A method for detecting methylated cysteine in serum

Abstract

The present application relates to a kind of methods for detecting methylation cysteine (Hcy) in serum, belong to the field of biotechnology and analytical test. By detecting the free Hcy concentration x μM in serum, according to the formula y=73.5x+0.919, the total amount of Hcy y μM in serum is calculated. Using Hcy aptamer, construct evanescent wave optical fiber sensor. The detection limit of the sensor for free Hcy in buffer is 8.4 fM, and the detection limit for free Hcy in serum is 0.20 nM. It has extremely high specificity for free Hcy, and no cross response is found for human serum albumin with Hcy concentration 100,000 times higher and various amino acids. The detected free Hcy concentration is 1.36% of the total Hcy concentration measured by enzyme cycle method. Only 1 microliter of serum is required for detecting free Hcy, and the detection time is only 5 minutes. The sensor can be reused, and the cost is low. The performance is significantly better than that of enzyme cycle method, and has excellent clinical application value.

Description

Technical Field

[0001] This invention relates to a method for detecting methylcysteine ​​in serum, belonging to the fields of biotechnology and analytical testing. Background Technology

[0002] Methylcysteine ​​(Hcy) is an intermediate product of methionine metabolism. In the human body, approximately 98%-99% of Hcy forms complexes with proteins and amino acids through disulfide bonds, while only 1%-2% exists in a free state. The total Hcy concentration in normal human serum is 5-15 μM, with less than 6 μM being the optimal value. Clinical medical studies have shown that higher than normal Hcy concentrations lead to an increased incidence of cardiovascular diseases, diabetes, hypertension, and other diseases. Blood Hcy concentration has a significant positive correlation with cardiovascular and cerebrovascular diseases. Therefore, Hcy concentration detection has become an important part of clinical diagnosis of cardiovascular and cerebrovascular diseases and general health checkups. Current methods for detecting Hcy mainly include high-performance liquid chromatography (HPLC), radioimmunoassay (RIA), and enzyme cycling methods. HPLC relies on expensive equipment and skilled technicians, making it inconvenient for use in primary care settings. Radioimmunoassay requires radioactive reagents, which has poor safety.

[0003] Currently, the most commonly used method for detecting total Hcy is the enzyme cycling method. For example... Figure 1 As shown, its detection principle involves multiple reaction steps. First, oxidized Hcy is reduced to free Hcy. Then, free Hcy reacts with S-adenosylmethionine (SAM) under the catalysis of Hcy methyltransferase to form methionine and S-adenosylhomocysteine ​​(SAH). SAH is hydrolyzed by SAH hydrolase to generate adenosine and Hcy. The generated Hcy is added to the next cycle to continue generating adenosine. Adenosine is hydrolyzed to hypoxanthin and ammonia. Ammonia, under the action of glutamate dehydrogenase, converts reduced coenzyme I (NADH) to oxidized coenzyme I (NAD). The Hcy concentration in the sample is directly proportional to the change in NAD concentration. Quantitative detection of Hcy is achieved by detecting the UV-Vis absorption of NAD at 340 nanometers (nm). Enzyme cycling detection requires many reagents and is costly, currently only allowing laboratory testing, and the results are easily affected by endogenous interference. Therefore, there is an urgent need for a rapid, sensitive, and inexpensive method for detecting Hcy.

[0004] Nucleic acid aptamers are single-stranded DNA or RNA molecules with unique spatial configurations that can specifically recognize targets. Nucleic acid aptamers can be obtained through in vitro screening techniques or chemical synthesis, exhibiting minimal performance variation between batches and low cost. In recent years, rapid detection methods based on nucleic acid aptamers have attracted considerable attention, and rapid and sensitive detection of various small molecule targets such as antibiotics and toxins has been achieved. A DNA nucleic acid aptamer for Hcy has been reported in the literature (5'ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3', RSC Adv., 2013, 3, 24415–24422), with a dissociation constant of 600 ± 300 nanomoles per liter (nM). By conjugating this nucleic acid aptamer with gold nanoparticles, colorimetric detection of free Hcy was achieved. A standard addition of free Hcy to 10% serum yielded a limit of detection (LOD) of 0.5 μM (equivalent to 5 μM for 100% serum) and a kinetic range of 0.5–3.0 μM (RSC Adv., 2013, 3, 24415–24422). By combining this nucleic acid aptamer with an electrochemical sensor, electrochemical detection of free Hcy was achieved, with an LOD of 0.01 μM in buffer and a kinetic range of 0.05–20.0 μM (Bioelectrochemistry, 2020, 134, 107497). However, this method is highly sensitive to the serum matrix, with a detection limit higher than 1 μM for free Hcy in 50% serum (equivalent to 2 μM for 100% serum). The concentration of free Hcy in normal human serum is approximately 50 nM–0.3 μM; therefore, the methods reported in the two aforementioned studies have poor sensitivity and cannot detect free Hcy in serum.

