues, while CD300LD was scarce in adjacent normal tissues. Figure 3 A). Quantitative real-time PCR was used to detect peripheral blood immune cells in healthy individuals and patients with colorectal cancer. The results showed that the expression of CD300LD was significantly increased in immune cells of patients with colorectal cancer. Figure 3 B). To further analyze the expression of CD300LD in other tumor types, the TCGA database was used for analysis. It was found that in 23 tumor types, the expression level of CD300LD was higher than that in the corresponding normal tissues. Figure 3C). The above results indicate that CD300LD expression is significantly upregulated in various tumors.

[0117] Example 4: The CD300LD signaling pathway is negatively correlated with the survival rate of melanoma patients.

[0118] This embodiment further analyzes the correlation between the CD300LD signaling pathway and the survival rate of melanoma patients.

[0119] Materials and Methods:

[0120] Clinical information and gene expression levels of melanoma patients were obtained from the TCGA database. Cases were divided into high and low groups based on the median CD300LD expression level for survival correlation analysis (Graphpad software). Simultaneously, using significantly positively correlated downstream genes of CD300LD (S100A8, NGP, LTF, S100A9, CAMP), the expression values ​​of each gene were standardized to form a CD300LD signature value; cases were then divided into high and low groups based on the median of this value for survival correlation analysis. The significance of the correlation was calculated using the Gehan-Breslow-Wilcoxon test.

[0121] result:

[0122] The results showed that in melanoma patients, the survival rate of the CD300LD high-expression group was lower than that of the low-expression group. Figure 4 A). Simultaneously, a comprehensive analysis was performed using CD300LD signature, a significant gene composition positively regulated by CD300LD. The results showed that survival was significantly reduced in the case group with high expression of CD300LD signature. Figure 4 B). The above results indicate that the CD300LD signaling pathway is negatively correlated with the survival rate of melanoma patients.

[0123] Example 5: Construction of CD300LD humanized mice

[0124] To verify whether targeting human CD300LD can similarly inhibit tumor development, this embodiment constructs CD300LD humanized mice to establish a tumor model.

[0125] Materials and Methods:

[0126] 5-1) Construction and identification of CD300LD humanized mice: Using CRISPR-Cas9 technology, the first exon of CD300ld in C57BL6 mice was replaced with human CD300LD. The construction of CD300LD humanized mice was entrusted to a third-party company, Jicui Pharmaceutical Co., Ltd.

[0127] The primers used to identify whether the CD300LD humanized mouse was successfully constructed are as follows:

[0128] WT-For, 5'TTAGAGGAAGTTCCCTGTTCACCC 3'; (SEQ ID NO. 11)

[0129] WT-Rev, 5'CTTACCTGGGAGGAAGAATAGGAG3'; (SEQ ID NO. 12)

[0130] Mutant-For, 5'TGCAGATTCCCACAATATGGGAG 3'; (SEQ ID NO. 13)

[0131] Mutant-Rev, 5'AACAGGAAGTGGGTGCTCTTGAG 3'; (SEQ ID NO. 14)

[0132] PCR reaction conditions: 95℃ for 5 min, 30 cycles (95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s), 72℃ for 10 min, 4℃ for 10 min;

[0133] The WT strip is 267bp and the Mutant strip is 1393bp.

[0134] 5-2) B16-F10 melanoma mouse model: B16-F10 cells (at a ratio of 1.5 × 10⁻⁶) were used to create a mouse model of melanoma. 5 Cells / mouse cells were subcutaneously injected into mice, and tumor size was measured every 2-3 days to plot a tumor growth curve; the tumor volume was 1000 cm³. 3 The mice were declared dead, and their survival curves were plotted.

[0135] result:

[0136] Figure 5 Figures A and B show that human CD300LD was successfully created by replacing mouse CD300LD with human CD300LD using CRISPR-Cas9 technology. A B16-F10 mouse model was constructed using wild-type mice, CD300LD knockout mice, and humanized CD300LD mice to analyze tumor development in different mouse types. The results showed that tumor development was significantly inhibited in CD300LD knockout mice compared to wild-type mice, while tumor development in humanized CD300LD mice was not different from that in wild-type mice; indicating that human CD300LD can functionally replace mouse CD300LD. Figure 5 C). This indicates that the humanized mouse can be used to evaluate the efficacy of drugs targeting human CD300LD.

