Nitro compound detecting element
Patent Information
- Application Number
- CN202180059241.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-07-27
- Filing Date
- 2021-07-21
- Publication Date
- 2026-08-18
- Estimated Expiration
- 2041-07-21
AI Technical Summary
然而,昆虫的嗅觉受体能够检测硝基化合物还不为大家所知
[0068]根据本发明,能够提供硝基化合物检测技术。
Smart Images

Figure BDA0004113646500000271 
Figure HDA0004113646510000011 
Figure HDA0004113646510000021
Abstract
Description
Technical Field
[0001] This disclosure relates to nitro compound detection elements, etc. Background Technology
[0002] Nitro compounds are mostly explosive, thus requiring the development of detection technologies. It is known that organisms such as dogs recognize nitro compounds, and olfactory receptor genes in mammals (mice, rats) have been identified as biological factors involved in this recognition (Non-Patent Literature 1).
[0003] On the other hand, in recent years, it has been recognized that insects possess a high degree of specificity in recognizing odor substances, leading to explorations into its application in olfactory sensors and other technologies. In the olfactory apparatus of insects, there exists an olfactory receptor complex formed by olfactory receptors that recognize odor substances and co-receptors. When activated by odor substances, this complex exhibits ion channel activity, thereby detecting the odor substances. However, the ability of insect olfactory receptors to detect nitro compounds is still unknown.
[0004] Existing technical documents
[0005] Patent documents
[0006] Patent Document 1: Japanese Patent Application Publication No. 2013-27376
[0007] Patent Document 2: Japanese Patent Application Publication No. 2018-59786
[0008] Patent Document 3: Japanese Patent Application Publication No. 2012-78351
[0009] Non-patent literature:
[0010] Non-patent literature 1: Li J, Haddad R, Chen S, Santos V, Luetje CW. Abr oadly tuned mouse odorant receptor that detects nitrotoluenes. J Neuroche m. 2012Jun; 121(6):881-890. Summary of the Invention
[0011] The problem that the invention aims to solve
[0012] The subject of this disclosure is to provide a technology for detecting nitro compounds.
[0013] Methods for solving problems
[0014] The inventors conducted in-depth research on the aforementioned issues and discovered that specific types of insect olfactory receptors, or those with specific mutations, exhibit nitro compound responsiveness. Based on this understanding, the inventors conducted further research, resulting in the invention disclosed herein. Specifically, this disclosure includes the following technical solutions.
[0015] Item 1. A nitro compound detection element comprising an olfactory receptor protein, said olfactory receptor protein containing:
[0016] (1) Amino acid sequence 1C, which is a mutation of amino acid sequence 1A shown in SEQ ID NO: 1 or amino acid sequence 1B having more than 80% identity with said amino acid sequence 1A, and includes mutation 1a: deletion of part or all of the region of the first extracellular loop;
[0017] (2) Amino acid sequence 2C, which is a mutation of amino acid sequence 2A shown in SEQ ID NO: 2 or amino acid sequence 2B having more than 80% identity with amino acid sequence 2A, comprising mutation 2a: substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A or substitution 2ay in amino acid sequence 2B corresponding to substitution 2ax;
[0018] (3) Amino acid sequence 3C, which is a mutation of amino acid sequence 3A shown in SEQ ID NO: 3 or amino acid sequence 3B having more than 80% identity with amino acid sequence 3A, comprising mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352 and S368 in amino acid sequence 3A or substitution 3ay of the amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids to non-charged amino acids in the region from the third outer loop to the third inner loop;
[0019] (4) Amino acid sequence 4C, which is a mutation of amino acid sequence 4A shown in SEQ ID NO: 4 or amino acid sequence 4B having more than 80% identity with amino acid sequence 4A, comprising mutation 4a: substitution 4ax in amino acid sequence 4A consisting of amino acid group consisting of M61, C104, R112, G181, V189 and I327 or substitution 4ay in amino acid sequence 4B corresponding to substitution 4ax; or,
[0020] (5) Amino acid sequence 5C, which is a mutation of amino acid sequence 5A shown in SEQ ID NO: 5 or amino acid sequence 5B having more than 80% identity with amino acid sequence 5A, comprising mutation 5a: substitution 5ax of amino acid L178 in amino acid sequence 5A or substitution 5ay in amino acid sequence 5B corresponding to substitution 5ax.
[0021] Item 1A. Use of olfactory receptor protein as a nitro compound detection element, said olfactory receptor protein comprising:
[0022] (1) Amino acid sequence 1C, which is a mutation of amino acid sequence 1A shown in SEQ ID NO: 1 or amino acid sequence 1B having more than 80% identity with said amino acid sequence 1A, and includes mutation 1a: deletion of part or all of the region of the first extracellular loop;
[0023] (2) Amino acid sequence 2C, which is a mutation of amino acid sequence 2A shown in SEQ ID NO: 2 or amino acid sequence 2B having more than 80% identity with amino acid sequence 2A, comprising mutation 2a: substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A or substitution 2ay in amino acid sequence 2B corresponding to substitution 2ax;
[0024] (3) Amino acid sequence 3C, which is a mutation of amino acid sequence 3A shown in SEQ ID NO: 3 or amino acid sequence 3B having more than 80% identity with amino acid sequence 3A, comprising mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352 and S368 in amino acid sequence 3A or substitution 3ay of the amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids to non-charged amino acids in the region from the third outer loop to the third inner loop;
[0025] (4) Amino acid sequence 4C, which is a mutation of amino acid sequence 4A shown in SEQ ID NO: 4 or amino acid sequence 4B having more than 80% identity with amino acid sequence 4A, comprising mutation 4a: substitution 4ax in amino acid sequence 4A consisting of amino acid group consisting of M61, C104, R112, G181, V189 and I327 or substitution 4ay in amino acid sequence 4B corresponding to substitution 4ax; or,
[0026] (5) Amino acid sequence 5C, which is a mutation of amino acid sequence 5A shown in SEQ ID NO: 5 or amino acid sequence 5B having more than 80% identity with amino acid sequence 5A, comprising mutation 5a: substitution 5ax of amino acid L178 in amino acid sequence 5A or substitution 5ay in amino acid sequence 5B corresponding to substitution 5ax.
[0027] Item 1B. Use of an olfactory receptor protein in the manufacture of a nitro compound detection element, said olfactory receptor protein comprising:
[0028] (1) Amino acid sequence 1C, which is a mutation of amino acid sequence 1A shown in SEQ ID NO: 1 or amino acid sequence 1B having more than 80% identity with said amino acid sequence 1A, and includes mutation 1a: deletion of part or all of the region of the first extracellular loop;
[0029] (2) Amino acid sequence 2C, which is a mutation of amino acid sequence 2A shown in SEQ ID NO: 2 or amino acid sequence 2B having more than 80% identity with amino acid sequence 2A, comprising mutation 2a: substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A or substitution 2ay in amino acid sequence 2B corresponding to substitution 2ax;
[0030] (3) Amino acid sequence 3C, which is a mutation of amino acid sequence 3A shown in SEQ ID NO: 3 or amino acid sequence 3B having more than 80% identity with amino acid sequence 3A, comprising mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352 and S368 in amino acid sequence 3A or substitution 3ay of the amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids to non-charged amino acids in the region from the third outer loop to the third inner loop;
[0031] (4) Amino acid sequence 4C, which is a mutation of amino acid sequence 4A shown in SEQ ID NO: 4 or amino acid sequence 4B having more than 80% identity with amino acid sequence 4A, comprising mutation 4a: substitution 4ax in amino acid sequence 4A consisting of amino acid group consisting of M61, C104, R112, G181, V189 and I327 or substitution 4ay in amino acid sequence 4B corresponding to substitution 4ax; or,
[0032] (5) Amino acid sequence 5C, which is a mutation of amino acid sequence 5A shown in SEQ ID NO: 5 or amino acid sequence 5B having more than 80% identity with amino acid sequence 5A, comprising mutation 5a: substitution 5ax of amino acid L178 in amino acid sequence 5A or substitution 5ay in amino acid sequence 5B corresponding to substitution 5ax.
[0033] Item 2. The nitro compound detection element according to Item 1, wherein,
[0034] The deletion region in mutation 1a is a region of 5 to 30 amino acids starting from the N-terminal amino acid.
[0035] In mutation 2a, the mutated amino acid of L60 is proline, the mutated amino acid of M138 is a branched-chain amino acid, and / or the mutated amino acid of A152 is a hydrophilic neutral amino acid.
[0036] In mutation 3a, the mutated amino acid of S114 is an aliphatic amino acid, the mutated amino acid of A120 is an acidic amino acid, the mutated amino acid of H162 is an aromatic amino acid, the mutated amino acid of V186 is an aliphatic amino acid, the mutated amino acid of V352 is a sulfur-containing amino acid, and the mutated amino acid of S368 is proline.
[0037] The number of substitutions to non-charged amino acids in mutation 3b is 6 to 18;
[0038] In the mutation 4a, the mutated amino acid of M61 is a hydrophilic neutral amino acid, the mutated amino acid of C104 is a basic amino acid, the mutated amino acid of R112 is a hydrophilic neutral amino acid, the mutated amino acid of G181 is an aliphatic amino acid, the mutated amino acid of V189 is a branched-chain amino acid, and the mutated amino acid of I327 is a branched-chain amino acid.
[0039] The mutated amino acid of L178 in mutation 5a is proline.
[0040] Item 3. The nitro compound detection element according to Item 1 or Item 2, wherein,
[0041] The deletion region in mutation 1a is a region of 15 to 25 amino acids starting from the N-terminal amino acid.
[0042] In mutation 2a, the mutated amino acid of L60 is proline, the mutated amino acid of M138 is isoleucine, and / or the mutated amino acid of A152 is threonine; in mutation 3a, the mutated amino acid of S114 is alanine, the mutated amino acid of A120 is glutamic acid, the mutated amino acid of H162 is tyrosine, the mutated amino acid of V186 is alanine, the mutated amino acid of V352 is methionine, and the mutated amino acid of S368 is proline.
[0043] The number of substitutions to non-charged amino acids in mutation 3b is 8 to 14;
[0044] The mutated amino acid of M61 in mutation 4a is threonine, the mutated amino acid of C104 is arginine, the mutated amino acid of R112 is glutamine, the mutated amino acid of G181 is alanine, the mutated amino acid of V189 is isoleucine, and the mutated amino acid of I327 is valine.
[0045] The mutated amino acid of L178 in mutation 5a is proline.
[0046] Item 4. The nitro compound detection element according to any one of items 1 to 3, wherein the nitro compound is a compound containing a structure in which a nitro group is directly attached to a benzene ring, and / or a compound containing two or more nitro groups.
[0047] Item 5. The nitro compound detection element according to any one of items 1 to 4, wherein the olfactory receptor protein contains the general formula (1) of the corresponding wild-type olfactory receptor protein:
[0048] φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6
[0049] The amino acid sequence B, which is the result of a mutation in amino acid sequence A, is shown below.
[0050] In general formula (1), X1~X6 and Z1~Z3 represent amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ1 represents hydrophobic amino acids, φ2~φ7 each independently represent non-polar amino acids or hydrophobic amino acids, and U represents non-polar amino acids.
[0051] It satisfies at least one of the following conditions: 1 to 3.
[0052] Condition 1: In the amino acid sequence B, X3 and / or X4 are substituted, where X3 is a branched-chain amino acid and / or X4 is a non-polar amino acid.
[0053] Condition 2: If X5 and X6 in amino acid sequence A are both positively charged polar amino acids, then X6 in amino acid sequence B is an amino acid other than a positively charged polar amino acid; and,
[0054] Condition 3: If one or both of X1 and X2 in amino acid sequence A are positively charged polar amino acids, then X1 and / or X2 in amino acid sequence B are substituted, where X1 is a non-polar amino acid and / or X2 is a hydrophobic amino acid.
[0055] Item 6. An olfactory receptor protein, comprising:
[0056] (1) Amino acid sequence 1C, which is a mutation of amino acid sequence 1A shown in SEQ ID NO: 1 or amino acid sequence 1B having more than 80% identity with said amino acid sequence 1A, and includes mutation 1a: deletion of part or all of the region of the first extracellular loop;
[0057] (2) Amino acid sequence 2C, which is a mutation of amino acid sequence 2A shown in SEQ ID NO: 2 or amino acid sequence 2B having more than 80% identity with amino acid sequence 2A, comprising mutation 2a: substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A or substitution 2ay in amino acid sequence 2B corresponding to substitution 2ax;
[0058] (3) Amino acid sequence 3C, which is a mutation of amino acid sequence 3A shown in SEQ ID NO: 3 or amino acid sequence 3B having more than 80% identity with said amino acid sequence 3A, comprising mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352 and S368 in said amino acid sequence 3A or substitution 3ay of said amino acid sequence 3B corresponding to said substitution 3ax, and mutation 3b: substitution of charged amino acids to non-charged amino acids in the region from the third outer loop to the third inner loop; or,
[0059] (4) Amino acid sequence 4C, which is a mutation of amino acid sequence 4A shown in SEQ ID NO: 4 or amino acid sequence 4B having more than 80% identity with amino acid sequence 4A, and includes mutation 4a: substitution 4ax of amino acid group consisting of M61, C104, R112, G181, V189 and I327 in amino acid sequence 4A or substitution 4ay of amino acid sequence 4B corresponding to substitution 4ax.