[0005] Evanescent wave fiber optic sensors are optical sensors used for continuous detection. They utilize the evanescent wave generated at the interface of the optically less dense medium when light propagates through an optical fiber via total internal reflection to excite fluorescent groups on the fiber surface. The change in fluorescence intensity allows for continuous quantitative detection of the analyte content. Recently, we combined nucleic acid aptamers with evanescent wave sensors and achieved ultrasensitive detection of various small molecule targets using an in-situ enrichment detection strategy (National Invention Patent Application: 201910509959.0; PCT / CN2020 / 079442). Summary of the Invention

[0006] In this invention, we experimentally demonstrated for the first time a highly linear correlation between the concentration of free homocysteine ​​(Hcy) in serum and the total Hcy concentration measured by the enzymatic cycling method. When testing patient serum samples, the free Hcy concentration was consistently 1.36% of the total Hcy concentration measured by the enzymatic cycling method, with a linear correlation coefficient of 0.9893. Therefore, by detecting the concentration of free Hcy (x μM) in serum, the total Hcy concentration (y μM) in serum can be calculated using the formula y = 73.5x + 0.919.

[0007] This invention provides a method for detecting methylcysteine ​​in serum. The method involves detecting the concentration of free methylcysteine ​​in a serum sample and calculating the total amount of methylcysteine ​​in the serum based on the linear positive correlation between the concentration of free methylcysteine ​​and the concentration of total methylcysteine.

[0008] Furthermore, the above method for detecting methylcysteine ​​in serum calculates the total amount of methylcysteine ​​in serum, y μM, by detecting the concentration x μM of free methylcysteine ​​in the serum sample and using the formula y = 73.5x + 0.919.

[0009] Furthermore, in the above method for detecting methylcysteine ​​in serum, the percentage decrease in fluorescence signal of the positive sample relative to the negative sample is substituted into the fitting equation y = 10.29x + 96.5 in the standard curve, R0. 2 =0.995, which was used to calculate the concentration of free methylcysteine ​​in the serum sample. A graph was plotted with the measured free methylcysteine ​​concentration on the x-axis and the total methylcysteine ​​concentration measured by the enzyme cycling method on the y-axis. The two concentrations showed a linear positive correlation: y = 73.5x + 0.919, with a linear correlation coefficient R. 2 The free methylcysteine ​​concentration was 0.9893, which was 1.36 ± 0.09% of the total methylcysteine ​​concentration measured by the enzyme cycling method. Therefore, by detecting the concentration of free methylcysteine ​​in serum x μM, the total methylcysteine ​​in serum y μM was calculated according to the formula y = 73.5x + 0.919.

[0010] Furthermore, the above method for detecting methylcysteine ​​in serum involves the following steps for detecting the concentration of free methylcysteine ​​in serum samples: Buffer A consists of 50 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 100 mM sodium chloride, 1 mM magnesium chloride, 20 mM potassium chloride, and 1 mM calcium chloride, at pH 7.4. The serum sample is diluted 10,000 times with buffer A alone, without any pretreatment. Then, it is mixed with 20 nM of the complementary strand of the methylcysteine ​​nucleic acid aptamer labeled with the fluorescent group Cy 5.5, c-Hcy 40-Cy 5.5: GATGCCTGTGAA-Cy5.5, incubated, and then introduced into the evanescent wave fiber optic sensing system through the following three steps. Step 1: Pump in buffer A for 30 seconds to clean the sample inlet tubing and fiber optic reaction cell, ensuring a stable baseline; Step 2: Pump in the mixture of serum sample and c-Hcy 40-Cy5.5:GATGCCTGTGAA-Cy5.5 into the fiber optic reaction cell for 20 seconds, and hold for 180 seconds, measuring the fluorescence signal in real time; Step 3: Purge with 0.5% SDS washing buffer at pH 1.9 for 30 seconds to wash away c-Hcy 40-Cy 5.5:GATGCCTGTGAA-Cy5.5 bound to the fiber optic surface.

[0011] Furthermore, the above-mentioned method for detecting methylcysteine ​​in serum utilizes the in-situ enrichment of methylcysteine ​​on the surface of an optical fiber and the in-situ purification of methylcysteine ​​by the nucleic acid aptamer based on the evanescent wave sensor with nucleic acid aptamer immobilization. Based on the competitive binding relationship between the complementary DNA strands of the target and fluorescent label in the sample and the nucleic acid aptamer, the detection of methylcysteine ​​is achieved. The method also includes the following optical fiber preparation steps: optical fiber preparation is carried out through hydroxylation, silanization, aldehyde conversion, coupling with nucleic acid aptamer, and reduction steps on the optical fiber surface. Before testing, the optical fiber is blocked with Tween 80 at a concentration of 1% (w / v).

[0012] Furthermore, in the above method for detecting methylcysteine ​​in serum, the optical fiber preparation steps are as follows:

[0013] First, the fiber optic interface is modified using the following steps:

[0014] Step 1, Hydroxylation: After cleaning the optical fiber with an ultrasonic cleaner, the optical fiber is placed in a piranha solution H2O2:H2SO4=1:3 (v / v) and heated at 120℃ for 1 hour. The optical fiber is then cleaned with ultrapure water and dried with an air pump, and then dried at 70℃ overnight.