[0137] Example 6: Human CD300LD-ECD significantly inhibits tumor development

[0138] In this embodiment, the extracellular domain protein of CD300LD (hCD300LD-ECD) was constructed and purified, and competitively inhibited in a humanized mouse tumor model of CD300LD to analyze its impact on tumor development.

[0139] Materials and Methods:

[0140] 6-1) Vector construction, expression, and purification of the CD300LD-ECD-hFc fusion protein: The extracellular region of human CD300LD was amplified by PCR using the primers and conditions shown below:

[0141] For:5'tgcggccgcgaattcgccaccatgtggctgtccccatc 3'(SEQ ID NO.15)

[0142] Rev: 5'gtccccgctcaagagcacccacgtcgacatcgagggc 3'(SEQ ID NO.16)

[0143] PCR conditions: 95℃ for 5 min, (95℃ for 30 s, 58℃ for 30 s, 72℃ for 60 s, 30 cycles), 72℃ for 10 min, 4℃ for 10 min

[0144] The nucleotide sequence of the extracellular region fragment of human CD300LD is shown in SEQ ID NO.17, and the amino acid sequence is shown in SEQ ID NO.18. Using a one-step cloning reagent (…),… Using the One-Step PCR Cloning Kit (NR005-01A), insert the fragment into the pCMV-hFc vector according to the reagent instructions. Transfect the pCMV-hCD300LD-ECD-hFc plasmid (nucleotide sequence as shown in SEQ ID NO.19) or pCMV-hFc plasmid into 293e cells using PEI transfection. After 96 hours, collect the cell supernatant and filter it through a 0.45μm filter. Purify the protein using protein A affinity chromatography, replace the buffer with PBS using a PD-10 desalting column (GE), and finally concentrate the protein to 1 mg / ml using a protein concentrator column (AMICON).

[0145] 6-2) Treatment of tumor-bearing mice with CD300LD-ECD protein: B16-F10 cells (at a concentration of 1.5 × 10⁻⁶) were treated. 5 Cells / mouse were inoculated subcutaneously into mice. On day 7 post-inoculation, the protein was injected via the tail vein at a dose of 200 μg protein / mouse. This was repeated every 2 days for a total of 4 times.

[0146] result:

[0147] Construct and purify hCD300LD-ECD-hFc fusion protein ( Figure 6 AB). A B16-F10 tumor model was established using CD300LD humanized mice; on day 7 after tumor inoculation, 200 μg of protein / mouse was injected via the tail vein, with hFc protein as a control. Results showed that hCD300LD-ECD-hFc significantly inhibited the development of established tumors. Figure 6 C).

[0148] Example 7: Human CD300LD-ECD and PD1 antibody exhibit significant anti-tumor synergistic effect.

[0149] Since CD300LD is mainly expressed on myeloid PMN-MDSC cells, while PD1 is mainly expressed on T cells, theoretically, simultaneously targeting these two targets would have a synergistic anti-tumor effect.

[0150] Materials and Methods:

[0151] 7-1) Drug treatment: B16-F10 cells (at a concentration of 1.5 × 10⁻⁶) 5 Cells / mouse were subcutaneously inoculated into CD300LD humanized mice. hCD300LD-ECD treatment: On day 7 post-inoculation, 200 μg protein / mouse was injected via tail vein; once every 2 days for a total of 4 times. PD1 antibody treatment (BioXcell InVivoMab anti-mouse PD-1 (CD279), Cat#BE0273) was administered: On day 8 post-inoculation, 200 μg protein / mouse was injected via tail vein; once every 2 days for a total of 3 times. Tumor size was measured every 2-3 days after tumor inoculation, and a tumor growth curve was plotted; tumor volume was considered optimal at 1000 cm³. 3 The mice were declared dead, and their survival curves were plotted.

[0152] result:

[0153] The results showed that, when treated alone, hCD300LD-ECD, like PD1 antibody, significantly inhibited tumor development; when the two were combined, the tumor growth curve was further suppressed. Figure 7 A). The mouse survival curves show the same trend ( Figure 7 B). The above results indicate that hCD300LD-ECD and PD1 antibody have a significant synergistic anti-tumor effect.

[0154] In summary, given that CD300LD plays an important role in the tumor immune microenvironment through PMN-MDSC, this invention utilizes CD300LD-ECD to competitively inhibit CD300LD, which can significantly inhibit tumor development and exhibit a significant anti-tumor synergistic effect with PD1 antibody, providing a new targeted drug for tumor immunotherapy.