[0060] Item 7. A polynucleotide containing the coding sequence of the olfactory receptor protein described in Item 6.
[0061] Item 8. A cell containing the polynucleotide described in item 7.
[0062] Item 9. A non-human animal containing the cells described in item 8.
[0063] Item 10. A nitro compound detection sensor comprising: a lipid bilayer membrane containing a nitro compound detection element as described in any one of items 1 to 5, a cell, or a non-human animal containing said cell.
[0064] Item 10A. Use of a lipid bilayer membrane, cell, or non-human animal containing any of the nitro compound detection elements described in any one of items 1 to 5 as a nitro compound detection sensor.
[0065] Item 10B. Use of a lipid bilayer membrane, cell, or non-human animal containing any of the nitro compound detection elements described in any of items 1 to 5 for the manufacture of a nitro compound detection sensor.
[0066] Item 11. A method for detecting nitro compounds, comprising: contacting the nitro compound detection element of any one of items 1 to 5 or the nitro compound detection sensor of item 10 with a nitro compound.
[0067] The effects of the invention
[0068] According to the present invention, a detection technology for nitro compounds can be provided. Attached Figure Description
[0069] Figure 1 The results show the determination of the nitro compound (2,3-dinitrotoluene, 2,6-dinitrotoluene) response activity of Anopheles olfactory receptor 28 and its mutants (Example 1). The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium. The area above the curve represents the olfactory receptor used (WT represents wild type, others represent mutant sites).
[0070] Figure 2 The results of the determination of the nitro compound (4-amino-2,6-dinitrotoluene) response activity of Anopheles olfactory receptor 47 and its mutants are shown in Example 2. The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium (see legend). The olfactory receptor used is indicated above the curve (WT represents wild type, others represent mutant sites).
[0071] Figure 3The results show the determination of the nitro compound (4-amino-2,6-dinitrotoluene) response activity of Anopheles mosquito olfactory receptor 47 and its mutants (Example 2). The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium (see illustration). The mutation site of the olfactory receptor used is indicated above the curve.
[0072] Figure 4 The results of the determination of the response activity of nitro compounds (3-trifluoromethyl-4-nitrophenol, 2,3-dinitrotoluene, 2,4-dinitrotoluene, or 2,6-dinitrotoluene) to the olfactory receptor 47 and its mutants in Anopheles mosquitoes (Example 2). The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium. The area above the curve represents the olfactory receptor used (wild type or 7-fold mutant (Example 12)).
[0073] Figure 5 The results of the determination of the response activity of nitro compounds (3-nitrotoluene, 4-nitrotoluene, or toluene) to the olfactory receptor 47 and its mutants in Anopheles mosquitoes are shown in Example 2. The vertical axis represents the fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium. The area above the curve represents the olfactory receptor used (wild type or 7-fold mutant (Example 12)).
[0074] Figure 6 The results show the determination of the nitro compound (2,3-dimethyl-2,3-dinitrobutane) response activity of Anopheles olfactory receptor 47 and its mutants (Example 2). The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium (DMSO represents 0 μM). The olfactory receptor used is indicated above the curve (WT represents wild type, others represent mutant sites).
[0075] Figure 7 The results of the determination of the nitro compound (2-nitroaniline) response activity of Anopheles mosquito olfactory receptor 6 and its mutants are shown in Example 3. The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium (DMSO represents 0 μM). The olfactory receptor used (wild type, mutant) is indicated above the curve.
[0076] Figure 8 The results of the determination of the nitro compound (2-nitroaniline) response activity of Anopheles mosquito olfactory receptor 15 and its mutants are shown in Example 4. The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium (DMSO represents 0 μM). The olfactory receptor used (wild type, mutant) is indicated above the curve.
[0077] Figure 9The results of the assay for the response activity of nitro compounds (2,4-dinitrotoluene, 4-nitrotoluene) to the olfactory receptor 4 in Aedes mosquitoes (Example 5) are shown. The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium. The olfactory receptor used is indicated above the curve.
[0078] Figure 10 The results of the determination of the nitro compound (3-nitrotoluene) response activity of Anopheles mosquito olfactory receptor 28 and mouse olfactory receptor Olfr256_17 are presented (Example 6). The vertical axis represents fluorescence intensity (= activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium.
[0079] Figure 11 The results of the determination of the responsiveness of nitro compounds (2,3-dinitrotoluene) to the 7th transmembrane region of the Anopheles olfactory receptor 28 (Example 7) are shown. The vertical axis represents fluorescence intensity (=activity intensity), and the horizontal axis represents the concentration of the test substance in the culture medium (DMSO represents 0 μM). Detailed Implementation
[0080] I. Definitions, etc.
[0081] In this specification, the expressions “containing” and “comprising” include the concepts of “containing”, “comprising”, “substantially composed of” and “composed of only”.
[0082] In this specification, the “identity” of an amino acid sequence refers to the degree of consistency between corresponding amino acid sequences of two or more comparable amino acid sequences. Therefore, the higher the consistency between two amino acid sequences, the higher their sequence identity or similarity. The level of amino acid sequence identity can be determined, for example, using FASTA, a tool for sequence analysis, with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. “Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes” Proc Natl Acad Sci USA. 87: 2264-2268 (1990), Karlin S, Altschul SF. “Applications and statistics for multiple high-scoring segments in molecular sequences.” Proc Natl Acad Sci USA. 90: 5873-7 (1993)). A program called BLASTX has been developed based on such a BLAST algorithm. The specific methods used to resolve these sequences are well-known and can be found on the website of the National Center of Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, the "identity" of the base sequence can also be defined according to the above. In this specification, "conservative substitution" refers to the substitution of an amino acid residue by an amino acid residue with a similar side chain. For example, substitutions between amino acid residues with basic side chains, such as lysine, arginine, and histidine, are considered conservative substitutions. In addition, substitutions between amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; substitutions between amino acid residues with non-charged polar side chains, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; substitutions between amino acid residues with non-polar side chains, such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; substitutions between amino acid residues with β-branched side chains, such as threonine, valine, and isoleucine; and substitutions between amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, tryptophan, and histidine, are also considered conservative substitutions.
[0083] In this specification, known chemical modifications can be applied to nucleotides such as DNA and RNA, as listed below. To prevent degradation by hydrolases such as nucleases, the phosphate residues (phosphate esters) of each nucleotide can be replaced with chemically modified phosphate residues such as thiophosphate (PS), methylphosphonate, or dithiophosphate. Furthermore, the hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide can be replaced with -OR (R represents, for example, CH3(2'-O-Me), CH2CH2OCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, chemical modifications can be applied to the base moiety (pyrimidine, purine), for example, by introducing a methyl group or cationic functional group at the 5-position of the pyrimidine base, or by replacing the carbonyl group at the 2-position with a thiocarbonyl group. Furthermore, modifications such as biotin, amino, lower alkylamine, or acetyl groups can be applied to the phosphate and hydroxyl moieties, but are not limited to these. Alternatively, it is preferable to use BNA (LNA) with the 2' oxygen and 4' carbon of the sugar portion of the cross-linked nucleotide to fix the conformation of the sugar portion to the N-type.
[0084] Olfactory receptor proteins are membrane proteins with a seven-terminal transmembrane structure. From their amino-terminus (hereinafter sometimes referred to as the "N-terminus") to their carboxyl-terminus (hereinafter sometimes referred to as the "C-terminus"), the following are connected in sequence: N-terminal region (NT), first transmembrane domain (TM1), first extracellular loop (EC1), second transmembrane domain (TM2), first intracellular loop (IC1), third transmembrane domain (TM3), second extracellular loop (EC2), fourth transmembrane domain (TM4), second intracellular loop (IC2), fifth transmembrane domain (TM5), third extracellular loop (EC3), sixth transmembrane domain (TM6), third intracellular loop (IC3), seventh transmembrane domain (TM7), and C-terminal region (CT). In this disclosure, each region was determined using structural predictions (with default conditions) from TMpred (K. Hofmann, W. Stoffel, TMbase - a database of membrane spanning protein segments, Biol. Chem. Hoppe-Seyler, 374 (1993), p. 166, https: / / embnet.vital-it.ch / software / TMPRED_form.html).
[0085] In this specification, amino acid mutations specifically refer to the deletion, substitution, insertion, or addition of amino acids. Olfactory receptor proteins may lack amino acids that have a minimal impact on their chemical response activity; for example, olfactory receptor peptides may lack a subset of amino acids outside the transmembrane region.
[0086] In this specification, the position of an amino acid in an amino acid sequence is sometimes indicated by the amino acid position alphanumeric symbol followed by the amino acid number from the N-terminus. For example, "A153" indicates that the 153rd amino acid from the N-terminus is alanine.
[0087] In this specification, nitro compound responsiveness refers to the property that an olfactory receptor recognizes a nitro compound, and the olfactory receptor complex formed by the olfactory receptor and its co-receptor is activated, exhibiting ion channel activity. The nitro compound responsiveness of an olfactory receptor can be measured as an indicator of the ion channel activity of the olfactory receptor complex formed by the olfactory receptor and its co-receptor in contact with the nitro compound. For example, cells expressing (a) an olfactory receptor, (b) an olfactory receptor co-receptor, and (c) proteins that exhibit color or luminescence upon intracellular influx of ions (such as calcium ions) in response to an olfactory receptor are contacted with a nitro compound, and the amount of luminescence in the cell is measured. The higher the measured amount of luminescence, the higher the nitro compound responsiveness of the olfactory receptor. Specific examples of measuring nitro compound responsiveness are described in Experimental Examples 1-2 and 1-3 described later.
[0088] 2. Olfactory receptor proteins
[0089] One embodiment of this disclosure relates to an olfactory receptor protein (which, in this specification, is sometimes referred to as "the olfactory receptor protein of this disclosure"), comprising:
[0090] (1) Amino acid sequence 1C, which is a mutation of amino acid sequence 1A shown in SEQ ID NO: 1 or amino acid sequence 1B having more than 80% identity with said amino acid sequence 1A, and includes mutation 1a: deletion of part or all of the region of the first extracellular loop;
[0091] (2) Amino acid sequence 2C, which is a mutation of amino acid sequence 2A shown in SEQ ID NO: 2 or amino acid sequence 2B having more than 80% identity with amino acid sequence 2A, comprising mutation 2a: substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A or substitution 2ay in amino acid sequence 2B corresponding to substitution 2ax;
[0092] (3) Amino acid sequence 3C, which is a mutation of amino acid sequence 3A shown in SEQ ID NO: 3 or amino acid sequence 3B having more than 80% identity with amino acid sequence 3A, comprising mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352 and S368 in amino acid sequence 3A or substitution 3ay of the amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids to non-charged amino acids in the region from the third outer loop to the third inner loop;
[0093] (4) Amino acid sequence 4C, which is a mutation of amino acid sequence 4A shown in SEQ ID NO: 4 or amino acid sequence 4B having more than 80% identity with amino acid sequence 4A, comprising mutation 4a: substitution 4ax in amino acid sequence 4A consisting of amino acid group consisting of M61, C104, R112, G181, V189 and I327 or substitution 4ay in amino acid sequence 4B corresponding to substitution 4ax; or,
[0094] (5) Amino acid sequence 5C, which is a mutation of amino acid sequence 5A shown in SEQ ID NO: 5 or amino acid sequence 5B having more than 80% identity with amino acid sequence 5A, comprising mutation 5a: substitution 5ax of amino acid L178 in amino acid sequence 5A or substitution 5ay in amino acid sequence 5B corresponding to substitution 5ax.
[0095] The following is an explanation of it.
[0096] 2-1. Amino acid sequence 1C
[0097] There are no particular limitations as long as the amino acid sequence 1C is a sequence derived from the amino acid sequence 1A shown in SEQ ID NO: 1 or a sequence derived from the amino acid sequence 1B which has more than 80% identity with the amino acid sequence 1A, including mutation 1a: deletion of part or all of the region of the first extracellular loop.
[0098] The amino acid sequence 1A is the amino acid sequence of olfactory receptor 28, which is endogenously expressed (intrinsic) in Anopheles gambiae mosquitoes.
[0099] There are no particular limitations as long as the nitro compound responsiveness of the protein (protein 1B) composed of a sequence formed by introducing mutation 1a into that sequence is not significantly lower than that of the protein (protein 1A) composed of a sequence formed by introducing mutation 1a into amino acid sequence 1A. The nitro compound responsiveness of protein 1B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, further preferably 80% or more, and even more preferably 90% or more, relative to the 100% nitro compound responsiveness of protein 1A. From this viewpoint, the identity of amino acid sequence 1B with respect to amino acid sequence 1A is preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%.
[0100] The amino acid sequence 1B is preferably the amino acid sequence described below (1B'):
[0101] (1B') An amino acid sequence 1B' with one or more amino acid mutations relative to amino acid sequence 1A.
[0102] In the amino acid sequence 1B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.
[0103] Amino acid mutations in amino acid sequence 1B relative to amino acid sequence 1A can include, for example, substitution, deletion, addition, insertion, etc., with substitution being preferred, and conservative substitution being more preferred.