[0015] Step 2, Silanization: Place the optical fiber in a 2% (v / v) toluene solution of 3-aminopropyltriethoxysilane and react at room temperature for 1 hour. Then, clean the optical fiber with anhydrous toluene and dry it with an air pump. Place it in an oven and dry it at 180°C for 1 hour.

[0016] Step 3, Aldehydeation: The optical fiber was placed in a 2% (v / v) glutaraldehyde aqueous solution and reacted at room temperature for 3 hours, then washed with ultrapure water;

[0017] Subsequently, the optical fiber was immersed in a solution of amino-modified methylcysteine ​​nucleic acid aptamers, NH2-Hcy 40: NH2-AAAAAAAAAATCACTAGACAGGCGCTGTTGGTTCACAGGCATCTTCATTA, so that the nucleic acid aptamers were covalently fixed on the surface of the optical fiber. Then, the optical fiber was immersed in a sodium borohydride solution. Before testing the sample, the optical fiber was sealed with Tween 80 at a concentration of 1% (m / v).

[0018] To achieve highly sensitive and specific detection of free homocysteine ​​(Hcy) concentration in serum, we truncated the DNA aptamers for free Hcy selected by our collaborating unit, the Academy of Military Medical Sciences, and constructed an evanescent wave fiber optic sensor based on aptamer immobilization. The sensor's limit of detection (LOD) for free Hcy in buffer (S / N=3) is 8.4 fM, and its LOD for serum samples (S / N=3) is 0.20 nM. It exhibits extremely high specificity for free Hcy, showing no cross-reactivity with human serum albumin and various amino acids (methionine, histidine, arginine, and cysteine) at concentrations 100,000 times higher than Hcy concentrations. Detection of Hcy in serum requires only 1 μL of diluted serum, with a detection time of 5 minutes. The sensor also exhibits excellent interfacial regeneration properties and can be reused more than 20 times. All performance characteristics are significantly superior to the enzyme cycling method, demonstrating excellent clinical application value.

[0019] In addition, to compare with conventional evanescent wave sensors, this invention also constructed an evanescent wave sensor based on Hcy target immobilization. The detection limit (S / N=3) of this sensor in buffer solution is 9.3 pM, and the detection limit (S / N=3) in serum samples is 206 nM. The selectivity of the sensor for Hcy is 100 times that of other interfering substances (human serum albumin, cysteine ​​Cys). The detection sensitivity and specificity are superior to those of reported nucleic acid aptamer-based biosensors, but significantly inferior to the aforementioned nucleic acid aptamer-immobilized evanescent wave sensor.

[0020] The method of the present invention has the following advantages:

[0021] 1) When testing patient serum samples, the free Hcy concentration detected by the method of this invention is 1.36% of the total Hcy concentration measured by the enzyme cycling method, with a linear correlation coefficient of 0.9893. Therefore, the method of this invention can calculate the total Hcy concentration yμM in serum by detecting the concentration xμM of free Hcy in serum, according to the formula y=73.5x+0.919. This avoids the problems of the enzyme cycling method, which requires multiple detection reagents, sample reduction, and significant interference from endogenous substances in the detection results.

[0022] 2) The two evanescent wave fiber optic nucleic acid aptamer sensors constructed in this invention for the detection of free Hcy can both achieve highly sensitive and specific detection of free Hcy in serum. The target-immobilized evanescent wave fiber optic nucleic acid aptamer sensor has a detection limit of 206 nM for Hcy detection in serum, which is 25 and 10 times lower than reported nucleic acid aptamer-based colorimetric and electrochemical Hcy sensors, respectively (RSC Adv., 2013, 3, 24415–24422; Bioelectrochemistry, 2020, 134, 107497). The nucleic acid aptamer-immobilized evanescent wave fiber optic nucleic acid aptamer sensor has a detection limit of 0.20 nM for Hcy detection in serum, which is 25,000 and 10,000 times lower than reported nucleic acid aptamer-based colorimetric and electrochemical Hcy sensors, respectively. It is currently the only nucleic acid aptamer sensor with the sensitivity required for clinical detection of Hcy in serum.

[0023] 3) The Hcy evanescent wave fiber optic nucleic acid aptamer sensor constructed in this invention has a detection kinetic range that is wider than that of the enzyme cycling method (which is generally only two orders of magnitude wider). For samples with high Hcy content, there is no need to perform sample dilution and secondary detection.

[0024] 4) The Hcy evanescent wave fiber optic nucleic acid aptamer sensor constructed in this invention has the advantages of simple operation and extremely simple sample pretreatment (only sample dilution is required).

[0025] 5) The Hcy evanescent wave fiber optic nucleic acid aptamer sensor constructed in this invention has a short detection time of only 5 minutes.

[0026] 6) The Hcy evanescent wave fiber optic nucleic acid aptamer sensor constructed in this invention can be reused 23 times with a single fiber, and the detection cost is far lower than that of existing detection methods. Attached Figure Description

[0027] Figure 1 This is a schematic diagram illustrating the principle of Hcy detection using the enzyme cycling method.