[0155] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention. sequence list <110> Fudan University Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences <120> An isolated polypeptide and its use in the preparation of tumor immunotherapy products. <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <400> 1 tgcggccgcg aattcatgtg gcagttctct gctct 35 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <400> 2 cctgctgagc agcatctacg tcgacatcga gggc 34 <210> 3 <211> 531 <212> DNA <213> Artificial Sequence <400> 3 atgtggcagt tctctgctct actcctattc ttcctcccag gctgctgcac ggctcaggat 60 tcagtcacag gtccagagga ggtgagcggt caggagcagg gctccttgac agtgcagtgc 120 agatattcct catactggaa gggttacaag aagtactggt gccgaggagt tcctcagaga 180 tcatgtgata ttcttgttga aaccgataaa tcagagcagc tggtgaagaa gaaccgtgtg 240 tccatcaggg acaaccagag agacttcatc ttcacagtga ccatggagga tctgaggatg 300 agcgatgctg gcatttactg gtgtggaatt acgaaaggtg gacctgatcc catgtttaaa 360 gttaatgtga acattgacca agccccaaaa agttcaatga tgaccaccac agccacagtt 420 ctgaaatcca tacaaccaag cgctgagaac actggcaagg aacaagtgac tcagagcaaa 480 gaagtgactc agagcaggcc ccacaccagg tccctgctga gcagcatcta c 531 <210> 4 <211> 177 <212> PRT Artificial Sequence <400> 4 Met Trp Gln Phe Ser Ala Leu Leu Leu Phe Phe Leu Pro Gly Cys Cys 1 5 10 15 Thr Ala Gln Asp Ser Val Thr Gly Pro Glu Glu Val Ser Gly Gln Glu 20 25 30 Gln Gly Ser Leu Thr Val Gln Cys Arg Tyr Ser Ser Tyr Trp Lys Gly 35 40 45 Tyr Lys Lys Tyr Trp Cys Arg Gly Val Pro Gln Arg Ser Cys Asp Ile 50 55 60 Leu Val Glu Thr Asp Lys Ser Glu Gln Leu Val Lys Lys Asn Arg Val 65 70 75 80 Ser Ile Arg Asp Asn Gln Arg Asp Phe Ile Phe Thr Val Thr Met Glu 85 90 95 Asp Leu Arg Met Ser Asp Ala Gly Ile Tyr Trp Cys Gly Ile Thr Lys 100 105 110 Gly Gly Pro Asp Pro Met Phe Lys Val Asn Val Asn Ile Asp Gln Ala 115 120 125 Pro Lys Ser Ser Met Met Thr Thr Thr Ala Thr Val Leu Lys Ser Ile 130 135 140 Gln Pro Ser Ala Glu Asn Thr Gly Lys Glu Gln Val Thr Gln Ser Lys 145 150 155 160 Glu Val Thr Gln Ser Arg Pro His Thr Arg Ser Leu Leu Ser Ser Ile 165 170 175 Tyr <210> 5 <211> 5387 <212> DNA <213> Artificial Sequence <400> 5 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct 60 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg 120 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa 180 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta 240 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc 300 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg 360 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 420 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 480 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 540 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 600 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 660 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 720 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 780 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc 840 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc 900 tcgtttagtg aaccgtcaga attaagcttg cggccgcgaa ttcatcgata gatctgatat 960 cggtaccagt cgacatcgag ggccgcatgg accccaaatc ttgtaaaact cacacatgcc 1020 caccgtgccc agcacctgaa ctcctggggg gaccgtcagt cttcctcttc cccccaaaac 1080 ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga 1140 gccacgaaga ccctgaggtc aagttcaact ggtacgtgga cggcgtggag gtgcataatg 1200 ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc agcgtcctca 1260 ccgtcctgca ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag 1320 ccctcccagc ccccatcgag aaaaccatct ccaaagccaa agggcagccc cgagaaccac 1380 aggtgtacac cctgccccca tcccgggagg agatgaccaa gaaccaggtc agcctgacct 1440 gcctggtcaa aggcttctat cccagcgaca tcgccgtgga gtgggagagc aatgggcagc 1500 cggagaacaa ctacaagacc acgcctcccg tgctggactc cgacggctcc ttcttcctct 1560 acagcaagct caccgtggac aagagcaggt ggcagcaggg gaacgtcttc tcatgctccg 1620 tgatgcacga ggctctgcac aaccactaca cgcagaagag cctctccctg tctccgggta 1680 aatgaggatc ccgggctgat tacaaggacg acgatgacaa gtaggttggg tggcatccct 1740 gtgacccctc cccagtgcct ctcctggccc tggaagttgc cactccagtg cccaccagcc 1800 ttgtcctaat aaaattaagt tgcatcattt tgtctgacta ggtgtccttc tataatatta 1860 tggggtggag gggggtggta tggagcaagg ggcaagttgg gaagacaacc tgtagggcct 1920 gcggggtcta ttgggaacca agctggagtg cagtggcaca atcttggctc actgcaatct 1980 ccgcctcctg ggttcaagcg attctcctgc ctcagcctcc cgagttgttg ggattccagg 2040 catgcatgac caggctcagc taatttttgt ttttttggta gagacggggt ttcaccatat 2100 tggccaggct ggtctccaac tcctaatctc aggtgatcta cccaccttgg cctcccaaat 2160 tgctgggatt acaggcgtga accactgctc ccttccctgt ccttctgatt ttaaaataac 2220 tataccagca ggaggacgtc cagacacagc ataggctacc tggccatgcc caaccggtgg 2280 gacatttgag