[0104] The amino acid sequence 1B is preferably derived from the amino acid sequence of the olfactory receptor of the insect. It should be noted that "derived from" means that it is endogenously expressed (inherent) by the organism. Among the insects, insects of the order *Entoptera* are preferred; more preferably, insects of the order *Diptera* such as mosquitoes and fruit flies; insects of the order *Lepidoptera* such as silkworm moths; insects of the order *Hymenoptera* such as bees; even more preferably, insects of the order *Diptera* such as mosquitoes and fruit flies; and even more preferably, insects of the family *Mosquitoes*. Examples of mosquitoes include, for example, *Anopheles gambiae*, *Aedes aegyptii*, and *Culex quinquefasciatus*. Examples of fruit flies include, for example, *Drosophila melanogaster*, *Drosophila pseudoobscura*, and *Drosophila virillis*. Examples of insects belonging to the Bombyx family (Silkworm) include the domestic silkworm (Bombyx mori), the wild silkworm (Bombyx mandarina), and the trilobite moth (Trilocha varians). Examples of insects belonging to the Apidae family (Apis mellifera), the honeybee (Apis florea), the giant honeybee (Apis dorsata), and the European bumblebee (Bombus terrestris).
[0105] Mutation 1a is a deletion of part or all of the first extracellular loop. The first extracellular loop is a 30-amino acid region in amino acid sequence 1A, from amino acid number 55 to amino acid number 84 from the N-terminus. Mutation 1a is more preferably a region of 5 to 30 amino acids in the first extracellular loop, starting from the N-terminal amino acid; more preferably a region of 10 to 25 amino acids, starting from the N-terminal amino acid; and even more preferably a region of 15 to 25 amino acids, starting from the N-terminal amino acid.
[0106] In mutation 1a, a further preferred deletion is a portion of the region adjacent to the N-terminal side of the first extracellular loop, i.e., the C-terminal side of the first transmembrane domain. For example, a deletion of 1 to 5 amino acids containing the C-terminal amino acid of the first transmembrane domain is preferred.
[0107] The amino acid sequence 1C preferably further includes mutation 1b: substitution 1bx of at least one amino acid selected from the group consisting of T25 and P31 in amino acid sequence 1A or substitution 1by corresponding to substitution 1bx in amino acid sequence 1B.
[0108] It should be noted that "the substitution corresponding to ~" refers to the substitution at the same position in the aligned sequence when comparing two sequences using BLAST (the default setting). For example, the substitution corresponding to T25 in amino acid sequence 1A means that in the aligned sequence obtained by comparing amino acid sequence 1A and amino acid sequence 1B, the amino acid at the same position as T25 in amino acid sequence 1A is substituted. Furthermore, the substituted amino acid in amino acid sequence 1A is the same as the substituted amino acid in amino acid sequence 1B.
[0109] The T25 in mutation 1b, or the mutated amino acid corresponding to it, is preferably a basic amino acid. Examples of basic amino acids include lysine, arginine, and histidine, with lysine being particularly preferred.
[0110] The P31 in mutation 1b, or the mutated amino acid corresponding to it, is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with threonine being particularly preferred.
[0111] Provided it does not significantly impair the responsiveness to nitro compounds, amino acid sequence 1C may contain other amino acid mutations (e.g., substitutions, conserved substitutions). As an example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the 7th transmembrane region. The number of other amino acid mutations may be, for example, 1–50, 1–20, 1–10, or 1–5.
[0112] Specifically, examples of amino acid sequences 1C include, for example, the amino acid sequences shown in SEQ ID NO: 21, 25, 27, or 29, or amino acid sequences that have 80% or more (preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, especially preferably 99% or more, and less than 100%) identity with such amino acid sequences.
[0113] 2-2. Amino acid sequence 2C
[0114] There are no particular limitations on the amino acid sequence 2C as long as it is a mutation of the amino acid sequence 2A shown in SEQ ID NO: 2 or the amino acid sequence 2B that has more than 80% identity with the amino acid sequence 2A, including mutation 2a: substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in the amino acid sequence 2A or substitution 2ay in the amino acid sequence 2B corresponding to the substitution 2ax.
[0115] Amino acid sequence 2A is the amino acid sequence of olfactory receptor 47, which is endogenously expressed (intrinsic) in Anopheles gambiae mosquitoes.
[0116] There are no particular limitations as long as the nitro compound responsiveness of the protein (protein 2B) composed of a sequence formed by introducing mutation 2a into that sequence is not significantly lower than that of the protein (protein 2A) composed of a sequence formed by introducing mutation 2a into amino acid sequence 2A. The nitro compound responsiveness of protein 2B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, further preferably 80% or more, and even more preferably 90% or more, relative to 100% of the nitro compound responsiveness of protein 2A. From this viewpoint, the identity of amino acid sequence 2B with respect to amino acid sequence 2A is preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%.
[0117] The amino acid sequence 2B is preferably the amino acid sequence described in (2B') below:
[0118] (2B') An amino acid sequence 2B' with one or more amino acid mutations relative to amino acid sequence 2A.
[0119] In the amino acid sequence 2B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.
[0120] Amino acid mutations in amino acid sequence 2B relative to amino acid sequence 2A can include, for example, substitution, deletion, addition, insertion, etc., with substitution being preferred, and conservative substitution being more preferred.
[0121] The amino acid sequence 2B is preferably an amino acid sequence derived from an insect olfactory receptor. The definition of an insect-derived olfactory receptor is the same as that in "2-1. Amino acid sequence 1C" above.
[0122] Mutation 2a is a substitution 2ax in amino acid sequence 2A, selected from the group consisting of L60, M138, and A152, or a substitution 2ay in amino acid sequence 2B corresponding to substitution 2ax. The definition of "substitution corresponding to ~" is the same as in "2-1. Amino Acid Sequence 1C" above.
[0123] The L60 in mutation 2a, or the mutated amino acid corresponding to it, is preferably proline.
[0124] The M138 in mutation 2a, or the mutated amino acid corresponding to it, is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with isoleucine being particularly preferred.
[0125] The A152 in mutation 2a, or the mutated amino acid corresponding to it, is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with threonine being particularly preferred.
[0126] Mutation 2a preferably contains at least one of M138 and A152 or its corresponding amino acid substitution, more preferably contains both of them or their corresponding amino acid substitution.
[0127] The amino acid sequence 2C preferably further includes mutation 2b: substitution 2bx of at least one amino acid selected from the group consisting of D5, L71, I134, S140, F147, K235 and N241 in amino acid sequence 2A or substitution 2by corresponding to substitution 2bx in amino acid sequence 2B.
[0128] The D5 in mutation 2b, or the mutated amino acid corresponding to it, is preferably an acidic amino acid. Examples of acidic amino acids include aspartic acid and glutamic acid, with glutamic acid being particularly preferred.
[0129] The L71 in mutation 2b, or the mutated amino acid corresponding to it, is preferably an aromatic amino acid. Examples of aromatic amino acids include phenylalanine, tyrosine, and tryptophan, with phenylalanine being particularly preferred.
[0130] The I134 in mutation 2b, or the mutated amino acid corresponding to it, is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with valine being particularly preferred.
[0131] The S140 in mutation 2b, or the mutated amino acid corresponding to it, is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with glycine being particularly preferred.
[0132] The F147 in mutation 2b, or the mutated amino acid corresponding to it, is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with leucine being particularly preferred.
[0133] The K235 in mutation 2b, or the mutated amino acid corresponding to it, is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with glutamine being particularly preferred.
[0134] The N241 in mutation 2b, or the mutated amino acid corresponding to it, is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with serine being particularly preferred.
[0135] Mutation 2b preferably contains a substitution of L71F or its corresponding amino acid substitution, more preferably contains a substitution of L71F and I134 or its corresponding amino acid substitution, further preferably contains a substitution of L71F, I134 and S140 or its corresponding amino acid substitution, and even more preferably contains a substitution of L71F, I134, S140 and F147 or its corresponding amino acid substitution.
[0136] Provided that the responsiveness to nitro compounds is not significantly impaired, amino acid sequence 2C may contain other amino acid mutations (e.g., substitutions, conserved substitutions). As an example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the 7th transmembrane region. The number of other amino acid mutations may be, for example, 1–50, 1–20, 1–10, or 1–5.
[0137] Specifically, examples of amino acid sequences 2C include, for example, the amino acid sequences shown in SEQ ID NO: 63, 67, 71, 73, 75, 77, or 79, or amino acid sequences that have 80% or more (preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, especially preferably 99% or more, and less than 100%) identity with such amino acid sequences.
[0138] 2-3. Amino acid sequence 3C
[0139] The amino acid sequence 3C is not particularly limited as long as it is a mutation of the amino acid sequence 3A shown in SEQ ID NO: 3 or an amino acid sequence 3B that has more than 80% identity with the amino acid sequence 3A, including mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352 and S368 in the amino acid sequence 3A or substitution 3ay of the amino acid sequence 3B corresponding to the substitution 3ax, and mutation 3b: substitution of charged amino acids to non-charged amino acids in the region from the third outer loop to the third inner loop.
[0140] The amino acid sequence 3A is the amino acid sequence of the olfactory receptor 6, which is endogenously expressed (intrinsic) in Anopheles gambiae mosquitoes.
[0141] There are no particular limitations as long as the nitro compound responsiveness of the protein (protein 3B) composed of a sequence formed by introducing mutations 3a and 3b into that sequence is not significantly lower than that of the protein (protein 3A) composed of a sequence formed by introducing mutations 3a and 3b into the amino acid sequence 3A. The nitro compound responsiveness of protein 3B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, further preferably 80% or more, and even more preferably 90% or more, relative to 100% of the nitro compound responsiveness of protein 3A. From this viewpoint, the identity of amino acid sequence 3B with respect to amino acid sequence 3A is preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%.
[0142] The amino acid sequence 3B is preferably the amino acid sequence described in (3B') below:
[0143] (3B') An amino acid sequence 3B' with one or more amino acid mutations relative to amino acid sequence 3A.
[0144] In the amino acid sequence 3B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, further preferably 2 to 3, and even more preferably 2.
[0145] Amino acid mutations in amino acid sequence 3B relative to amino acid sequence 3A can include, for example, substitution, deletion, addition, insertion, etc., with substitution being preferred, and conservative substitution being more preferred.
[0146] The amino acid sequence 3B is preferably derived from an olfactory receptor from insects. The definition of an olfactory receptor derived from insects is the same as that in "2-1. Amino acid sequence 1C" above.
[0147] Mutation 3a is substitution 3ax in amino acid sequence 3A consisting of amino acid groups S114, A120, H162, V186, V352, and S368, or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax. The definition of "substitution corresponding to ~" is the same as in "2-1. Amino Acid Sequence 1C" above.
[0148] The S114 in mutation 3a, or the mutated amino acid corresponding to it, is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with alanine being particularly preferred.
[0149] The A120 in mutation 3a, or the mutated amino acid corresponding to it, is preferably an acidic amino acid. Examples of acidic amino acids include aspartic acid and glutamic acid, with glutamic acid being particularly preferred.
[0150] The H162 in mutation 3a, or the mutated amino acid corresponding to it, is preferably an aromatic amino acid. Examples of aromatic amino acids include phenylalanine, tyrosine, and tryptophan, with tyrosine being particularly preferred.
[0151] The V186 in mutation 3a, or the mutated amino acid corresponding to it, is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with alanine being particularly preferred.
[0152] The V352 in mutation 3a, or the mutated amino acid corresponding to it, is preferably a sulfur-containing amino acid. Examples of sulfur-containing amino acids include methionine and cysteine, with methionine being particularly preferred.
[0153] The preferred amino acid for mutation 3a is proline, which is S368 or the mutated amino acid corresponding to it.
[0154] Mutation 3b is a substitution of charged amino acids for non-charged amino acids in the region from the third extracellular loop to the third intracellular loop (i.e., the region composed of the third extracellular loop, the sixth transmembrane domain, and the third intracellular loop). The third extracellular loop is the region of 69 amino acids in amino acid sequence 3A, from amino acid 211 to amino acid 279 counting from the N-terminus. The sixth transmembrane domain is the region of 23 amino acids in amino acid sequence 3A, from amino acid 280 to amino acid 302 counting from the N-terminus. The third intracellular loop is the region of 76 amino acids in amino acid sequence 3A, from amino acid 303 to amino acid 378 counting from the N-terminus.
[0155] The charged amino acids are acidic and basic amino acids, specifically lysine, arginine, histidine, aspartic acid, and glutamic acid. In mutation 3b, some or all of the charged amino acids are replaced with non-charged amino acids. There are no particular limitations on the non-charged amino acids, as long as they are not charged. The number of non-charged amino acids replaced is usually multiple, for example, 5 to 25 or more, preferably 6 to 18, and more preferably 8 to 14.
[0156] Provided that the responsiveness to nitro compounds is not significantly impaired, the amino acid sequence 3C can contain other amino acid mutations (e.g., substitutions, conserved substitutions). As an example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the 7th transmembrane region. The number of other amino acid mutations can be, for example, 1–60, 1–20, 1–10, or 1–5.
[0157] Specifically, examples of amino acid sequences 3C include, for instance, the amino acid sequence shown in SEQ ID NO: 81, or an amino acid sequence that has 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, especially preferably 99% or more, and less than 100%) the sameness as the amino acid sequence.
[0158] 2-4. Amino acid sequence 4C
[0159] There are no particular limitations on the amino acid sequence 4C as long as it is a mutation of the amino acid sequence 4A shown in SEQ ID NO: 4 or the amino acid sequence 4B that has more than 80% identity with the amino acid sequence 4A, including mutation 4a: substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189 and I327 in the amino acid sequence 4A or substitution 4ay of the amino acid sequence 4B corresponding to substitution 4ax.