[0028] Figure 2 This is a schematic diagram illustrating the construction and detection principle of an Hcy evanescent wave fiber optic sensor based on a fixed target. Figure 2 In this context, "Signal off" means the signal is off, and "Time" means the time.

[0029] Figure 3 It uses an evanescent wave sensor to test the dissociation constant (K) of Hcy nucleic acid aptamers. D )picture.

[0030] Figure 4 This is a working curve of Hcy detection based on a target-fixed evanescent wave fiber optic sensor.

[0031] Figure 5 This is a diagram showing the target-specific detection results of an evanescent wave fiber optic sensor with a fixed target.

[0032] Figure 6 This is a working curve for detecting Hcy in serum with standard additives based on a target-fixed evanescent wave fiber optic sensor.

[0033] Figure 7 This is a schematic diagram illustrating the construction and detection principle of an Hcy evanescent wave fiber optic sensor based on nucleic acid aptamer immobilization. Figure 7 In this context, "Signal off" means the signal is off, and "Time" means the time.

[0034] Figure 8 This is a working curve of Hcy detection based on a nucleic acid aptamer-fixed evanescent wave fiber optic sensor.

[0035] Figure 9 The target-specific detection results of the evanescent wave fiber optic sensor based on nucleic acid aptamer immobilization are shown in the figure.

[0036] Figure 10 This is a graph showing the test results of the interface regeneration capability of an evanescent wave fiber optic sensor based on nucleic acid aptamer immobilization.

[0037] Figure 11 This is a working curve for the detection of Hcy in serum with standard additives based on a nucleic acid aptamer-immobilized evanescent wave fiber optic sensor.

[0038] Figure 12 This is a comparison chart of the concentration of free Hcy and total Hcy in the patient's serum. The free Hcy was detected using an evanescent wave fiber optic sensor immobilized with nucleic acid aptamers, while the total Hcy was detected by Beijing Anzhen Hospital using an enzyme cycling method. Detailed Implementation

[0039] The overall technical solution of the present invention is to provide a method for detecting methylcysteine ​​in serum. The method involves detecting the concentration of free methylcysteine ​​in a serum sample and calculating the total amount of methylcysteine ​​in the serum based on the linear positive correlation between the concentration of free methylcysteine ​​and the concentration of total methylcysteine.

[0040] Substituting the percentage decrease in fluorescence signal of the positive sample relative to the negative sample obtained from the test into the fitting equation of the standard curve y = 10.29x + 96.5, R0 2 =0.995, which was used to calculate the concentration of free methylcysteine ​​in the serum sample. A graph was plotted with the measured free methylcysteine ​​concentration on the x-axis and the total methylcysteine ​​concentration measured by the enzyme cycling method on the y-axis. The two concentrations showed a linear positive correlation: y = 73.5x + 0.919, with a linear correlation coefficient R. 2 The free methylcysteine ​​concentration was 0.9893, which was 1.36 ± 0.09% of the total methylcysteine ​​concentration measured by the enzyme cycling method. Therefore, by detecting the concentration of free methylcysteine ​​in serum x μM, the total methylcysteine ​​in serum y μM was calculated according to the formula y = 73.5x + 0.919.

[0041] The steps for detecting the concentration of free methylated cysteine ​​in serum samples are as follows: Buffer A consists of 50 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 100 mM sodium chloride, 1 mM magnesium chloride, 20 mM potassium chloride, and 1 mM calcium chloride, pH 7.4. The serum sample is diluted 10,000 times with buffer A alone, without any serum sample pretreatment. Then, it is mixed with 20 nM of the complementary strand c-Hcy 40-Cy 5.5:GATGCCTGTGAA-Cy5.5 labeled with the fluorescent group Cy 5.5. After incubation, the mixture is introduced into the evanescent wave fiber optic sensing system through the following three steps. Step 1: Pump in buffer A for 30 seconds to clean the sample inlet tubing and fiber optic reaction cell, ensuring a stable baseline; Step 2: Pump in the mixture of serum sample and c-Hcy 40-Cy5.5:GATGCCTGTGAA-Cy5.5 into the fiber optic reaction cell for 20 seconds, and hold for 180 seconds, measuring the fluorescence signal in real time; Step 3: Purge with 0.5% SDS washing buffer at pH 1.9 for 30 seconds to wash away c-Hcy40-Cy 5.5:GATGCCTGTGAA-Cy5.5 bound to the fiber optic surface.

[0042] The above-mentioned method for detecting methylcysteine ​​in serum utilizes the in-situ enrichment of methylcysteine ​​on the surface of an optical fiber and the in-situ purification of methylcysteine ​​by the nucleic acid aptamer, based on the competitive binding relationship between the complementary DNA strands of the target and fluorescent label in the sample and the nucleic acid aptamer. It also includes the following optical fiber preparation steps: optical fiber is prepared by hydroxylation, silanization, aldehyde conversion, coupling with nucleic acid aptamer, and reduction steps on the optical fiber surface. Before testing, the optical fiber is blocked with Tween 80 at a concentration of 1% (w / v).