ttgcttgctt ggcactgtcc tctcatgcgt tgggtccact cagtagatgc 2340 ctgttgaatt gggtacgcgg ccagcttggc tgtggaatgt gtgtcagtta gggtgtggaa 2400 agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa 2460 ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca 2520 attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgcccta actccgccca 2580 gttccgccca ttctccgccc catggctgac taattttttt tattatgca gaggccgagg 2640 ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga ggcctaggct 2700 tttgcaaaaa gctcctcgag gaactgaaaa accagaaagt taattcccta tagtgagtcg 2760 tattaaattc gtaatcatgt catagctgtt tcctgtgtga aattgttatc cgctcacaat 2820 tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag 2880 ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg 2940 ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc 3000 ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc 3060 agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa 3120 catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 3180 tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 3240 gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 3300 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 3360 cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 3420 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 3480 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 3540 taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 3600 taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac 3660 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 3720 ttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 3780 gatctttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 3840 catgagatta tcaaaaagga tcttcaccta gatcctttta attaaaaat gaagttttaa 3900 atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga 3960 ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt 4020 gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg 4080 agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga 4140 gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga 4200 agctagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg 4260. catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc 4320 aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc 4380. gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca 4440. taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg 4680 4740. tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggca aatgccgca aaaagggat aagggcgac cggaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttga tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 4980 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 5040 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 5100 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 5160 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 5220 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 5280 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 5340 acaaaaattt aacgcgaatt ttaacaaaat attaacgctt acaattt 5387 <210> 6 <211> 5893 <212> DNA <213> Artificial Sequence <400> 6 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct 60 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg 120 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa 180 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta 240 ttggccattg catacgttgt atctatatca tatatgtac atttatattg gctcatgtcc 300 aatatgaccg ccatgttgac attgattatt gactagttat tatagtaat caattacggg 360 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 420 gcctggctga ccgcccaacg acccccgcc attgacgtca ataatgacgt atgttcccat 480 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 540 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 600 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 660 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 720 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 780 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc 840 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc 900 tcgtttagtg aaccgtcaga attaagcttg cggccgcgaa ttcatgtggc agttctctgc 960 tctactccta ttcttctcc caggctgctg cacggctcag gattcagtca caggtccaga 1020 ggaggtgagc ggtcaggagc agggctcctt gacagtgcag tgcagatatt cctcatactg 1080 gaagggttac aagaagtact ggtgccgagg agttcctcag agatcatgtg atattcttgt 1140 tgaaaccgat aaatcagagc agctggtgaa gaagaaccgt gtgtccatca gggacaacca 1200 gagagacttc atcttcacag tgaccatgga ggatctgagg atgagcgatg ctggcattta 1260 ctggtgtgga attacgaaag gtggacctga tcccatgttt aaagttaatg tgaacattga 1320 ccaagcccca aaaagttcaa tgatgaccac cacagccaca gttctgaaat ccatacaacc 1380 1440 gccccacacc aggtccctgc tgagcagcat ctacgtcgac atcgagggcc gcatggaccc 1500 caaatcttgt