A molecular marker related to chicken age at first egg and application thereof

Abstract

The application discloses a molecular marker related to chicken age at first egg and application thereof, and relates to the technical field of biology; a nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; a SNP site exists at 535bp of the molecular marker; and the SNP site is a T / C mutation. It is found by the application that variation of the SNP site is significantly related to chicken age at first egg. By detecting the SNP site of the molecular marker, the genotype of a target chicken group can be known, so that the chicken group can be selected purposefully; and by selecting an individual with a TT genotype in a breeding process, the chicken age at first egg can be shortened. The identification method used in the application is high in accuracy, low in cost and high in efficiency.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a molecular marker related to the age at which chickens begin laying eggs and its application. Background Technology

[0002] Age at first egg production is a crucial economic trait in poultry; earlier onset of laying generally correlates with higher productivity. Under artificial and natural selection, the age of sexual maturity in livestock and poultry is gradually decreasing. For example, the red junglefowl (domestic breed) begins laying at 24.9 weeks, and the white Leghorn at 19.9 weeks. As an important economic trait, age at first egg production is closely related to other productive traits. In recent years, research on the genetic regulation of age at first egg production in chickens has received increasing attention from breeders, but this focus has primarily been on commercial laying hens, with limited research on local breeds. The development of high-quality chicken breeds often uses local breeds as breeding material, but these breeds tend to have later onset of laying and exhibit poor uniformity in age at first egg production. Using molecular selection methods to identify molecular genetic markers associated with age at first egg production, and then utilizing these markers for early marker-assisted selection, can effectively shorten the breeding cycle and has significant economic value for the selection and breeding of high-quality local chickens. Summary of the Invention

[0003] The purpose of this invention is to provide a molecular marker related to the age of chickens at the start of laying and its application, so as to solve the problems existing in the prior art. The present invention has found that the variation of the SNP site in the molecular marker is significantly related to the age of chickens at the start of laying. By using this molecular marker, breeding chicken breeds with good production performance can be selected, making the selection more efficient.

[0004] To achieve the above objectives, the present invention provides the following solution:

[0005] This invention provides a molecular marker related to the age of chickens at the start of laying. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. There is an SNP site at 535 bp of the molecular marker, and the SNP site is a T / C mutation.

[0006] Furthermore, the genotypes of the SNP sites include TT, CT, and CC.

[0007] This invention also provides a method for identifying the age at first laying of chickens using the above-mentioned molecular markers, comprising the following steps:

[0008] (1) Extract the genomic DNA of the chicken to be tested, perform PCR amplification, and obtain the amplification product with the nucleotide sequence shown in SEQ ID NO.1;

[0009] (2) Sequencing the amplification product to detect the genotype of the base at 535bp of the amplification product. When the genotype is TT, the chickens start laying eggs earlier.

[0010] Further, in step (1), the primer pairs for PCR amplification are as shown in SEQ ID NO.2-3.

[0011] Further, in step (1), the PCR amplification system is as follows: 2 μL DNA template, 7.5 μL 2×PCR mix, 2 μL mixed primers, and H2O added to 15 μL.

[0012] Further, in step (1), the PCR amplification program is as follows: 95℃ for 3 min; 94℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 20 cycles; 72℃ for 3 min.

[0013] The present invention also provides a primer pair for identifying the age at first laying of chickens, the nucleotide sequence of which is shown in SEQ ID NO. 2-3.

[0014] The present invention also provides a kit for identifying the age at which chickens begin laying, comprising the primer pairs described above.

[0015] The present invention also provides the application of the above-mentioned molecular markers, primer pairs or kits in chicken genetic breeding.

[0016] Furthermore, the chicken genetic breeding refers to the selection of chicken breeds with an early onset of egg production.