[0043] The optical fiber fabrication steps are as follows:

[0044] First, the fiber optic interface is modified using the following steps:

[0045] Step 1, Hydroxylation: After cleaning the optical fiber with an ultrasonic cleaner, the optical fiber is placed in a piranha solution H2O2:H2SO4=1:3 (v / v) and heated at 120℃ for 1 hour. The optical fiber is then cleaned with ultrapure water and dried with an air pump, and then dried at 70℃ overnight.

[0046] Step 2, Silanization: Place the optical fiber in a 2% (v / v) toluene solution of 3-aminopropyltriethoxysilane and react at room temperature for 1 hour. Then, clean the optical fiber with anhydrous toluene and dry it with an air pump. Place it in an oven and dry it at 180°C for 1 hour.

[0047] Step 3, Aldehydeation: The optical fiber was placed in a 2% (v / v) glutaraldehyde aqueous solution and reacted at room temperature for 3 hours, then washed with ultrapure water;

[0048] Subsequently, the optical fiber was immersed in a solution of amino-modified methylcysteine ​​nucleic acid aptamers, NH2-Hcy 40: NH2-AAAAAAAAAATCACTAGACAGGCGCTGTTGGTTCACAGGCATCTTCATTA, so that the nucleic acid aptamers were covalently fixed on the surface of the optical fiber. Then, the optical fiber was immersed in a sodium borohydride solution. Before testing the sample, the optical fiber was sealed with Tween 80 at a concentration of 1% (m / v).

[0049] Table 1. DNA probes used in this invention

[0050]

[0051] Cy5.5: Fluorescent group

[0052] All tests in the following examples were performed in buffer A (50 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 100 mM sodium chloride, 1 mM magnesium chloride, 20 mM potassium chloride, 1 mM calcium chloride, pH 7.4).

[0053] Example 1. Determination of the dissociation constant (Ki) of Hcy nucleic acid aptamers using a target-fixed evanescent wave sensor. D )

[0054] First, the fiber optic interface is modified through the following steps (the modification steps and principles are as follows). Figure 2 As shown):

[0055] 1. Hydroxylation: After cleaning the optical fiber with an ultrasonic cleaner, the fiber is placed in a piranha solution (H2O2:H2SO4 = 1:3 v / v) and heated at 120°C for 1 hour. The fiber is then rinsed with ultrapure water, dried with an air pump, and stored at 70°C overnight.

[0056] 2. Silanization: The optical fiber is placed in a 2% (v / v) toluene solution of 3-aminopropyltriethoxysilane (APTS) and reacted at room temperature for 1 hour. The optical fiber is then cleaned with anhydrous toluene and dried with an air pump. It is then placed in an oven and dried at 180°C for 1 hour.

[0057] 3. Aldehydeation: The optical fiber was placed in a 2% (v / v) glutaraldehyde aqueous solution and reacted at room temperature for 3 hours, then washed with ultrapure water;

[0058] 4. Target coupling: Place the optical fiber in an Hcy aqueous solution (1 μM) and react at room temperature for 6 hours; then rinse with ultrapure water.

[0059] 5. Reduction: Place the optical fiber in a 3% (m / v) sodium borohydride aqueous solution and react at room temperature for 0.5 hours; then wash with ultrapure water; store the obtained optical fiber at low temperature (4℃).

[0060] Then, solutions of Hcy nucleic acid aptamers modified with the fluorescent group Cy5.5 (Hcy 88-Cy 5.5, see Table 1) with concentrations of 0.1, 1, 10, 50, 100, 200, and 500 nM (nanomoles per liter) were prepared in buffer A. The different concentrations of Hcy 88-Cy5.5 solutions were then sequentially introduced into the evanescent wave fiber optic sensing system through the following two steps to achieve K... D The test. (1) Pump in buffer for 20 seconds to clean the sample inlet and fiber optic reaction chamber to ensure a stable baseline; (2) Pump Hcy 88-Cy 5.5 solution into the fiber optic reaction chamber (takes 20 seconds) and keep it for 180 seconds to allow the recognition and binding of Hcy fixed on the fiber optic surface with Hcy 88-Cy 5.5 to reach dynamic equilibrium), and measure the fluorescence signal in real time. Repeat (1)-(2), in which the concentration of nucleic acid aptamers in (2) increases sequentially. Plot the binding curve with fluorescence intensity as the ordinate Y and the concentration of Hcy 88-Cy 5.5 as the abscissa X. And by assuming a 1:1 binding mode (Y=Bmax*X / (K D +X)), K is obtained through nonlinear fitting. D The value is 120±20 nM, and the experimental results are as follows: Figure 3 As shown in the figure, this value is lower than the dissociation constant of Hcy reported in the literature (600±300 nM), indicating that the Hcy nucleic acid aptamer used in this invention has higher affinity.

[0061] Example 2. Ultrasensitive and highly specific detection of free Hcy using a target-fixed evanescent wave fiber optic aptamer sensor.