aaaactcaca catgcccacc gtgcccagca cctgaactcc tgggggacc 1560 gtcagtcttc ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga 1620 ggtcacatgc gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt tcaactggta 1680 cgtggacggc gtggaggtgc ataatgccaa gacaaagccg cgggaggagc agtacaacag 1740 cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag gactggctga atggcaagga 1800 gtacaagtgc aaggtctcca acaaagccct cccagccccc atcgagaaaa ccatctccaa 1860 agccaaaggg cagccccgag aaccacaggt gtacaccctg cccccatccc gggaggagat 1920 gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc ttctatccca gcgacatcgc 1980 cgtggagtgg gagagcaatg ggcagccgga gaacaactac aagaccacgc ctcccgtgct 2040 ggactccgac ggctccttct tcctctacag caagctcacc gtggacaaga gcaggtggca 2100 gcaggggaac gtcttctcat gctccgtgat gcacgaggct ctgcacaacc actacacgca 2160 gaagagcctc tccctgtctc cgggtaaatg aggatcccgg gctgattaca aggacgacga 2220 tgacaagtag gttgggtggc atccctgtga cccctcccca gtgcctctcc tggccctgga 2280 agttgccact ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc 2340 tgactaggtg tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca 2400 agttgggaag acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt 2460 ggcacaatct tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca 2520 gcctcccgag ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt 2580 ttggtagaga cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt 2640 gatctaccca ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt 2700 ccctgtcctt ctgattttaa aataactata ccagcaggag gacgtccaga cacagcatag 2760 gctacctggc catgcccaac cggtgggaca tttgagttgc ttgcttggca ctgtcctctc 2820 atgcgttggg tccactcagt agatgcctgt tgaattgggt acgcggccag cttggctgtg 2880 gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca 2940 aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct ccccagcagg 3000 cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat 3120 tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg 3180. aggaggcttt tttggaggcc tagcttttg caaaagctc ctcgaggac tgaaaaacca 3300. tccctatagt gagtcgtatt aaattcgtaa tcatgtcata gctgtttcct gtgtgaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc 3420 gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 3540 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 3600 3660. gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 3720 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gacttaag ataccaggcg 3780 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 3840 ctgtccgcct ttctccctc gggaagcgtg gcgctttc atagctcacg ctgtaggtat 3900 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctg tgcacgacc ccccgttcag 3960 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 4020 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 4080 gctacagagt tctgaagtg gtggcctaac tacggctaca ctagagaac agtatttggt 4140 atctgcgctc tgctgaagcc agttaccttc ggaaaagag ttggtagctc ttgatccggc 4200 aaacaaacca ccgctggtag cggtggtttt ttgtttgca agcagcagat tacgcgcaga 4260 aaaaaaggat ctcaagaga tcctgatc tttctacgg ggtctgacgc tcagtggaac 4320 gaaaactcac gttaaggat ttggtcatg agatttaca aaaggatctt cacctagatc 4380 cttttaaattt aaaaatgaag ttttaatca atctaaagta tatatgagta aacttggtct 4440 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 4500 tccatagttg cctgactccc cgtcgtgtag atatacga tacgggagg cttaccatct 4560 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 4620 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 4680 4740 cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 4800 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 4860 aaagcggtta gctccttgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 4920 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 4980 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 5040 agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 5100 gtgctcatca ttggaaaacg ttcttcgggg cgaaaaactct caaggatctt accgctgttg 5160 agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 5220 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 5280 gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 5340 cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 5400 ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg cgccctgtag cggcgcatta 5460 agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg 5520 cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa 5580 gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc 5640 aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt 5700 cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca 5760 acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc 5820 tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta 5880 acgcttacaa ttt 5893 