[0017] The present invention discloses the following technical effects:

[0018] This invention provides a molecular marker associated with the age at first laying in chickens. The nucleotide sequence of this marker is shown in SEQ ID NO.1. A SNP site, specifically a T>C mutation, exists at the 535bp position of this sequence. Variation at this site is significantly correlated with the age at first laying in chickens. By detecting the SNP site of this invention, the genotype of the relevant trait in the target flock can be determined, allowing for targeted selection of the flock. Selecting individuals with the TT genotype during breeding can shorten the age at first laying in chickens. The identification method used in this invention is highly accurate, low-cost, and efficient. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1

[0025] PCR was used to genotype the corresponding variant sites, and selection was made based on the genotype of the target site in the tested chicken blood. The specific steps are as follows:

[0026] 1. Sample DNA preparation

[0027] (1) Blood was collected from 306 Kang Le Yellow Chickens and DNA was extracted from the blood using the phenol-chloroform extraction method.

[0028] (2) DNA quality testing and dilution: Take qualified DNA samples, dilute to 100 ng / μL, and store at -20℃ for later use.

[0029] The phenol-chloroform extraction method has the following specific steps:

[0030] (1) Take 30 μL of whole blood and place it in a 1.5 mL centrifuge tube. Add 470 μL of 1×SET buffer, 12.5 μL of 20% SDS and 6 μL of 10 mg / mL proteinase K respectively. Mix well and place in a 55°C water bath overnight.

[0031] (2) Take the sample into a 1.5 mL centrifuge tube, add 500 μL of saturated phenol, shake gently for 20 min, and centrifuge at 10000 rpm for 10 min;

[0032] (3) Take the supernatant, add 500 μL of saturated phenol again, shake gently for 20 min, and centrifuge at 10000 rpm for 10 min;

[0033] (4) Take the supernatant, add 500 μL of chloroform-isoamyl alcohol (23:1), shake gently for 20 min, and centrifuge at 10000 rpm for 10 min;

[0034] (5) Take the supernatant, add 1 mL of ice-cold anhydrous ethanol (-20℃), shake back and forth to precipitate DNA, centrifuge at 10000 rpm for 10 min and then pour out the ethanol.

[0035] (6) Wash the DNA once with 1 mL of 75% ethanol, discard the ethanol, and dry it in a 50°C drying oven.

[0036] (7) After the DNA is completely dry, add 300 μL of sterilized double-distilled water to dissolve it, and place it in a 50°C water bath overnight to dissolve the DNA.

[0037] (8) Store in a refrigerator at -20℃ for later use.

[0038] 2. PCR amplification

[0039] Primer sequences:

[0040] Upstream primer: GATAAATATTGGGTAT (SEQ ID NO.2);

[0041] Downstream primer: TTCACCTTTTCAAGG (SEQ ID NO.3).

[0042] The amplified target sequence is shown in SEQ ID NO.1. There is an SNP site at 535 bp (i.e., at 132,467,534 bp on chromosome 1 of the gallusgallus 6 chicken genome), specifically a T>C mutation.

[0043] SEQ ID NO.1:

[0044] GATAAATATTGGGTATTCTATAACTGTGTTCTTAAGTGCAAAATATACAACTTAAAAGCTTACTCATCATACAGTTCAAAATAATCCTTTGAAAGCAAAGAAAGCTTTTTTGAATTGCTTCTTAATGTATTCAGCAAAACAGAAGTAGGAAATTAAGCAGATTGGGTACTGGCAGGAAAGGGAGTAATTAATGTAACCAGATAGGAGGCAAGCTTCAAAATATGACTGTAATAGCACACTGACACTAGCAATAAGGGATGAACGCATGTGCTTAAACATAAGATTGTGACTGAATCTCTGGTTTGATAGAAAAACTGAAAACAGCAAAGTGCTTTATGTTCTTAGAAGTGCATATTTTTCTCCATTAGCTACAAAGGGATTTCCTCACATGAACATGGTCTGCACCATTATCTGCATCCAGTTGAAGTGGGAGTTTCTGGTAAAGCCAGACCAAACTCATCCCATTCACCTGCAAAT