[0062] The fiber fabrication process was the same as in Example 1, involving the coupling of Hcy to the fiber surface through steps such as hydroxylation, silanization, aldehyde conversion, Hcy coupling, and reduction. Hcy standard solutions of different final concentrations (10 pM, 100 pM, 1 nM, 10 nM, 100 nM, 1 μM) were prepared in buffer A. Then, the Hcy standard solutions were mixed with 20 nM of Hcy nucleic acid aptamers labeled with the fluorescent group Cy 5.5 (Hcy 88-Cy 5.5, see Table 1) and incubated. The mixture was then introduced into the evanescent wave fiber optic sensing system through the following three steps. (1) Pump in buffer solution for 30 seconds to clean the sample inlet tubing and fiber optic reaction cell to ensure a stable baseline; (2) Pump the mixture of target and Hcy 88-Cy 5.5 into the fiber optic reaction cell (takes 20 seconds) and hold for 180 seconds, measuring the fluorescence signal in real time; (3) Purge with washing buffer (0.5% sodium dodecyl sulfate (SDS), pH 1.9) for 30 seconds to wash away Hcy 88-Cy5.5 bound to the fiber optic surface. Repeat (1)-(3), with the target concentration in (2) increasing sequentially.

[0063] When performing specificity tests, replace Hcy in the above steps with various other targets (human serum albumin HSA, cysteine ​​Cys) at 100 nM, and the other test steps are the same as above.

[0064] When testing serum samples spiked with Hcy, no sample pretreatment is required. Simply add different concentrations of Hcy to the serum and mix well, with final concentrations of 100 nM, 1 μM, 10 μM, 100 μM, 1 mM, 10 mM, and 100 mM, respectively. Then, dilute the spiked serum sample 10,000 times in buffer solution and mix it with 20 nM Hcy 88-Cy 5.5. The detection procedure is the same as that for Hcy detection in the buffer solution described above.

[0065] The results show that the test results of the working curve are as follows: Figure 4 As shown. When using a target-fixed evanescent wave fiber optic nucleic acid aptamer sensor to detect free Hcy in buffer solution, the limit of detection (LOD) obtained at a signal-to-noise ratio of 3 was 9.3 pM, and the semi-logarithmic linear kinetic range was 10 pM to 1 μM (y = 12.8*x + 155.1, R). 2 =0.955). The detection limit is 1000 times lower than that of the nucleic acid aptamer-based Hcy electrochemical sensor reported in the literature (Bioelectrochemistry, 2020, 134, 107497). Specificity test results are as follows. Figure 5As shown, the signal response of 1 nM Hcy is higher than that of human serum albumin and cysteine ​​at 100 nM, indicating that the sensor has high target specificity (>100-fold).

[0066] The detection results of standard Hcy in serum are as follows Figure 6 As shown. The limit of detection (LOD) was 205.7 nM (converted to 100% serum concentration), and the semi-logarithmic linear kinetic range was 1 μM to 100 μM (y = 13.6*x + 97, R0). 2 =0.999). The detection limit for Hcy in serum is 25 and 10 times lower than that of reported nucleic acid aptamer-based colorimetric and electrochemical Hcy sensors, respectively (RSC Adv., 2013, 3, 24415–24422; Bioelectrochemistry, 2020, 134, 107497). The concentration of free Hcy in normal human serum is 50 nM–0.3 μM. Therefore, this target-immobilized nucleic acid aptamer evanescent wave sensor does not meet the sensitivity requirements for direct detection of free Hcy in serum.

[0067] Example 3. Ultrasensitive and highly specific detection of Hcy and sensor regeneration performance testing using an evanescent wave fiber optic nucleic acid aptamer sensor based on nucleic acid aptamer immobilization.

[0068] The ultrasensitive evanescent wave sensor based on nucleic acid aptamer immobilization utilizes the in-situ enrichment of Hcy on the fiber surface and the in-situ purification of Hcy by the nucleic acid aptamer. Based on the competitive binding relationship between the complementary DNA strands of the target and fluorescently labeled DNA in the sample and the nucleic acid aptamer, ultrasensitive detection of Hcy is achieved. Figure 7 ).like Figure 7 As shown, the surface hydroxylation, silanization, and aldehyde modification steps of the optical fiber were the same as in Example 1. Subsequently, the optical fiber was immersed in a solution of amino-modified Hcy nucleic acid aptamers (NH2-Hcy 40, Table 1), allowing the nucleic acid aptamers to be covalently fixed to the surface of the optical fiber. Then, the optical fiber was immersed in a sodium borohydride solution. Before testing the sample, the optical fiber was sealed with Tween 80 at a concentration of 1% (m / v).

[0069] Hcy standard solutions of different final concentrations (1fM, 10fM, 100fM, 1pM, 10pM, 100pM, 1nM, 10nM) were prepared in buffer A. Then, the Hcy standard solutions were mixed with 20nM of complementary strands of Hcy nucleic acid aptamers labeled with the fluorescent group Cy 5.5 (c-Hcy 40-Cy 5.5, Table 1). The mixture was introduced into the evanescent wave fiber optic sensing system through the following three steps: (1) Buffer A was pumped in for 30 seconds to clean the sample inlet and fiber optic reaction chamber to ensure a stable baseline; (2) The mixture of target and c-Hcy 40-Cy 5.5 was pumped into the fiber optic reaction chamber (20 seconds) and held for 180 seconds, and the fluorescence signal was measured in real time; (3) Washing buffer (0.5% SDS, pH 1.9) was introduced for 30 seconds to wash away c-Hcy 40-Cy 5.5 bound to the fiber optic surface. Repeat (1)-(3), where the target concentration in (2) increases sequentially.