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 tcccaggtta ctccattgcc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 gcctgagcca taagcacact 20 <210> 9 <211> twenty one <212> DNA <213> Artificial Sequence <400> 9 tgtgggcatc aatggatttg g 21 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <400> 10 acaccatgta ttccgggtca at 22 <210> 11 <211> twenty four <212> DNA <213> Artificial Sequence <400> 11 ttagaggaag ttccctgttc accc 24 <210> 12 <211> twenty four <212> DNA <213> Artificial Sequence <400> 12 cttacctggg aggaagaata ggag 24 <210> 13 <211> twenty three <212> DNA <213> Artificial Sequence <400> 13 tgcagattcc cacaatatgg gag 23 <210> 14 <211> twenty three <212> DNA <213> Artificial Sequence <400> 14 aacaggaagt gggtgctctt gag 23 <210> 15 <211> 38 <212> DNA <213> Artificial Sequence <400> 15 tgcggccgcg aattcgccac catgtggctg tccccatc 38 <210> 16 <211> 37 <212> DNA <213> Artificial Sequence <400> 16 gtccccgctc aagagcaccc acgtcgacat cgagggc 37 <210> 17 <211> 495 <212> DNA <213> Artificial Sequence <400> 17 atgtggctgt ccccatctct gctgcttctc atcctcccag gttatccat tgccgctaaa 60 atcactggtc caacaacagt gaatggctcg gagcagggct cattgactgt gcagtgtgct 120 tatggctcag gctgggagac ctacttgaag tggcggtgtc aaggagctga ttggaattac 180 tgtaacatcc ttgttaaaac aaatggatca gagcaggagg taaagaagaa tcgagtttcc 240 atcagggaca atcagaaaaa ccacgtgttc accgtgacca tggagaatct caaaagagat 300 gatgctgaca gttattggtg tgggactgag agacctggaa ttgatcttgg ggtcaaagtt 360 caagtgacca ttaacccagg cacacaaact gcagtctcag aatggacaac cacaacagca 420 agcctggctt tcacagctgc agccacccag aagaccagca gccccctcac caggtccccg 480 ctcaagagca cccac 495 <210> 18 <211> 165 <212> PRT <213> Artificial Sequence <400> 18 Met Trp Leu Ser Pro Ser Leu Leu Leu Leu Ile Leu Pro Gly Tyr Ser 1 5 10 15 Ile Ala Ala Lys Ile Thr Gly Pro Thr Thr Val Asn Gly Ser Glu Gln 20 25 30 Gly Ser Leu Thr Val Gln Cys Ala Tyr Gly Ser Gly Trp Glu Thr Tyr 35 40 45 Leu Lys Trp Arg Cys Gln Gly Ala Asp Trp Asn Tyr Cys Asn Ile Leu 50 55 60 Val Lys Thr Asn Gly Ser Glu Gln Glu Val Lys Lys Asn Arg Val Ser 65 70 75 80 Ile Arg Asp Asn Gln Lys Asn His Val Phe Thr Val Thr Met Glu Asn 85 90 95 Leu Lys Arg Asp Asp Ala Asp Ser Tyr Trp Cys Gly Thr Glu Arg Pro 100 105 110 Gly Ile Asp Leu Gly Val Lys Val Gln Val Thr Ile Asn Pro Gly Thr 115 120 125 Gln Thr Ala Val Ser Glu Trp Thr Thr Thr Thr Ala Ser Leu Ala Phe 130 135 140 Thr Ala Ala Ala Thr Gln Lys Thr Ser Ser Pro Leu Thr Arg Ser Pro 145 150 155 160 Leu Lys Ser Thr His 165 <210> 19 <211> 5863 <212> DNA <213> Artificial Sequence <400> 19 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct 60 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg 120 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa 180 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta 240 ttggccattg catacgttgt atctatatca tatatgtac atttatattg gctcatgtcc 300 aatatgaccg ccatgttgac attgattatt gactagttat tatagtaat caattacggg 360 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 420 gcctggctga ccgcccaacg acccccgcc attgacgtca ataatgacgt atgttcccat 480 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 540 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 600 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 660 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 720 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 780 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc 840 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc 900 tcgtttagtg aaccgtcaga attaagcttg cggccgcgaa ttcgccacca tgtggctgtc 960 cccatctctg ctgcttctca tcctcccagg ttactccatt gccgctaaaa tcactggtcc 1020 aacaacagtg aatggctcgg agcagggctc attgactgtg cagtgtgctt atggctcagg 1080 ctgggagacc tacttgaagt ggcggtgtca aggagctgat tggaattact gtaacatcct 1140 tgttaaaaca aatggatcag agcaggaggt aaagaagaat cgagtttcca tcagggacaa 1200 tcagaaaaac cacgtgttca ccgtgaccat ggagaatctc aaaagagatg atgctgacag 1260 ttattggtgt gggactgaga gacctggaat tgatcttggg gtcaaagttc aagtgaccat 1320 taacccaggc acacaaactg cagtctcaga atggacaacc acaacagcaa gcctggcttt 1380 cacagctgca gccacccaga agaccagcag ccccctcacc aggtccccgc tcaagagcac 1440 ccacgtcgac atcgagggcc gcatggaccc caaatcttgt aaaactcaca catgcccacc 1500 gtgcccagca cctgaactcc tggggggacc gtcagtcttc ctcttccccc caaaacccaa 1560 ggacaccctc atgatctccc ggacccctga ggtcacatgc gtggtggtgg acgtgagcca 1620 cgaagaccct gaggtcaagt tcaactggta cgtggacggc gtggaggtgc ataatgccaa 1680 gacaaagccg cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt 1740 cctgcaccag gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct 1800 cccagccccc atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt 1860 gtacaccctg cccccatccc gggaggagat gaccaagaac caggtcagcc