[0045] CATCCCCAACATCACTAATAACATTACGGTACTATTAATACACAGAACTCAAATAAAG YATTAAGCAACCAGTAATCTCATGGAAATAATCCCAAATCCCTGTCAAATCACAAAGGTATCATGTCCCCTTGCCCCATTTCTGTCCATATCCTGCTAGTGTGGCTATTAGCAATCTCAGCAAGCAGTGTGTTAGCAAGCATGCAGATCCCAGCAGCATAAGAGCACACAGTAGATGTGGTCTGATGCTCCAAAAGCATCGTCATGTTTATTGCCTGAGGATGCCTGAAAGCTTGA AGTCACAAAGTAAAATCATAGACTGTCCACATTTTGTACTTAAAAATCATCCTCACAACTGCACAATCTTAATGCTTACATATAATAATGTAGGCTTTGTACAACATTAAAGAACAGATTACAATTGCTTCCAGCTGACAAAAAGAAGGTGCAAGAAGTCTATTAGCACAGCCCCTGTGCTTCTTATGCTCTATTCAAAGAGCAGTAGAACAAGTGGAAAAGTTCC, where Y is T / C.

[0046] The synthesized primers were dissolved in 1×TE buffer to a concentration of 10 pmol. The upstream and downstream primers were added together in a volume ratio of 1:1, mixed well, and centrifuged.

[0047] The PCR amplification system is prepared as shown in Table 1:

[0048] Table 1 PCR amplification system

[0049] DNA template 2μL 2×PCRmix 7.5μL Mixed primers 2μL <![CDATA[H2O]]> Add to 15μL

[0050] Aliquot the prepared PCR tubes into 200 μL PCR containers, centrifuge, add 2 μL of DNA sample to each well, centrifuge again, and run on a PCR instrument. The amplification program is as follows: 95℃ for 3 min; 94℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 20 cycles; 72℃ for 3 min.

[0051] Sequencing and genotyping: The amplified PCR products were sent to a biotechnology company for sequencing. The experimental results were read using the SeqMan module of DNAStar software to view the genotype of the target locus. The peak diagram was viewed using Chromas software.

[0052] 3. Trait association analysis

[0053] The correlation between different genotypes of the chr1:132467534 gene locus and age at onset was statistically analyzed using SAS 9.0 GLM program. The results are shown in Table 2. Based on the genotyping results, individuals with genotypes TT, CC, and TC were labeled. The experimental data on age at onset in Table 2 show that there was a significant difference between individuals with the TT genotype and those with the CC genotype. The age at onset for individuals with the TT genotype was significantly earlier than that for individuals with the CC genotype, while the age for individuals with the TC genotype was in the middle.

[0054] Table 2 Correlation analysis between chr1:132467534 and age at onset of labor

[0055]

[0056]

[0057] Note: a. Least squares mean ± standard error; the same letter in the table indicates no significant difference, and different letters indicate significant difference; b. The number in parentheses represents the number of individuals with that genotype.

[0058] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for identifying the age of first laying in chickens using molecular markers, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. There is a SNP site at 535 bp of the molecular marker, and the SNP site is a T / C mutation. The method includes the following steps: (1) Extract the genomic DNA of the chicken to be tested, perform PCR amplification, and obtain the amplification product with the nucleotide sequence shown in SEQ ID NO.1; (2) Sequencing the amplification product to detect the genotype of the base at 535bp of the amplification product. When the genotype is TT, the chickens start laying eggs earlier.

2. The method according to claim 1, characterized in that, In step (1), the primer pairs for PCR amplification are shown in SEQ ID NO.2-3.

3. The method according to claim 1, characterized in that, In step (1), the PCR amplification system is as follows: 2 μL DNA template, 7.5 μL 2×PCR mix, 2 μL mixed primers, and H2O added to 15 μL.

4. The method according to claim 1, characterized in that, In step (1), the PCR amplification program is as follows: 95℃ for 3 min; 94℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 20 cycles; 72℃ for 3 min.

5. The application of a primer pair for identifying the age at first laying in chickens in chicken genetic breeding, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2-3; The chicken genetic breeding mentioned above refers to the selection of chicken breeds that start laying eggs at an early age.

6. The application of a kit for identifying the age at first laying in chickens in chicken genetic breeding, characterized in that, The kit includes primer pairs; the nucleotide sequences of the primer pairs are shown in SEQ ID NO.2-3; The chicken genetic breeding mentioned above refers to the selection of chicken breeds that start laying eggs at an early age.

Images