[0070] For specificity testing, replace Hcy in the above steps with 100 nM of various other targets (human serum albumin HSA, methionine Met, histidine His, arginine Arg, cysteine ​​Cys), and follow the same testing steps. For sensor regeneration performance testing, cycle the test with a blank sample containing only 20 nM c-Hcy 40-Cy 5.5 and a sample with 100 nM Hcy added, following the same testing steps.

[0071] When testing serum samples spiked with Hcy, no sample pretreatment is required. Simply add different concentrations of Hcy to the serum and mix well, resulting in final concentrations of 10 pM, 100 pM, 1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM. Then, dilute the spiked serum sample 10,000 times in buffer solution and mix it with 20 nM c-Hcy 40-Cy 5.5. The detection procedure is the same as for Hcy detection in buffer solution.

[0072] The results show that the test results of the working curve are as follows: Figure 8 As shown. When using a nucleic acid aptamer-based evanescent wave fiber optic sensor to detect Hcy in the buffer solution, the detection limit, calculated at a signal-to-noise ratio of 3, was 8.4 fM, and the semi-logarithmic linear kinetic range was from 10 fM to 1 nM (y = 10.34x + 151.7, R0). 2 =0.973). The LOD is about 1,000 times lower than the target-fixed evanescent wave fiber optic sensor of this invention, and 1 million times lower than the Hcy electrochemical sensor based on nucleic acid aptamers reported in the literature (Bioelectrochemistry, 2020, 134, 107497).

[0073] Specificity test results as follows Figure 9 As shown, the signal response of 1 pM Hcy is higher than that of other amino acids and proteins at 100 nM, indicating that the sensor has extremely high target specificity (>100,000 times). The sensor's regeneration performance test results are as follows... Figure 10 As shown, the sensor can perform 23 "on / off" tests, and the signal response of both blank samples (without Hcy) and positive samples (containing 100 nM Hcy) did not change significantly (within ±5%). During the 24th-30th tests, both the blank and sample signals showed a significant decrease. This indicates that the sensor can be reused at least 23 times without system calibration.

[0074] The detection results of standard Hcy in serum are as follows Figure 11 As shown, the detection limit was 0.20 nM (converted to 100% serum concentration), and the semi-logarithmic linear kinetic interval was 10 pM to 10 nM (y = 4.69x + 50.12, R0). 2 =0.9995) and 0.1 μM to 10 μM (y = 10.29x + 96.50, R = ... 2 =0.9950). The LOD for detecting Hcy in serum is approximately 1000 times lower than that of the target-immobilized evanescent wave fiber optic sensor of this invention, and approximately 25000 and 10000 times lower, respectively, than the nucleic acid aptamer-based colorimetric and electrochemical Hcy sensors reported in the literature (RSC Adv., 2013, 3, 24415–24422; Bioelectrochemistry, 2020, 134, 107497). The concentration of free Hcy in normal human serum is 50 nM–0.3 μM. Therefore, this nucleic acid aptamer-immobilized evanescent wave sensor can meet the sensitivity requirements for direct detection of free Hcy in serum.

[0075] Example 4. Detection of free homocysteine ​​(Hcy) in real patient serum samples using an evanescent wave fiber optic nucleic acid aptamer sensor based on nucleic acid aptamer immobilization.

[0076] The optical fiber fabrication process was the same as in Example 3, involving hydroxylation, silanization, aldehyde modification, aptamer coupling, and reduction on the fiber surface. Before testing, the optical fiber was sealed with 1% (w / v) Tween 80.

[0077] The patient serum sample was diluted 10,000-fold with buffer A, then mixed with the complementary strand of the Hcy aptamer labeled with the fluorescent group Cy 5.5 (c-Hcy 40-Cy 5.5, Table 1) at 20 nM, incubated, and the detection procedure was the same as in Example 3. The percentage decrease in fluorescence signal of the positive sample relative to the negative sample was substituted into the fitting equation of the standard curve (y = 10.29x + 96.5, R²).2 =0.995), which was used to calculate the free Hcy concentration in the patient's serum sample. The measured free Hcy concentration was plotted on the x-axis, and the total Hcy concentration measured by Beijing Anzhen Hospital using an enzyme cycling method was plotted on the y-axis. Figure 12 .like Figure 12 As shown, the concentrations of the two are linearly positively correlated (y = 73.5x + 0.919, linear correlation coefficient R). 2 The free Hcy concentration we measured was 1.36 ± 0.09% of the total Hcy concentration measured by the enzyme cycling method at Beijing Anzhen Hospital. Therefore, the total Hcy concentration y μM in serum can be calculated by detecting the concentration x μM of free Hcy in serum and using the formula y = 73.5x + 0.919.

[0078] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it. They should not be used to limit the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the essence of the present invention shall fall within the scope of protection of the present invention.