tgacctgcct 1920 ggtcaaaggc ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga 1980 gaacaactac aagaccacgc ctcccgtgct ggactccgac ggctccttct tcctctacag 2040 caagctcacc gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat 2100 gcacgaggct ctgcacaacc actacacgca gaagagcctc tccctgtctc cgggtaaatg 2160 aggatcccgg gctgattaca aggacgacga tgacaagtag gttgggtggc atccctgtga 2220 cccctcccca gtgcctctcc tggccctgga agttgccact ccagtgccca ccagccttgt 2280 cctaataaaa ttaagttgca tcattttgtc tgactaggtg tccttctata atattatggg 2340 gtggaggggg gtggtatgga gcaaggggca agttgggaag acaacctgta gggcctgcgg 2400 ggtctattgg gaaccaagct ggagtgcagt ggcacaatct tggctcactg caatctccgc 2460 ctcctgggtt caagcgattc tcctgcctca gcctcccgag ttgttgggat tccaggcatg 2520 catgaccagg ctcagctaat ttttgttttt ttggtagaga cggggtttca ccatattggc 2580 caggctggtc tccaactcct aatctcaggt gatctaccca ccttggcctc ccaaattgct 2640 gggattacag gcgtgaacca ctgctccctt ccctgtcctt ctgattttaa aataactata 2700 ccagcaggag gacgtccaga cacagcatag gctacctggc catgcccaac cggtgggaca 2760 tttgagttgc ttgcttggca ctgtcctctc atgcgttggg tccactcagt agatgcctgt 2820 tgaattgggt acgcggccag cttggctgtg gaatgtgtgt cagttagggt gtggaaagtc 2880 cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag 2940 gtgtggaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc 3060 3120. cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc tagcttttg 3180 3240. caaaagctc ctcgaggaac tgaaaaacca gaaagttaat tccctatagt gagtcgtatt aaattcgtaa tcatgtcata gctgtttcct gtgtgaatt gttatccgct cacaattcca cacaacatac gagccggag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag 3420. ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 3540 cactcaaagg cggtaatacg gttatccaca gaatcagggg father aaagaacatg 3660. tgagcaaaag gccagcaaaa ggccaggac cgtaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga 3720 aacccgacag gacttaaag ataccaggcg ttccccctg gaagctccct cgtgcgctct 3780 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctccctc gggaagcgtg 3840 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 3900 ctgggctgtg tgcacgacc cccgttcag cccgaccgct gcgccttatc cggtaactat 3960 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 4020 aggattagca gagcgaggta tgtaggcggt gctacagagt tctgaagtg gtggcctaac 4080 tacggctaca ctagagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc 4140 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 4200 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaga tcctttgatc 4260 tttctacgg gtctgacgc tcagtggaac gaaaaccc gttaaggat ttggtcatg 4320 agatttaca aaaggatctt cacctagatc cttttaattt aaaaatgaag ttttaatca 4380 atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca 4440 cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag 4500 ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac 4560 ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc 4620 agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct 4680 agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc 4740 gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg 4800 cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc 4860 gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat 4920 tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag 4980 tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat 5040 aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg 5100 cgaaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca 5160 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 5220 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 5280 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 5340 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg 5400 ccacctgacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc 5460 gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt 5520 ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc 5580 cgatttagtg ctttacggca cctcgacccc aaaaaacttg attagggtga tggttcacgt 5640 agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt 5700 aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggt ctattctttt 5760 gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa 5820 aaatttaacg cgaattttaa caaaatatta acgcttacaa ttt 5863 <210> 20 <211> 415 <212> PRT <213> Artificial Sequence <400> 20 Met Trp Gln Phe Ser Ala Leu Leu Leu Phe Phe Leu Pro Gly Cys Cys 1 5 10 15 Thr Ala Gln Asp Ser Val Thr Gly Pro Glu Glu Val Ser Gly Gln Glu 20 25 30 Gln Gly Ser Leu Thr Val Gln Cys Arg Tyr Ser Ser Tyr Trp Lys Gly 35 40 45 Tyr Lys Lys Tyr Trp Cys Arg Gly Val Pro Gln Arg Ser Cys Asp Ile 50 55 60 Leu Val Glu Thr Asp Lys Ser Glu Gln Leu Val Lys Lys Asn Arg Val 65 70 75 80 Ser Ile Arg Asp Asn Gln Arg Asp Phe Ile Phe Thr Val Thr Met Glu 85 90 