[0160] Amino acid sequence 4A is the amino acid sequence of olfactory receptor 15, which is endogenously expressed (intrinsic) in Anopheles gambiae mosquitoes.
[0161] There are no particular limitations as long as the nitro compound responsiveness of the protein (protein 4B) composed of a sequence formed by introducing mutation 4a into the amino acid sequence 4B is not significantly lower than that of the protein (protein 4A) composed of a sequence formed by introducing mutation 4a into the amino acid sequence 4A. The nitro compound responsiveness of protein 4B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, further preferably 80% or more, and even more preferably 90% or more, relative to 100% of the nitro compound responsiveness of protein 4A. From this viewpoint, the identity of amino acid sequence 4B with respect to amino acid sequence 4A is preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%.
[0162] The amino acid sequence 4B is preferably the amino acid sequence described below (4B'):
[0163] (4B') An amino acid sequence 4B' with one or more amino acid mutations relative to amino acid sequence 4A.
[0164] In the amino acid sequence 4B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, further preferably 2 to 3, and even more preferably 2.
[0165] Amino acid mutations in amino acid sequence 4B relative to amino acid sequence 4A can include, for example, substitution, deletion, addition, and insertion. Substitution is preferred, and conservative substitution is even more preferred.
[0166] The amino acid sequence 4B is preferably derived from an olfactory receptor from an insect. The definition of an olfactory receptor derived from an insect is the same as that in "2-1. Amino acid sequence 1C" above.
[0167] Mutation 4a is substitution 4ax in amino acid sequence 4A consisting of amino acid groups M61, C104, R112, G181, V189, and I327, or substitution 4ay in amino acid sequence 4B corresponding to substitution 4ax. The definition of "substitution corresponding to ~" is the same as in "2-1. Amino Acid Sequence 1C" above.
[0168] The M61 in mutation 4a, or the mutated amino acid corresponding to it, is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with threonine being particularly preferred.
[0169] The C104 in mutation 4a, or the mutated amino acid corresponding to it, is preferably a basic amino acid. Examples of basic amino acids include lysine, arginine, and histidine, with arginine being particularly preferred.
[0170] The amino acid resulting from the mutation of R112 in mutation 4a, or the amino acid corresponding to it, is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with glutamine being particularly preferred.
[0171] The G181 in mutation 4a, or the mutated amino acid corresponding to it, is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with alanine being particularly preferred.
[0172] The V189 in mutation 4a, or the mutated amino acid corresponding to it, is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with isoleucine being particularly preferred.
[0173] The mutated amino acid of I327 in mutation 4a or its corresponding amino acid is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with valine being particularly preferred.
[0174] Provided that the responsiveness to nitro compounds is not significantly impaired, the amino acid sequence 4C can contain other amino acid mutations (e.g., substitutions, conserved substitutions). As an example, the responsiveness to nitro compounds can be further enhanced by introducing specific mutations in the 7th transmembrane region. The number of other amino acid mutations can be, for example, 1–50, 1–20, 1–10, or 1–5.
[0175] As an amino acid sequence 4C, specific examples include, for example, the amino acid sequence shown in SEQ ID NO: 83, or an amino acid sequence that has 80% or more (preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, especially preferably 99% or more, and less than 100%) the sameness as that amino acid sequence.
[0176] 2-5. Amino acid sequence 5C
[0177] There are no particular limitations on the amino acid sequence 5C as long as it is a mutation of the amino acid sequence 5A shown in SEQ ID NO: 5 or the amino acid sequence 5B that has more than 80% identity with the amino acid sequence 5A, including mutation 5a: substitution 5ax of amino acid L178 in the amino acid sequence 5A or substitution 5ay in the amino acid sequence 5B corresponding to the substitution 5ax.
[0178] The amino acid sequence 5A is the amino acid sequence of the olfactory receptor 4, which is endogenously expressed (intrinsic) in Aedes aegypti mosquitoes.
[0179] There are no particular limitations as long as the nitro compound responsiveness of the protein (protein 5B) composed of a sequence formed by introducing mutation 5a into the amino acid sequence 5B is not significantly lower than that of the protein (protein 5A) composed of a sequence formed by introducing mutation 5a into the amino acid sequence 5A. The nitro compound responsiveness of protein 5B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, further preferably 80% or more, and even more preferably 90% or more, relative to 100% of the nitro compound responsiveness of protein 5A. From this viewpoint, the identity of amino acid sequence 5B with respect to amino acid sequence 5A is preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%.
[0180] The amino acid sequence 5B is preferably the amino acid sequence described below (5B'):
[0181] (5B') An amino acid sequence 5B' with one or more amino acid mutations relative to amino acid sequence 5A.
[0182] In the amino acid sequence 5B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.
[0183] Amino acid mutations in amino acid sequence 5B relative to amino acid sequence 5A can include, for example, substitution, deletion, addition, insertion, etc., with substitution being preferred, and conservative substitution being more preferred.
[0184] The amino acid sequence 5B is preferably derived from an olfactory receptor derived from insects. For olfactory receptors derived from insects, the definition is the same as in "2-1. Amino acid sequence 1C" above.
[0185] Mutation 5a is a substitution 5ax of amino acid L178 in amino acid sequence 5A or a substitution 5ay in amino acid sequence 5B corresponding to substitution 5ax. The definition of "substitution corresponding to ~" is the same as in "2-1. Amino Acid Sequence 1C" above.
[0186] The preferred amino acid for mutation 5a is proline, or the mutated amino acid corresponding to L178.
[0187] Provided it does not significantly impair the responsiveness to nitro compounds, amino acid sequence 5C may contain other amino acid mutations (e.g., substitutions, conserved substitutions). As an example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the 7th transmembrane region. The number of other amino acid mutations may be, for example, 1–50, 1–20, 1–10, or 1–5.
[0188] Specifically, the amino acid sequence 5C can be exemplified by, for example, the amino acid sequence shown in SEQ ID NO: 85, or an amino acid sequence that has 80% or more (preferably 85% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 97% or more, especially preferably 99% or more, and less than 100%) identity with that amino acid sequence.
[0189] 2-6. Protein
[0190] The olfactory receptor protein disclosed herein, in one embodiment, comprises the general formula (1) of the corresponding wild-type olfactory receptor protein:
[0191] φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6
[0192] (In the formula, X1~X6 and Z1~Z3 represent amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ1 represents hydrophobic amino acids, φ2~φ7 each independently represent non-polar amino acids or hydrophobic amino acids, and U represents non-polar amino acids.)
[0193] The amino acid sequence B, which is the result of a mutation in amino acid sequence A, is shown below.
[0194] It can satisfy at least one of the following conditions: 1 to 3.
[0195] (Condition 1) In the amino acid sequence B, X3 and / or X4 are substituted, where X3 is a branched-chain amino acid and / or X4 is a charge-free polar amino acid.
[0196] (Condition 2) If X5 and X6 in amino acid sequence A are both positively charged polar amino acids, then X6 in amino acid sequence B is an amino acid other than a positively charged polar amino acid.
[0197] (Condition 3) If one or both of X1 and X2 in the amino acid sequence A are positively charged polar amino acids, then X1 and / or X2 in the amino acid sequence B are substituted, where X1 is a non-polar amino acid and / or X2 is a hydrophobic amino acid.
[0198] This enables an increase in the responsiveness of nitro compounds. It should be noted that "corresponding wild-type olfactory receptors" refers to olfactory receptors composed of any sequence of amino acid sequences 1A to 5A. The amino acid sequence A represented by the general formula (1) can be contained in the 7th transmembrane region.
[0199] Provided that the olfactory receptor protein disclosed herein does not significantly impair the responsiveness to nitro compounds, it may be supplemented with amino acid sequences other than the 1C-5C amino acid sequence, such as protein tags, fluorescent proteins, luminescent proteins, signal sequences, or other proteins or peptides. Examples of protein tags include biotin, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags.
[0200] The olfactory receptor proteins disclosed herein may be chemically modified, provided that the responsiveness to nitro compounds is not significantly impaired.
[0201] The C-terminus of the olfactory receptor protein disclosed herein can be a carboxyl group (-COOH) or a carboxyl group (-COO). - It can be any of the following: amide (-CONH2) or ester (-COOR).
[0202] Here, the R in the ester can be, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1~6 Alkyl groups; such as cyclopentyl, cyclohexyl, etc. (C60) 3~8 Cycloalkyl groups; such as phenyl, α-naphthyl, etc. 6~12 Aryl groups; such as benzyl, phenethyl, etc. phenyl-C 1~2 Alkyl groups; α-naphthylmethyl and other α-naphthyl-C 1~2 Alkyl and other C 7~14 Aryl alkyl groups; neopentyloxymethyl groups, etc.
[0203] The carboxyl group (or carboxylate) other than the C-terminus of the olfactory receptor protein disclosed herein can be amidated or esterified. As an ester in such cases, for example, the C-terminal ester described above can be used.
[0204] Furthermore, the olfactory receptor protein disclosed herein may also contain an amino-protected group (e.g., formyl, acetyl, etc.) of the N-terminal amino acid residue. 1~6 C of alkyl acyl group, etc. 1~6 Proteins protected by acyl groups, proteins whose N-terminal glutamine residues are pyroglutamicized after cleavage in vivo, and proteins whose intramolecular amino acid side chains have substitution groups (e.g., -OH, -SH, amino, imidazole, indole, guanidinyl, etc.) are protected by suitable groups (e.g., formyl, acetyl, etc.). 1~6 C of alkyl acyl group, etc. 1~6 Proteins protected by acyl groups, or so-called glycoproteins and other complex proteins bonded by glycans.
[0205] The olfactory receptor protein disclosed herein can be in the form of a salt formed with an acid or a base. There is no particular limitation on the salt; it can be either an acidic salt or a basic salt. Examples of acidic salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, and p-toluenesulfonate; and amino acid salts such as aspartate and glutamate. Furthermore, examples of basic salts include alkali metal salts such as sodium and potassium salts; and alkaline earth metal salts such as calcium and magnesium salts.
[0206] The olfactory receptor protein disclosed herein can also be in the form of a solvate. The solvent is not particularly limited, and examples include water, ethanol, glycerol, and acetic acid.
[0207] The olfactory receptor protein disclosed herein can be readily manufactured using known genetic engineering methods. For example, it can be manufactured using PCR, restriction enzyme digestion, DNA ligation technology, in vitro transcription and translation technology, recombinant protein production technology, etc.
[0208] 3. Polynucleotides, cells, non-human animals
[0209] One embodiment of this disclosure relates to a polynucleotide (sometimes referred to as "the polynucleotide of this disclosure") containing the coding sequence of the olfactory receptor protein of this disclosure, a cell (sometimes referred to as "the cell of this disclosure") containing the polynucleotide of this disclosure, and a non-human animal (sometimes referred to as "the non-human animal of this disclosure") containing the cell of this disclosure. These will be described below.
[0210] There are no particular limitations on the coding sequence of the olfactory receptor protein disclosed herein, as long as it is a polynucleotide consisting of the base sequence encoding the olfactory receptor protein disclosed herein.
[0211] In one embodiment of the polynucleotide disclosed herein, an expression cassette of the olfactory receptor protein of the present disclosure is included.
[0212] The expression cassette of the olfactory receptor protein disclosed herein is not particularly limited as long as it is a polynucleotide capable of expressing the olfactory receptor protein of the present disclosure within a cell. Typical examples of the expression cassette of the olfactory receptor protein of the present disclosure include polynucleotides containing a promoter and a coding sequence of the olfactory receptor protein of the present disclosure configured under the control of that promoter.
[0213] The promoter contained in the expression cassette of the olfactory receptor protein disclosed herein is not particularly limited and can be selected appropriately according to the target cell. Various Pol II lineage promoters can be used as promoters. Examples of Pol II lineage promoters include CMV promoters, EF1 promoters, SV40 promoters, and MSCV promoters, among others. Additionally, other promoters that can be used include tryptophan promoters such as TRC and TAC, lac promoters, T7 promoters, T5 promoters, T3 promoters, SP6 promoters, arabinose-inducible promoters, cold shock promoters, and tetracycline-inducible promoters.
[0214] The olfactory receptor protein expression cassette disclosed herein may contain other elements as needed (e.g., multiple cloning site (MCS), drug resistance gene, origin of replication, enhancer sequence, repressor sequence, insulator sequence, reporter protein (e.g., fluorescent protein, etc.) coding sequence, drug resistance gene coding sequence, etc.).
[0215] The polynucleotides disclosed herein can be used as vectors. A suitable vector can be selected based on the intended use (cloning, protein expression) and the type of host cell. Examples of vectors for *E. coli* as the host include M13 phage or its mutants, λ phage or its mutants, pBR 322 or its mutants (pB325, pAT153, pUC8, etc.); examples of vectors for yeast as the host include pYepSec1, pMFa, pYES2, pPIC3.5K, etc.; examples of vectors for insect cells as the host include pAc, pVL, etc.; and examples of vectors for mammalian cells as the host include pcDNA, pCDM8, pMT2PC, etc.