Claims

1. An evanescent wave fiber optic sensing system for detecting methylcysteine ​​in serum, characterized in that, The evanescent wave fiber optic sensing system includes a serum sample, the complementary strand of the methylated cysteine ​​nucleic acid aptamer c-Hcy 40-Cy 5.5: GATGCCTGTGAA-Cy5.5, an evanescent wave fiber optic nucleic acid aptamer sensor based on Hcy target immobilization, and buffer A, wherein buffer A consists of 50 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 100 mM sodium chloride, 1 mM magnesium chloride, 20 mM potassium chloride, and 1 mM calcium chloride, at pH 7.

4. The preparation steps of the fiber optic nucleic acid aptamer sensor are as follows: First, the fiber optic interface is modified using the following steps: Step 1, Hydroxylation: After cleaning the optical fiber with an ultrasonic cleaner, place the optical fiber in a piranha solution H2O2 : H2SO4 = 1:3 (v / v) and heat it at 120°C for 1 hour. After cleaning the optical fiber with ultrapure water, blow it dry with an air pump and dry it at 70°C overnight. Step 2, Silanization: Place the optical fiber in a 2% (v / v) toluene solution of 3-aminopropyltriethoxysilane and react at room temperature for 1 hour. Then, clean the optical fiber with anhydrous toluene and dry it with an air pump. Place it in an oven and dry it at 180°C for 1 hour. Step 3, Aldehydeation: The optical fiber was placed in a 2% (v / v) glutaraldehyde aqueous solution and reacted at room temperature for 3 hours, then washed with ultrapure water; Subsequently, the optical fiber was immersed in a solution of amino-modified methylcysteine ​​nucleic acid aptamers, NH2-Hcy 40: NH2-AAAAAAAAAATCACTAGACAGGCGCTGTTGGTTCACAGGCATCTTCATTA, so that the nucleic acid aptamers were covalently fixed on the surface of the optical fiber. Then, the optical fiber was immersed in a sodium borohydride solution. Before testing the sample, the optical fiber was sealed with Tween 80 at a concentration of 1% (m / v).

2. The application of the evanescent wave fiber optic sensing system as described in claim 1 in the preparation of a product for detecting methylcysteine ​​in serum, characterized in that, The testing methods for the product include: The total amount of methylcysteine ​​in serum is calculated by detecting the concentration of free methylcysteine ​​in serum samples and finding that the concentration of free methylcysteine ​​and the concentration of total methylcysteine ​​are linearly positively correlated. Substituting the percentage decrease in fluorescence signal of the positive sample relative to the negative sample obtained from the test into the fitting equation of the standard curve y=10.29x+96.5, R 2 =0.995, where x is the Log cysteine ​​concentration on the x-axis and y is the percentage decrease in fluorescence signal on the y-axis, which is used to calculate the concentration of free methylated cysteine ​​in the serum sample. Plotting the measured free methylcysteine ​​concentration on the x-axis and the total methylcysteine ​​concentration measured by the enzymatic cycling method on the y-axis, we find a linear positive correlation between the two concentrations: y = 73.5x + 0.919, with a linear correlation coefficient R0. 2 The value was 0.9893, and the measured concentration of free methylated cysteine ​​was 1.36 ± 0.09% of the total methylated cysteine ​​concentration determined by the enzymatic cycling method. Therefore, by detecting the concentration x of free methylated cysteine ​​in serum... M, calculate the total amount of methylated cysteine ​​in serum using the formula y=73.5x+ 0.

919. M, where x is the x-coordinate and y is the y-coordinate; The steps for detecting the concentration of free methylated cysteine ​​in serum samples are as follows: Buffer A consists of 50 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 100 mM sodium chloride, 1 mM magnesium chloride, 20 mM potassium chloride, and 1 mM calcium chloride, pH 7.

4. The serum sample only needs to be diluted 10,000 times with Buffer A; no serum sample pretreatment is required. Then, it is mixed with 20 nM of the complementary strand of the methylated cysteine ​​aptamer labeled with the fluorescent group Cy5.5, c-Hcy 40-Cy 5.5:GATGCCTGTGAA-Cy5.

5. After incubation, the mixture is introduced into the evanescent wave fiber optic sensing system through the following three steps: Step 1: Pump in Buffer A for 30 seconds to clean the sample inlet tube and fiber optic reaction cell to ensure baseline stability; Step 2: Pump the mixture of serum sample and c-Hcy 40-Cy 5.5:GATGCCTGTGAA-Cy5.5 into the fiber optic reaction cell, taking 20 seconds. Step 3: Pour in 0.5% SDS washing buffer, pH 1.9, and rinse for 30 seconds to wash away c-Hcy40-Cy 5.5:GATGCCTGTGAA-Cy5.5 bound to the fiber surface; This method utilizes the in-situ enrichment of methylcysteine ​​on the surface of an optical fiber and the in-situ purification of methylcysteine ​​by the nucleic acid aptamer based on the evanescent wave sensor with nucleic acid aptamer immobilization. Based on the competitive binding relationship between the complementary strands of the target and fluorescent label in the sample and the nucleic acid aptamer, the method achieves the detection of methylcysteine.

Images