95 Asp Leu Arg Met Ser Asp Ala Gly Ile Tyr Trp Cys Gly Ile Thr Lys 100 105 110 Gly Gly Pro Asp Pro Met Phe Lys Val Asn Val Asn Ile Asp Gln Ala 115 120 125 Pro Lys Ser Ser Met Met Thr Thr Thr Ala Thr Val Leu Lys Ser Ile 130 135 140 Gln Pro Ser Ala Glu Asn Thr Gly Lys Glu Gln Val Thr Gln Ser Lys 145 150 155 160 Glu Val Thr Gln Ser Arg Pro His Thr Arg Ser Leu Leu Ser Ser Ile 165 170 175 Tyr Val Asp Ile Glu Gly Arg Met Asp Pro Lys Ser Cys Lys Thr His 180 185 190 Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val 195 200 205 Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 210 215 220 Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu 225 230 235 240 Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys 245 250 255 Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser 260 265 270 Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys 275 280 285 Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile 290 295 300 Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 305 310 315 320 Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 325 330 335 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 340 345 350 Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 355 360 365 Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 370 375 380 Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu 385 390 395 400 His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 405 410 415 <210> 21 <211> 403 <212> PRT Artificial Sequence <400> 21 Met Trp Leu Ser Pro Ser Leu Leu Leu Leu Ile Leu Pro Gly Tyr Ser 1 5 10 15 Ile Ala Ala Lys Ile Thr Gly Pro Thr Thr Val Asn Gly Ser Glu Gln 20 25 30 Gly Ser Leu Thr Val Gln Cys Ala Tyr Gly Ser Gly Trp Glu Thr Tyr 35 40 45 Leu Lys Trp Arg Cys Gln Gly Ala Asp Trp Asn Tyr Cys Asn Ile Leu 50 55 60 Val Lys Thr Asn Gly Ser Glu Gln Glu Val Lys Lys Asn Arg Val Ser 65 70 75 80 Ile Arg Asp Asn Gln Lys Asn His Val Phe Thr Val Thr Met Glu Asn 85 90 95 Leu Lys Arg Asp Asp Ala Asp Ser Tyr Trp Cys Gly Thr Glu Arg Pro 100 105 110 Gly Ile Asp Leu Gly Val Lys Val Gln Val Thr Ile Asn Pro Gly Thr 115 120 125 Gln Thr Ala Val Ser Glu Trp Thr Thr Thr Thr Ala Ser Leu Ala Phe 130 135 140 Thr Ala Ala Ala Thr Gln Lys Thr Ser Ser Pro Leu Thr Arg Ser Pro 145 150 155 160 Leu Lys Ser Thr His Val Asp Ile Glu Gly Arg Met Asp Pro Lys Ser 165 170 175 Cys Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 180 185 190 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 195 200 205 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 210 215 220 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 225 230 235 240 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 245 250 255 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 260 265 270 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 275 280 285 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 290 295 300 Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser 305 310 315 320 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 325 330 335 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 340 345 350 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 355 360 365 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 370 375 380 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 385 390 395 400 Pro Gly Lys

Claims

1. Use of an isolated polypeptide, or a nucleic acid construct encoding said isolated polypeptide, or a cell line containing said nucleic acid construct, or a cell line whose genome integrates an exogenous polynucleotide as shown in SEQ ID NO. 17, in the preparation of a product for treating tumors, wherein the isolated polypeptide comprises a functional fragment of CD300LD protein, said functional fragment of CD300LD protein being an extracellular region of CD300LD protein, said extracellular region of CD300LD protein being derived from human CD300LD protein, said amino acid sequence of said extracellular region of CD300LD protein being shown in SEQ ID NO. 18, said nucleic acid construct containing a polynucleotide as shown in SEQ ID NO. 17, and said tumor being melanoma.

2. The use according to claim 1, characterized in that, The isolated polypeptide also includes a protein purification tag.

3. The use according to claim 1, characterized in that, The amino acid sequence of the isolated polypeptide is shown in SEQ ID NO.

21.

4. The use according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid construct is shown in SEQ ID NO.

19.

5. Use of the polypeptide isolated in any one of claims 1-4 and the anti-PD1 antibody in the preparation of a product for treating tumors, wherein the tumor is melanoma.

Images