[0216] The cells disclosed herein are not particularly limited as long as they contain the polynucleotides disclosed herein. Examples of cells include, for example, *Escherichia coli* K12 and other *Escherichia coli* bacteria; *Bacillus subtilis* MI114 and other *Bacillus* bacteria; yeasts such as *Saccharomyces cerevisiae* AH22; Sf cell lines derived from *Spodoptera frugiperda* or HighFive cell lines derived from *Trichoplusia ni*; insect cells such as olfactory nerve cells; and animal cells such as COS7 cells. As for animal cells, cultured cells derived from mammals are preferred; specifically, examples include COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, HeLa cells, PC12 cells, N1E-115 cells, and SH-SY5Y cells.
[0217] From the viewpoint of being directly usable in the nitro compound detection applications described later, the cells disclosed herein preferably contain the coding sequence of an insect olfactory receptor co-receptor. Like olfactory receptors, insect olfactory receptor co-receptors are membrane proteins with a seven-transmembrane structure, but they do not recognize odor substances themselves; instead, they function by forming a heterogeneous complex with olfactory receptors. As a heterogeneous complex composed of olfactory receptors and olfactory receptor co-receptors, the olfactory receptor complex possesses ion channel activity activated by odor substances; when activated, it allows sodium ions (Na+) to pass through. + ), calcium ions (Ca 2+ Cations such as ions flow into the cells.
[0218] From the same perspective, the cells of this disclosure preferably contain the coding sequence of a protein that displays color or emits light upon response to ions (such as calcium ions) flowing into the cell in response to olfactory receptors. Examples of such proteins include jellyfish luminescent protein, Yellow Cameleon (YC), and GCaMP. Alternatively, the cells of this disclosure preferably contain calcium ion-dependent fluorescent pigments (e.g., Fura-2, Fluo-3, Fluo-4, etc.).
[0219] From the same perspective, the cells of this disclosure contain the olfactory receptor protein of this disclosure, that is, the olfactory receptor protein of this disclosure is expressed in the cells of this disclosure. In this case, the olfactory receptor protein of this disclosure has a 7-transmembrane structure, and therefore is configured as a membrane protein on the cell membrane.
[0220] The non-human animal disclosed herein is not particularly limited as long as it contains the cells of this disclosure. While there are no particular limitations on the non-human animal, insects are preferred from the viewpoint of suitability for the detection of nitro compounds described later. Regarding insects, the description is the same as in "2-1. Amino acid sequence 1C" above. Furthermore, from the same viewpoint, the cells of this disclosure in the non-human animal preferably contain olfactory nerve cells.
[0221] 4. Uses
[0222] The olfactory receptor protein disclosed herein has the ability to respond to nitro compounds by causing cations (sodium ions (Na+) to react). + ), calcium ions (Ca 2 + The olfactory receptor protein of this disclosure can be used as a detection element for nitro compounds by detecting the influx of cations into cells. Nitro compounds can be detected by detecting the cations or by detecting behavioral changes in olfactory nerve cell activation caused by the influx of cations. Therefore, the olfactory receptor protein of this disclosure can be used as a detection element for nitro compounds.
[0223] One embodiment of this disclosure relates to a nitro compound detection element composed of olfactory receptor proteins of this disclosure (the detection element of this disclosure), and a nitro compound detection sensor (the detection sensor of this disclosure) comprising a cell containing the detection element of this disclosure, a lipid bilayer membrane (artificial cell membrane) containing the detection element of this disclosure, or a non-human animal containing the cell.
[0224] There are no particular limitations on nitro compounds as long as they contain a nitro group. Preferred examples of nitro compounds include compounds with a structure where a nitro group is directly attached to a benzene ring, and compounds containing two or more nitro groups. Specific examples of nitro compounds include 2-nitrotoluene, 3-nitrotoluene, 4-nitrotoluene, 2,3-dinitrotoluene, 2,4-dinitrotoluene, 2,6-dinitrotoluene, 4-amino-2,6-dinitrotoluene, 3-trifluoromethyl-4-nitrophenol, nitroaniline, trinitrotoluene, trimethylenetrinitroamine, pentaerythritol tetranitrate, picric acid, nitroglycerin, and 2,3-dimethyl-2,3-dinitrobutane.
[0225] It is known to utilize sensors for detecting chemical substances from cells, lipid bilayers, or non-human animals, and their specific configurations can adopt those described in, for example, Patent Documents 1, 2, and 3. A nitro compound detection sensor based on a cell or lipid bilayer of this disclosure includes, for example, a container holding the cell or lipid bilayer of this disclosure, a sensor that outputs a signal when detecting a nitro compound in the cell of this disclosure in response (e.g., light), and a determiner that detects the nitro compound based on the signal. A nitro compound detection sensor based on a non-human animal of this disclosure includes, for example, a detection unit (e.g., a motion sensor, vibration sensor, sound sensor, etc.) that detects the movement of the non-human animal of this disclosure.
[0226] Example
[0227] Hereinafter, one embodiment of the present invention will be described in detail based on an example, but the present invention is not limited to these embodiments.
[0228] In the following examples, OR represents the olfactory receptor, Orco represents the olfactory receptor co-receptor, Ag represents Anopheles gambiae, and Aa represents Aedes aegypti.
[0229] The wild-type olfactory receptor genes used in the following examples are shown below.
[0230] [Table 1]
[0231]
[0232] Experimental Example 1. Determination of the nitro compound responsiveness of AgOR28
[0233] The responsiveness of olfactory receptors (wild-type AgOR28 and mutant AgOR28) to nitro compounds was determined.
[0234] Experimental Example 1-1. Preparation of Expression Plasmids
[0235] < Comparative Example 1 Preparation of wild-type AgOR28 expression plasmid >
[0236] A double-stranded DNA with the coding sequence (base sequence: SEQ ID NO: 6) of wild-type AgOR28 (amino acid sequence: SEQ ID NO: 1) in any DNA strand was synthesized and introduced into pcDNA3.1 to obtain the wild-type AgOR28 expression plasmid (pcDNA3.1-AgOR28).
[0237] < Comparative Example 2Preparation of the mutant AgOR28 (T25K mutant) expression plasmid >
[0238] As described below, a plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 12) of mutant AgOR28 (T25K mutation) (amino acid sequence: SEQ ID NO: 11) with the amino acid residue 25 of wild-type AgOR28 mutated from threonine to lysine was prepared.
[0239] PCR primers (CAGAGGCATGGCCAAGAAGATCCAGAACAGC (SEQ ID NO: 13), GCTGTTCTGGATCTTCTTGGCCATGCCTCTG (SEQ ID NO: 14)) were synthesized and designed to convert threonine residue 25 of the wild-type AgOR28 amino acid sequence to lysine. Using these primers, PCR amplification was performed with pcDNA3.1-AgOR28 as a template. The PCR reaction was performed using KOD-Plus-Neo (TOYOBO). The reaction solution was prepared according to the attached procedure, consisting of 1×PCR buffer for KOD-Plus-Neo, 0.2 mM dNTPs, 1.5 mM MgSO4, 0.2 μM primers, and 1 U KOD-Plus-Neo DNA polymerase, with a final volume of 50 μL. As a reaction cycle, after pre-modification at 95°C for 30 seconds, the reaction was repeated 16 times, with one cycle consisting of modification at 95°C for 30 seconds, annealing at 55°C for 1 minute, and extension at 68°C for 10 minutes. 0.4 μL of DpnI was added to 20 μL of the obtained PCR product, and after treatment at 37°C for 2 hours, it was transformed into *E. coli* (DH5α). The transformed *E. coli* were inoculated onto LB plates supplemented with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. The nucleotide sequence of the plasmid retained was then determined, yielding the mutant AgOR28 (T25K mutant) expression plasmid.
[0240] < Comparative Example 3 Preparation of the mutant AgOR28 (P31T mutant) expression plasmid >
[0241] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 16) of a mutant AgOR28 (P31T mutation) (amino acid sequence: SEQ ID NO: 15) with a proline-threonine mutation at amino acid residue 31 in the amino acid sequence of wild-type AgOR28 was prepared. Specifically, it was prepared in the same manner as in Comparative Example 2, except that primer F: CAGATCCAGAACAGCACCATCGACCTGTACGTG (SEQ ID NO: 17) and primer R: CACGTACAGGTCGATGGTGCTGTTCTGGATCTG (SEQ ID NO: 18) were used as PCR primers.
[0242] < Comparative Example 4 Preparation of the mutant AgOR28 (T25K-P31T double mutant) expression plasmid >
[0243] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 20) of a mutant AgOR28 (T25K, P31T double mutation) (amino acid sequence: SEQ ID NO: 19), in which amino acid residue 25 is mutated from threonine to lysine and amino acid residue 31 is mutated from proline to threonine, was prepared. Specifically, it was prepared in the same manner as in Comparative Example 3, except that the mutant AgOR28 (T25K mutation) expression plasmid (Comparative Example 2) was used as the template for PCR.
[0244] < Example 1 Preparation of mutant AgOR28 (22a.a deletion) expression plasmid >
[0245] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 22) of a mutant AgOR28 (22a.a deletion) with a 22-amino acid deletion from amino acid position 52 to 73 in the wild-type AgOR28 amino acid sequence was prepared. Specifically, primers F1: TACCGAGCTCGGATCATGGCCAGACTGGTGCTG (SEQ ID NO: 23), primer R1: GATATCTGCAGAATT TTACTGCTGGTTGATGGTC (SEQ ID NO: 24), primer F2: GCCAGCCTGTGCGTGCCCCAGTTCACCTACCTGGTGGTGGACACCAAG (SEQ ID NO: 90), and primer R2: CACCAGGTAGGTGAACTGGGGCACGCACAGGCTGGCGATAGGGATG (SEQ ID NO: 91) were synthesized. Using wild-type AgOR28 as a template, PCR was performed using primers F1 and R2, and PCR was performed using primers F2 and R1. The amplification products were purified by agarose gel electrophoresis. The purified products were mixed in a 1:1 molar ratio, incubated at 95°C for 5 minutes, and then allowed to stand at room temperature for 5 minutes. A final 50 μL reaction buffer (1 U KOD-Plus-Neo DNA polymerase (TOYOBO), 1.5 mM MgSO4 (TOYOBO), 0.2 mM dNTPs Mix (TOYOBO), and 1×PCR buffer (TOYOBO) for KOD plus neo PCR) was prepared. After incubating at 94°C for 2 minutes, two cycles were performed, each consisting of 95°C for 30 seconds, 63°C for 30 seconds, and 68°C for 1 minute and 50 seconds. 5 μL of this reaction buffer was used to perform PCR using primers F1 and R1. The PCR reaction solution was prepared according to the following composition for KOD-Plus-Neo: 1×PCR buffer, 0.2 mM dNTPs, 1.5 mM MgSO4, 0.2 μM primers, and 1 μU KOD-Plus-Neo DNA polymerase. The final volume was set to 50 μL. After pre-modification at 94 °C for 2 minutes, 30 cycles were performed, consisting of one cycle of modification at 98 °C for 10 seconds, annealing at 63 °C for 30 seconds, and extension at 68 °C for 1 minute and 50 seconds. The resulting PCR amplified fragment was ligated to the pcDNA3.1 expression plasmid fragment cut with BamHI and EcoRI using the In-Fusion HD Cloning Kit (Takara Bio Inc.) according to the attached protocol. After the reaction, E. coli (DH5α) was transformed using the In-Fusion reaction solution.The transformed *E. coli* were inoculated onto LB agar plates supplemented with ampicillin and incubated at 37°C to form colonies. Two colonies were selected and incubated again on LB liquid medium. The base sequences of the plasmids they retained were then determined, yielding the expression plasmids.
[0246] It should be noted that the amino acid sequence of wild-type AgOR28 was structurally predicted using TMpred (K. Hofmann, W. Stoffel, TMbase - a database of membrane spanning protein segments, Biol. Chem. Hoppe-Seyler, 374 (1993), p. 166, https: / / embnet.vital-it.ch / software / TMPRED_form.html) (using default conditions). The results predicted that the region from amino acid 55 to 84 was the first extracellular loop. Therefore, the missing region is the first extracellular loop.
[0247] < Example 2 Preparation of mutant AgOR28 (T25K mutation, 22a.a deletion) expression plasmid >
[0248] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 26) of a mutant AgOR28 (T25K mutation, 22a.a deletion) (amino acid sequence: SEQ ID NO: 25), in which amino acid residue 25 of the wild-type AgOR28 is mutated from threonine to lysine and 22 amino acids from amino acid residues 52 to 73 are continuously deleted, was prepared. Specifically, it was prepared in the same manner as in Comparative Example 2, except that the mutant AgOR28 (22a.a deletion) expression plasmid (Example 1) was used as the template for PCR.
[0249] < Example 3 Preparation of mutant AgOR28 (P31T mutation, 22a.a deletion) expression plasmid >
[0250] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 28) of a mutant AgOR28 (P31T mutation, 22a.a deletion) (amino acid sequence: SEQ ID NO: 27) with a proline-threonine mutation at amino acid residue 31 of the wild-type AgOR28 amino acid sequence and a continuous deletion of 22 amino acids from amino acids 52 to 73. Specifically, it was prepared in the same manner as in Comparative Example 3, except that the mutant AgOR28 (22a.a deletion) expression plasmid (Example 1) was used as the template for PCR.
[0251] < Example 4 Preparation of the mutant AgOR28 (T25K-P31T double mutation, 22a.a deletion) expression plasmid >
[0252] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 30) of mutant AgOR28 (T25K-P31T double mutation, 22a.a deletion) (amino acid sequence: SEQ ID NO: 29), was prepared. This mutation involves a 25th amino acid residue (threonine) to lysine mutation, a 31st amino acid residue (proline) to threonine mutation, and a 22-amino acid deletion consecutively from amino acids 52 to 73. Specifically, the plasmid was prepared in the same manner as in Comparative Example 3, except that the mutant AgOR28 (T25K mutation, 22a.a deletion) expression plasmid (Example 2) was used as the PCR template.
[0253] < Reference Example 1 Preparation of chimeric Orco expression plasmid >
[0254] According to a previously published document (Japanese Patent Application Publication No. 2018-50556), a plasmid (pcDNA3.1) encoding the coding sequence (base sequence: SEQ ID NO: 93) of a fusion protein Dm(NT-TM4)AmORCO (amino acid sequence: SEQ ID NO: 92) containing a portion of a Drosophila coreceptor and a portion of a bee coreceptor was prepared. The amino acid sequence of Dm(NT-TM4)AmORCO from the N-terminal region (NT) to the 4th transmembrane domain (TM4) (the amino acid sequence from its N-terminal amino acid residue to amino acid residue 234) is derived from the Drosophila coreceptor (Dm(NT-TM4), and the amino acid sequence from the 2nd intracellular loop to the C-terminal region is derived from the bee coreceptor (Am(IC2-CT)).
[0255] Experimental Example 1-2. Introduction of Expression Plasmids into Cells
[0256] HEK293FT cells (purchased from Invitrogen) were used at a rate of 3 × 10⁻⁶. 6Cells were seeded into 10 cm culture dishes and cultured in DMEM medium (made by NACALAI TESQUE, INC.) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. 1.5 μg of any olfactory receptor expression plasmid, 3.0 μg of olfactory receptor co-receptor expression plasmid, and 8 μg of GFP-jellyfish luminescent protein (GAP) expression plasmid were mixed with 12.5 μL of Plus reagent and 31.25 μL of lipofectamine LTX (made by Invitrogen) and incubated for 10 minutes. This mixture was then transfected into the cells. Four hours after transfection, cells were seeded in 96-well plates at 9 × 10⁶ cells / wells. 4 Cells were seeded in DMEM medium (made by NACALAI TESQUE, INC.) containing 10% FBS and cultured at 37°C and 5% CO2 for approximately 24 hours. This yielded transformed cells transiently infused with olfactory receptor expression plasmids, olfactory receptor co-receptor expression plasmids, and GAP expression plasmids.
[0257] Experimental Examples 1-3. Activity Assay
[0258] When GFP-jellyfish luminescent protein (GAP) binds to calcium ions, it is activated and emits green fluorescence in the presence of substrates such as coelenterate. Therefore, the increase in intracellular calcium ion concentration in cells expressing GAP is directly reflected in the increase in fluorescence intensity. Thus, changes in fluorescence intensity can be used to determine whether the olfactory receptor complex functions as an ion channel by adding the test substance.
[0259] The culture medium of the transformed cells was removed and replaced with an assay buffer (Hanks-HEPES (20 mM pH 7.4) containing 0.5 μM coelenterate h (Promega Corporation) and 0.3% BSA), and the cells were incubated at room temperature for 4 hours. Next, using a Flexstation 3 (Molecular Devices), the analyte corresponding to the olfactory receptor was added to the cell culture medium, and the luminescence intensity of the cells was measured.
[0260] In this test example, 2,3-dinitrotoluene, 2,6-dinitrotoluene, or toluene was used as the test substance.
[0261] The results are shown in Figure 1 It is known that the Anopheles olfactory receptor 28 containing the 22a.a deletion exhibits responsiveness to nitro compounds but not to non-nitro compounds. On the other hand, the Anopheles olfactory receptor 28 without this deletion does not exhibit responsiveness to nitro compounds.
[0262] Experimental Example 2. Determination of the nitro compound responsiveness of AgOR47
[0263] The responsiveness of olfactory receptors (wild-type AgOR47 and mutant AgOR47) to nitro compounds was determined.
[0264] Experimental Example 2-1. Preparation of Expression Plasmids
[0265] < Comparative Example 5 Preparation of wild-type AgOR47 expression plasmid >
[0266] A double-stranded DNA with the coding sequence (base sequence: SEQ ID NO: 7) of wild-type AgOR47 (amino acid sequence: SEQ ID NO: 2) in any DNA strand was synthesized and introduced into pcDNA3.1 to obtain the wild-type AgOR47 expression plasmid (pcDNA3.1-AgOR47).
[0267] < Comparative Example 6 Preparation of the mutant AgOR47 (L71F mutant) expression plasmid >
[0268] As described below, a plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 36) of mutant AgOR47 (L71F mutation) (amino acid sequence: SEQ ID NO: 35) containing a mutation of leucine to phenylalanine at amino acid residue 71 in the amino acid sequence of wild-type AgOR47 was prepared.
[0269] PCR primers (primer F: CTATCGCCGAGGGCATGTTCAGCTTCAATACCACC (SEQ ID NO: 37) and primer R: GGTGGTATTGAAGCTGAACATGCCCTCGGCGATAG (SEQ ID NO: 38)) were synthesized and designed to convert leucine residue 71 in the amino acid sequence of wild-type AgOR47 to phenylalanine. Using these primers, PCR amplification was performed using pcDNA3.1-AgOR47 as a template (reaction sequence and conditions followed standard procedures). The amplified PCR reaction solution was digested with DpnI and transformed into *E. coli* (DH5α). The transformed *E. coli* were inoculated onto LB plates supplemented with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. The base sequence of the plasmid retained in these colonies was then determined, yielding the mutant AgOR47 (L71F mutant) expression plasmid.
[0270] < Comparative Example 7 Preparation of the mutant AgOR47 (I134V mutant) expression plasmid >
[0271] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 40) of a mutant AgOR47 (I134V mutation) (amino acid sequence: SEQ ID NO: 39), in which isoleucine at amino acid residue 134 of the wild-type AgOR47 is mutated to valine, was prepared. Specifically, it was prepared in the same manner as Comparative Example 6, except that primer F: CATCTTCACCAACGGCGTCGTGTTCGCCATGAC (SEQ ID NO: 41) and primer R: GGTCATGGCGAACACGACGCCGTTGGTGAAGATG (SEQ ID NO: 42) were used as PCR primers.
[0272] < Comparative Example 8 Preparation of the mutant AgOR47 (S140G mutant) expression plasmid >
[0273] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 44) of a mutant AgOR47 (S140G mutation) with a serine-glycine mutation at amino acid residue 140 in the amino acid sequence of wild-type AgOR47 (amino acid sequence: SEQ ID NO: 43) was prepared. Specifically, it was prepared in the same manner as Comparative Example 6, except that primer F: GTGTTCGCCATGACCGGCTCTACAATCGCCGG (SEQ ID NO: 45) and primer R: CCGGCGATTGTAGAGCCGGTCATGGCGAACAC (SEQ ID NO: 46) were used as PCR primers.
[0274] < Comparative Example 9 Preparation of the mutant AgOR47 (F147L mutant) expression plasmid >
[0275] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 48) of a mutant AgOR47 (F147L mutant) with a phenylalanine-leucine mutation at amino acid residue 147 in the amino acid sequence of wild-type AgOR47 (amino acid sequence: SEQ ID NO: 47). Specifically, it was prepared in the same manner as Comparative Example 6, except that primers F: CAATCGCCGGCATGTTCTACACCTACTACACC (SEQ ID NO: 49) and primer R: GGTGTAGTAGGTGTAGAACATGCCGGCGATTG (SEQ ID NO: 50) were used as PCR primers.
[0276] < Comparative Example 10 Preparation of the mutant AgOR47 (D5E mutant) expression plasmid >
[0277] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 52) of a mutant AgOR47 (D5E mutation) (amino acid sequence: SEQ ID NO: 51) with the amino acid residue 5 of wild-type AgOR47 mutated from aspartic acid to glutamic acid was prepared. Specifically, primers F: ATGGTTGTGTTCGAACCACTGGACGACCC (SEQ ID NO: 53) and R: GGGTCGTCCAGTGGTTCGAACACAACCAT (SEQ ID NO: 54) were used as PCR primers, in the same manner as Comparative Example 6.
[0278] < Comparative Example 11 Preparation of the mutant AgOR47 (K235Q mutant) expression plasmid >
[0279] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 56) of a mutant AgOR47 (K235Q mutation) (amino acid sequence: SEQ ID NO: 55) with lysine mutated to glutamine at amino acid residue 235 in the wild-type AgOR47 amino acid sequence was prepared. Specifically, primers F: GATCGGACCCGTTGACCAGTATACTGCAGAGCTG (SEQ ID NO: 57) and R: CAGCTCTGCAGTATACTGGTCAACGGGTCCGATC (SEQ ID NO: 58) were used as PCR primers, in the same manner as Comparative Example 6.
[0280] < Comparative Example 12 Preparation of the mutant AgOR47 (N241S mutant) expression plasmid >
[0281] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 60) of a mutant AgOR47 (N241S mutation) (amino acid sequence: SEQ ID NO: 59) with an asparagine-to-serine mutation at amino acid residue 241 in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, it was prepared in the same manner as Comparative Example 6, except that primers F: GTATACTGCAGAGCTGAGTGAAATTATCGAACTTCAC (SEQ ID NO: 61) and R: GTGAAGTTCGATAATTTCACTCAGCTCTGCAGTATAC (SEQ ID NO: 62) were used as PCR primers.
[0282] < Example 5Preparation of the mutant AgOR47 (L60P mutant) expression plasmid >
[0283] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 32) of a mutant AgOR47 (L60P mutant) (amino acid sequence: SEQ ID NO: 31) with a leucine-proline mutation at amino acid residue 60 in the wild-type AgOR47 amino acid sequence was prepared. Specifically, it was prepared in the same manner as Comparative Example 6, except that primer F: CTACGAGACAATCCCGCAGTGCTTCCGGTC (SEQ ID NO: 33) and primer R: GACCGGAAGCACTGCGGGATTGTCTCGTAG (SEQ ID NO: 34) were used as PCR primers.
[0284] < Example 6 Preparation of the mutant AgOR47 (M138I mutant) expression plasmid >
[0285] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 64) of a mutant AgOR47 (M138I mutation) (amino acid sequence: SEQ ID NO: 63) with a methionine-to-isoleucine mutation at amino acid residue 138 in the wild-type AgOR47 amino acid sequence was prepared. Specifically, it was prepared in the same manner as Comparative Example 6, except that primers F: GGCGTCGTGTTCGCCATCACCGGCTCTACAATC (SEQ ID NO: 65) and R: GATTGTAGAGCCGGTGATGGCGAACACGACGCC (SEQ ID NO: 66) were used as PCR primers.
[0286] < Example 7 Preparation of the mutant AgOR47 (A152T mutant) expression plasmid >
[0287] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 68) of a mutant AgOR47 (A152T mutation) (amino acid sequence: SEQ ID NO: 67) with a mutation of alanine to threonine at amino acid residue 152 in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, it was prepared in the same manner as Comparative Example 6, except that primers F: GGAATGTTTTACACCTACTACACGAAAGATTCGGAATATTCC (SEQ ID NO: 69) and R: GGAATATTCCGAATCTTTCGTGTAGTAGGTGTAAAACATTCC (SEQ ID NO: 70) were used as PCR primers.
[0288] < Example 8 Preparation of the mutant AgOR47 (L60P-A152T double mutant) expression plasmid >
[0289] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 72) of mutant AgOR47 (L60P-A152T double mutation) (amino acid sequence: SEQ ID NO: 71) with an L60P-A152T double mutation in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, firstly, the expression plasmid was prepared in the same manner as in Example 7, except that the mutant AgOR47 (L60P mutation) expression plasmid (Example 5) was used as the template for PCR.
[0290] < Example 9 Preparation of the mutant AgOR47 (M138I-A152T double mutant) expression plasmid >
[0291] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 74) of a mutant AgOR47 (M138I-A152T double mutation) with an M138I-A152T double mutation in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, it was prepared in the same manner as in Example 7, except that the mutant AgOR47 (M138I mutation) expression plasmid (Example 6) was used as the template for PCR.
[0292] < Example 10 Preparation of the mutant AgOR47 (L60P-M138I-A152T triple mutant) expression plasmid >
[0293] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 76) of a mutant AgOR47 (L60P-M138I-A152T triple mutation) with an L60P-M138I-A152T triple mutation in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, it was prepared in the same manner as in Example 6, except that the mutant AgOR47 (L60P-A152T double mutation) expression plasmid (Example 8) was used as the template for PCR.
[0294] < Example 11 Preparation of the mutant AgOR47 expression plasmid (L60P-L71F-I134V-S140G-F147L 5-fold mutant) >
[0295] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 109) of a mutant AgOR47 (L60P-L71F-I134V-S140G-F147L5-fold mutation) with an L60P-L71F-I134V-S140G-F147L 5-fold mutation in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, the mutant AgOR47 (L60P mutation) expression plasmid (Example 5) was used as a template for PCR, and the mutation was sequentially introduced using the primers used in the comparative example above.
[0296] < Example 12 Preparation of the mutant AgOR47 expression plasmid (L60P-L71F-I134V-M138I-S140G-F147L-A152T 7-fold mutation) >
[0297] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 78) of a mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L-A152T 7-fold mutation) (amino acid sequence: SEQ ID NO: 77) with the L60P-L71F-I134V-M138I-S140G-F147L-A152T 7-fold mutation in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, firstly, as a template for PCR, an expression plasmid of mutant AgOR47 (L60P-L71F-I134V-S140G-F147L5-fold mutation) was used (Example 11), and the mutation was sequentially introduced using the primers used in the above examples and comparative examples.
[0298] < Example 13 Preparation of the mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L6 double mutant) expression plasmid >
[0299] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 80) of mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L 6-fold mutation) (amino acid sequence: SEQ ID NO: 79) with the L60P-L71F-I134V-M138I-S140G-F147L 5-fold mutation in the amino acid sequence of wild-type AgOR47 was prepared. Specifically, the expression plasmid of mutant AgOR47 (L60P-L71F-I134V-S140G-F147L 5-fold mutation) (Example 11) was used as a template for PCR, and the mutation was introduced using the primers used in the above examples.
[0300] Experimental Example 2-2. Introduction of Expression Plasmid into Cells and Activity Assay
[0301] The expression plasmid was introduced into cells in the same manner as in Examples 1-2, and its activity was measured in the same manner as in Examples 1-3. In this example, 4-amino-2,6-dinitrotoluene, 3-trifluoromethyl-4-nitrophenol, 2,3-dinitrotoluene, 2,6-dinitrotoluene, or 2,3-dimethyl-2,3-dinitrobutane were used as the test substance.
[0302] The results are shown in Figures 2-6 It is known that the Anopheles olfactory receptor 47 containing a substitution of at least one amino acid selected from the group consisting of A61, M138, and A152 exhibits nitro compound responsiveness. On the other hand, the Anopheles olfactory receptor 47 without this deletion does not exhibit nitro compound responsiveness.
[0303] Experimental Example 3. Determination of the nitro compound responsiveness of AgOR6
[0304] The responsiveness of olfactory receptors (wild-type AgOR6 and mutant AgOR6) to nitro compounds was determined.
[0305] Experimental Example 3-1. Preparation of Expression Plasmid
[0306] < Comparative Example 13 Preparation of wild-type AgOR6 expression plasmid >
[0307] A double-stranded DNA with the coding sequence (base sequence: SEQ ID NO: 8) of wild-type AgOR6 (amino acid sequence: SEQ ID NO: 3) in any DNA strand was synthesized and introduced into pcDNA3.1 to obtain the wild-type AgOR6 expression plasmid (pcDNA3.1-AgOR6).
[0308] < Example 14 Preparation of mutant AgOR6 expression plasmid >
[0309] A plasmid (pcDNA3.1) was constructed containing the coding sequence (base sequence: SEQ ID NO: 82) of mutant AgOR6 (amino acid sequence: SEQ ID NO: 81), which contains the following amino acid sequences in the wild-type AgOR6 amino acid sequence: serine at amino acid residue 114 is mutated to alanine, alanine at amino acid residue 120 is mutated to glutamic acid, histidine at amino acid residue 162 is mutated to tyrosine, valine at amino acid residue 186 is mutated to alanine, valine at amino acid residue 352 is mutated to methionine, serine at amino acid residue 368 is mutated to proline, and the 79th amino acid region is substituted (including the substitution of 11 charged amino acids to non-charged amino acids in the region from the 3rd extracellular loop to the 3rd intracellular loop). Specifically, a double-stranded DNA containing the coding sequence (base sequence: SEQ ID NO: 82) of mutant AgOR6 (amino acid sequence: SEQ ID NO: 81) in any DNA strand is synthesized and introduced into pcDNA3.1 to obtain the mutant AgOR6 expression plasmid (pcDNA3.1-AgOR6).
[0310] Experimental Example 3-2. Introduction of expression plasmids into cells and assay of their activity
[0311] The expression plasmid was introduced into cells in the same manner as in Examples 1-2, and its activity was measured in the same manner as in Examples 1-3. 2-Nitroaniline was used as the test substance in this experiment.
[0312] The results are shown in Figure 7 It can be seen that the mutant Anopheles mosquito olfactory receptor 6 exhibits a nitro compound responsiveness. On the other hand, the wild-type Anopheles mosquito olfactory receptor 6 does not exhibit a nitro compound responsiveness.
[0313] Experimental Example 4. Determination of the nitro compound responsiveness of AgOR15
[0314] The responsiveness of olfactory receptors (wild-type AgOR15 and mutant AgOR15) to nitro compounds was determined.
[0315] Experimental Example 4-1. Preparation of Expression Plasmid
[0316] < Comparative Example 14 Preparation of wild-type AgOR15 expression plasmid >
[0317] A double-stranded DNA with the coding sequence (base sequence: SEQ ID NO: 9) of wild-type AgOR15 (amino acid sequence: SEQ ID NO: 4) in any DNA strand was synthesized and introduced into pcDNA3.1 to obtain the wild-type AgOR15 expression plasmid (pcDNA3.1-AgOR15).
[0318] < Example 15 Preparation of mutant AgOR15 expression plasmid >
[0319] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 84) of a mutant AgOR15 (amino acid sequence: SEQ ID NO: 83) was constructed, consisting of amino acid residues 61-61 (methionine to threonine), 104-104 (cysteine to arginine), 112-112 (arginine to glutamine), 181-181 (glycine to alanine), 189-189 (valine to isoleucine), and 327-327 (isoleucine to valine) in the amino acid sequence of wild-type AgOR15. Specifically, using the wild-type AgOR15 expression plasmid as a template, a 6-fold mutant M61T-C104R-R112Q-G181A-V189I-I327V was constructed using the following primers.
[0320] M61T mutation introduction primer set
[0321] CCCGACCTTGAGATAACGATCATTGGCACCGCTG (base sequence: SEQ ID NO: 94) and CAGCGGTGCCAATGATCGTTATCTCAAGGTCGGG (base sequence: SEQ ID NO: 95)
[0322] C104R mutation introduction primer set
[0323] CCCAAACGGTTATCCGTGCGTCACCTCCCGCG (base sequence: SEQ ID NO: 96) and CGCGGGAGGTGACGCACGGATAACCGTTTGGG (base sequence: SEQ ID NO: 97)
[0324] R112Q mutation introduction primer set
[0325] CCTCCCGCGGTGGTCCAGCATTTGACGACCCAG (base sequence: SEQ ID NO: 98) and CTGGGTCGTCAAATGCTGGACCACCGCGGGAGG (base sequence: SEQ ID NO: 99)
[0326] Primer set for G181A mutation introduction
[0327] CAGACTCGCACCTCGGCTACGCACTACCTGATC (base sequence: SEQ ID NO: 100) and GATCAGGTAGTGCGTAGCCGAGGTGCGAGTCTG (base sequence: SEQ ID NO: 101)
[0328] Primer set for V189I mutation introduction
[0329] CTACCTGATCTTCGGTATCGTCATGACGCCTACC (base sequence: SEQ ID NO: 102) and GGTAGGCGTCATGACGATACCGAAGATCAGGTAG (base sequence: SEQ ID NO: 103)
[0330] I327V mutation introduction primer set
[0331] CGTGTAGCACATACCGTTTACGAAAGTGGCTGG (base sequence: SEQ ID NO: 104) and CCAGCCACTTTCGTAAACGGTATGTGCTACACG (base sequence: SEQ ID NO: 105).
[0332] Experiment 4-2. Introduction of expression plasmid into cells and activity assay
[0333] The expression plasmid was introduced into cells in the same manner as in Examples 1-2, and its activity was measured in the same manner as in Examples 1-3. 2-Nitroaniline was used as the test substance in this experiment.
[0334] The results are shown in Figure 8 It can be seen that the mutant Anopheles mosquito olfactory receptor 15 shows a nitro compound responsiveness. On the other hand, the wild-type Anopheles mosquito olfactory receptor 15 does not show a nitro compound responsiveness.
[0335] Experimental Example 5. Determination of the nitro compound responsiveness of AaOR4
[0336] The responsiveness of olfactory receptors (two wild-type AaOR4s) to nitro compounds was determined.
[0337] Experimental Example 5-1. Preparation of Expression Plasmids
[0338] < Comparative Example 15 Preparation of wild-type AaOR4 expression plasmid >
[0339] A double-stranded DNA with the coding sequence (base sequence: SEQ ID NO: 10) of wild-type AaOR4 type 1 (amino acid sequence: SEQ ID NO: 5) in any DNA strand was synthesized and introduced into pcDNA3.1 to obtain the wild-type AaOR4 type 1 expression plasmid (pcDNA3.1-AaOR4 type 1).
[0340] < Example 16 Preparation of wild-type AaOR4 expression plasmid >
[0341] A plasmid (pcDNA3.1) containing the coding sequence (base sequence: SEQ ID NO: 86) of wild-type AaOR4 type 2 (amino acid sequence: SEQ ID NO: 85), formed by mutating leucine to proline at amino acid residue 178 of the wild-type AaOR4 type 1 amino acid sequence, was prepared. Specifically, it was prepared as described below.
[0342] PCR primers (GGGTCAAGCTATTTCCGTACGTGATTTGGTTC (SEQ ID NO: 106), GAACCAAATCACGTACGGAAATAGCTTGACCC (SEQ ID NO: 107)) were synthesized and designed to replace leucine with proline at amino acid residue 178 of the wild-type AaOR4 amino acid sequence. Using these primers, PCR amplification was performed with pcDNA3.1-AaOR4 type 1 as a template (reaction sequence and conditions followed standard procedures). The amplified PCR reaction solution was digested with DpnI and transformed into *E. coli* (DH5α). The transformed *E. coli* were inoculated onto plates supplemented with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. The base sequence of the plasmids they retained was then determined, yielding the wild-type AaOR4 type 2 (L178P mutant) expression plasmid.
[0343] Experimental Example 5-2. Introduction of Expression Plasmid into Cells and Activity Assay
[0344] The expression plasmid was introduced into cells in the same manner as in Examples 1-2, and its activity was measured in the same manner as in Examples 1-3. In this example, 2,4-dinitrotoluene, 4-nitrotoluene, or toluene was used as the test substance.
[0345] The results are shown in Figure 9 It can be seen that wild-type AaOR4 type 2 exhibits nitro compound responsiveness. On the other hand, wild-type AaOR4 type 1 does not exhibit nitro compound responsiveness.
[0346] Test Example 6. Comparison with Existing Technology
[0347] It is known that cells infused with the mouse olfactory receptor Olfr256_17 respond to nitro compounds. Such cells are known to be produced by introducing plasmids encoding the mouse olfactory receptor Olfr256_17, the G protein (Gα15_olf), the receptor transporter (RTP1S), and GAP. Therefore, in this experimental example, such cells (mouse olfactory receptor-expressing cells) were produced, and their nitro compound responsiveness was compared with that of cells obtained in one embodiment of the present invention (cells infused with a mutant AgOR28 (T25K mutation, 22a.a deletion) (Example 2) (Experiments 1-2)).
[0348] First, expression plasmids for mouse olfactory receptor Olfr256_17 (amino acid sequence: SEQ ID NO: 87) (rho-myc-mOlfr256_17 / pcDNA3.1), Gα15_olf (amino acid sequence: SEQ ID NO: 88) (Ga15_olf / pBK-CMV), and RTPS (amino acid sequence: SEQ ID NO: 89) (mRTP1S / pcDNA3.1) were prepared by adding rho and myc tags to the N-terminus according to conventional methods.
[0349] In a 10cm petri dish, use 3×10 6 HEK293FT cells (purchased from Invitrogen) were seeded in DMEM medium (made by NACALAI TESQUE, INC.) containing 10% FBS and cultured at 37°C and 5% CO2 for approximately 24 hours. The prepared Ga15_olf / pBK-CMV (1 μg), rho-myc-mOlfr256_17 / pcDNA3.1 (2.5 μg), mRTP1S / pcDNA3.1 (1 μg), and GFP-jellyfish luminescent protein / pcDNA3.1 (8 μg) were mixed with 12.5 μL of Plus reagent and 31.25 μL of lipofectamine LTX (made by Invitrogen) and incubated for 10 minutes. This mixture was then transfected into the cells. Four hours after transfection, cells were cultured at a rate of 9 × 10⁶ cells / day. 4 Cells were seeded into 96-well plates and cultured in DMEM medium (made by NACALAI TESQUE, INC.) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. This yielded transformed cells (mouse olfactory receptor expression cells) transiently infused with mouse olfactory receptor Olfr256_17, G protein, receptor transporter expression plasmids, and GAP expression plasmids.
[0350] Cells incorporating the mutant AgOR28 (T25K mutation, 22a.a deletion) (Example 2) (Examples 1-2) and the mouse olfactory receptor expressing cells obtained above were used to measure activity in the same manner as in Examples 1-3. In this experiment, 3-nitrotoluene was used as the test substance.
[0351] The results are shown in Figure 10 It is known that the mutant AgOR28 (T25K mutation, 22a.a deletion) can detect nitro compounds with higher sensitivity and activity than mouse olfactory receptors.
[0352] Experimental Example 7. Introduction of amino acid mutations into the 7th transmembrane region
[0353] Similar to Example 4, an expression plasmid for mutant AgOR28 (T25K-P31T2 heavy mutation, 22a.a deletion) was created by further introducing amino acid substitutions (S368A, Q376A, R380A, S382L, S385A) into the 7th transmembrane region of mutant AgOR28 (T25K-P31T-S368A-Q376A-R380A-S382L-S385A7 heavy mutation, 22a.a deletion) using PCR-based mutation introduction technology. The expression plasmid was introduced into cells in the same manner as in Examples 1-2, and its activity was measured in the same manner as in Examples 1-3. 2,3-Dinitrotoluene was used as the test substance in this experiment.
[0354] The results are shown in Figure 11 It can be seen that the responsiveness of nitro compounds is enhanced by introducing mutations into the 7th transmembrane region. sequence list <110> Sumitomo Chemical Co., Ltd. <120> Nitro compound detection element <130> P21-106WO <150> JP 2020-126686 <151> 2020-07-27 <160> 109 <170> PatentIn version 3.5 <210> 1 <211> 420 <212> PRT <213> Anopheles gambiae <400> 1 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Thr Lys Ile Gln Asn Ser Pro Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Ile Ile Phe Arg Val Lys Met Leu Lys Gln Thr Lys 50 55 60 Gln Ile Ile His Phe Tyr Leu Ser Leu Gln Phe Thr Tyr Leu Val Val 65 70 75 80 Asp Thr Lys Ser Leu Ile Asp Phe Ile Ser Val Leu Val Pro Ile Thr 85 90 95 Glu Ile Leu Leu Thr Asn Gly Met Ile Ile Ile Cys Asn Val Lys Arg 100 105 110 Gly Lys Containing Asn Leu Containing Asn Gln Val Gln Value Only Trp Asp Glu 115 120 125 Cys Ala Lys Ser Glu His To Glu Ile Gln Thr To Ile Thr Thr 130 135 140 Ala Lys Lys Ser Lys Ile Phe Val Ile Tyr Thr Thr Ser Phe Leu 145 150 155 160 Lion With Cys Val Glu Tyr Ser Met Pro Lion Phe Lys Lion With Tyr 165 170 175 His Ser Ala Val Tyr Gly Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro 180 185 190 Tyr Leu Ser Arg Phe Ala Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala 195 200 205 Trp Thr Tyr Phe Phe Ile Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr 210 215 220 Leu Ser Gly Phe Asp Ser Leu Phe Ser Thr Leu Val Met His Ile Lys 225 230 235 240 Met Met Phe Lys Val Leu Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp 245 250 255 Leu Ser Ala Gly Lys Ser His Val Glu Leu Gln Ala Lys Leu Lys Gln 260 265 270 Ile Ile Leu Lys His Lys Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu 275 280 285 Asp Gly Phe Ser Phe Phe Leu Met Ala Gln Phe Leu Thr Ser Ser Ile 290 295 300 Leu Val Cys Val Val Leu Tyr Glu Leu Thr Met Val Phe Gly Trp Asn 305 310 315 320 Glu Asp Thr Phe Lys Thr Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln 325 330 335 Leu Phe Leu Phe Cys Trp Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg 340 345 350 Leu Val Ser Asp His Ile Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro 355 360 365 Lys Leu Gln Lys Asp Ile Leu Thr Phe Met Val Lys Ala Gln Lys Pro 370 375 380 Thr Gly Val Thr Ala Ser Lys Phe Tyr Met Val Thr Leu Gln Thr Phe 385 390 395 400 Gln Arg Ile Ser Ser Thr Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr 405 410 415 Ile Asn Gln Gln 420 <210> 2 <211> 387 <212> PRT <213> Anopheles gambiae <400> 2 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 3 <211> 405 <212> PRT <213> Anopheles gambiae <400> 3 Met Val Arg Leu Ser Phe Glu Glu Thr Leu Arg Asn Thr Asn Leu Met 1 5 10 15 Leu Leu Met Met Gly Ile Pro Cys Glu Glu Pro Tyr Pro Pro Gly 20 25 30 Val Leu Pro Ser Leu Lys Arg Asn Ala Gly Phe Ile Ala Ser Phe Leu 35 40 45 Leu Leu Ala Tyr Thr Thr Ile Gly Glu Leu Ile Tyr Leu Lys Gln Met 50 55 60 Phe Glu Arg Asp Val Thr Phe Leu Glu Val Thr Phe Gln Ala Pro Cys 65 70 75 80 Ile Gly Tyr Cys Thr Ile Gly Val Leu Lys Met Val Ile Leu Ala Arg 85 90 95 Gly Arg Asn Thr Ile Ala Glu Leu Val Gly Leu Phe Arg Ala Lys Trp 100 105 110 Thr Ser Ala Ile Val Thr Gly Ala His Trp Ala Val Cys Glu Asp Thr 115 120 125 Met Arg Pro Ala Ile Arg Val Thr Ser Val Thr Ala Leu Ala Asn Val 130 135 140 Val Met Gly Ile Ala Phe Thr Ile Leu Pro Ile Ala Glu Met Ile Tyr 145 150 155 160 Thr His His Tyr Thr Gly Arg Trp Asn Arg Gln Leu Ala Phe Asn Ile 165 170 175 Trp Trp Pro Phe Asp Val Leu Gly Gly Val Lys Tyr Tyr Trp Phe Val 180 185 190 Tyr Pro Leu Tyr Val Val Ile Gly Phe Thr Gly Ile Ile Ile His Met 195 200 205 Ala Phe Asp Cys Leu Phe Cys Ile Leu Ala Ala His Leu Cys Met Gln 210 215 220 Phe Arg Ile Leu Ala His Asn Phe Gly His Val Val Glu Val Ala Asn 225 230 235 240 Gly Ala Arg Glu Gly Asp Ser Gly Ser Thr Ser Arg Leu Arg Asp Ala 245 250 255 Ile Arg Ile His Gln Glu Leu Ile Gly Tyr Glu Gly Thr Pro Leu Asp 260 265 270 Ala Gly Val Asn Gln Trp Arg Asn Gly Tyr Met Leu Val Lys Phe Val 275 280 285 Leu Phe Met Leu Cys Phe Leu Ile Glu Leu Leu Met Leu Cys Ala Tyr 290 295 300 Gly Glu Asp Ile Val Glu Ser Val Arg His Gln Ala Val Met Ser Glu 305 310 315 320 Ser Arg Val Ile Glu Ala Phe Ala Phe Lys Thr His Gln Ser Leu Gly 325 330 335 Val Ile Asp Ala Ala Tyr Gly Cys Glu Trp Tyr Arg Glu Gly Ser Val 340 345 350 Ala Phe His Arg Ser Val Leu Gln Ile Ile His Arg Ser Gln Gln Ser 355 360 365 Val Ile Leu Thr Ala Trp Lys Ile Trp Pro Ile Gln Met Ser Thr Phe 370 375 380 Ser Gln Ile Leu Gln Ala Ser Trp Ser Tyr Phe Thr Leu Leu Lys Thr 385 390 395 400 Val Tyr Gly Asn Lys 405 <210> 4 <211> 387 <212> PRT <213> Anopheles gambiae <400> 4 Met Asn Phe Leu Arg Gln Glu Gln Pro Ala Gly Met Pro His Ile Ser 1 5 10 15 Ile Lys Leu Leu Arg Val Phe Gly Val Thr Asn His Ser Glu Glu Arg 20 25 30 Phe Arg Ile Val Pro Val Met Leu Ala Tyr Phe Phe Phe Ile Val Val 35 40 45 Pro Lys Cys Phe Phe Gly Tyr Pro Asp Leu Glu Ile Met Ile Ile Gly 50 55 60 Thr Ala Glu Leu Ile Phe Gln Thr Asn Ser Phe Cys Gly Met Phe Leu 65 70 75 80 Leu Phe Leu Asn Arg Arg Lys Leu Ala Glu Phe Ile Gln His Ala Arg 85 90 95 Ser Phe Ser Gln Thr Val Ile Cys Ala Ser Pro Pro Ala Val Val Arg 100 105 110 His Leu Thr Thr Gln His Asp Met Ile His Lys Ile Thr Arg Ile Phe 115 120 125 Cys Ile Val Val Met Phe Ala Ala His Phe Tyr Ala Leu Ala Pro Phe 130 135 140 Leu Ser Thr Leu Tyr Thr Phe Tyr Gly Thr Val Arg Asn Lys Asn Ala 145 150 155 160 Thr Met His Tyr Thr Leu Gln Met Glu Glu Asn Phe Tyr Gly Leu Gln 165 170 175 Thr Arg Thr Ser Gly Thr His Tyr Leu Ile Phe Gly Val Val Met Thr 180 185 190 Pro Thr Ala Tyr Leu Cys Ala Phe Thr Gly Thr Val Lys Thr Leu Thr 195 200 205 Ile Cys Asn Ile Thr Thr Tyr Cys Thr Leu Tyr Phe Gln Leu Val Gln 210 215 220 Leu Lys Leu Arg Thr Val Thr Gln Asp Asn Thr Phe Arg Gln Glu Leu 225 230 235 240 Lys Ser Val Ile Lys Met His Gln Asp Ala Leu Asn Cys Ala Ser Leu 245 250 255 Val Glu Ser Ile Thr Ser Leu Ala Leu Leu Gln Gln Leu Leu Leu Cys 260 265 270 Val Leu Ile Trp Ser Ser Met Leu Leu Tyr Phe Thr Val Ser Gly Phe 275 280 285 Asn Val Asn Phe Met Asn Leu Phe Val Leu Phe Val Phe Asp Thr Thr 290 295 300 Glu Thr Phe Ala Tyr Cys Tyr Leu Gly Glu Lys Leu Ser Tyr Glu Ser 305 310 315 320 Ala Arg Val Ala His Thr Ile Tyr Glu Ser Gly Trp Glu Thr Gln Thr 325 330 335 Thr Asp Ile Gln Lys Asp Leu Gln Leu Ile Leu Val Arg Ala Gln Ser 340 345 350 Pro Val Gly Ile Thr Ala Gly Lys Phe Tyr Tyr Met Asn Met Glu Gln 355 360 365 Phe Gly Ile Ile Val Lys Thr Thr Tyr Ser Phe Phe Val Ile Leu Arg 370 375 380 Asp Gln Ile 385 <210> 5 <211> 406 <212> PRT <213> Aedes aegypti <400> 5 Met Thr Gln Ser Leu Glu Phe Asp Gln Thr Phe Gly Phe Ile Ala Lys 1 5 10 15 Val Leu Gln Met Ile Gly Tyr Pro Ser Cys Leu Ala Pro Tyr Pro Thr 20 25 30 Thr Phe Ala Ser Arg Leu Lys Ser Ser Ala Gly Phe Val Val Cys Phe 35 40 45 Leu Met Leu Thr Tyr Cys Val Phe Gly Gln Ile Ile Asn Ile Gly Leu 50 55 60 Leu Met Met Gly His Arg Gln Thr Asp Gln Val Val Glu Glu Val Ala 65 70 75 80 Ile Gln Val Ser Ser Thr Gly Phe Cys Ile Ile Gly Leu Ala Lys Met 85 90 95 Tyr Ser Leu Ser Tyr Asn Arg Ala Ile Leu Ser Trp Leu Ile Ala Asp 100 105 110 Phe Arg Val Lys Trp Asn Ala Gly Glu Leu Thr Asp Lys Asp Arg Ser 115 120 125 Ile Arg Asp Gly Thr Leu Arg Pro Thr Val Ala Ile Thr Thr Val Ala 130 135 140 Ala Leu Gly Asn Ile Ile Met Val Ser Ala Phe Asn Phe Gln Pro Val 145 150 155 160 Val Glu Met Ile Tyr Gly Arg Val Val Thr Gly Glu Trp Val Lys Leu 165 170 175 Phe Leu Tyr Val Ile Trp Phe Pro Phe Asn Ser Thr His Gly Ala Ile 180 185 190 Tyr Tyr Leu Val Tyr Leu Phe Glu Val Tyr Ser Gly Val Ile Val Ala 195 200 205 Val Gly Asn Val Gly Phe Asn Cys Ile Phe Cys Leu Leu Thr Ser His 210 215 220 Leu Ser Met Gln Leu Lys Leu Leu Cys Ser Trp Ile Glu Asp Met Val 225 230 235 240 Glu Val Glu Asp Glu Lys Gly Val Gln Ser Lys Lys Lys Leu Tyr Arg 245 250 255 Ile Val Arg Tyr His Gln Asp Leu Ile Arg Gly Arg Asn Ala Leu Gln 260 265 270 Ser Met Phe Ser Thr Thr Leu Phe Leu Asn Phe Ser Ala Ser Ser Val 275 280 285 Leu Met Cys Met Gln Leu Tyr Leu Ile Thr Thr Ala Gly Ile Thr Leu 290 295 300 Met Val Lys Phe Thr Leu Phe Met Leu Cys Ile Leu Met Glu Ile Phe 305 310 315 320 Ile Leu Cys Tyr Tyr Gly Glu Glu Ile Leu Ala Asn Ser Ser Ser Ile 325 330 335 Ala Ala Gly Ala Phe Asn Ser Asn Trp Tyr Gln Ser Lys Val Ser Gln 340 345 350 Gln Asn Pro Arg Phe Gly Lys Asn Leu Ile Pro Ile Ile Gln Gln Gly 355 360 365 Gln Arg Pro Met Val Leu Thr Ala Trp Lys Phe Trp Pro Ile Thr Ile 370 375 380 Arg Thr Phe Ser Ala Ile Leu Gln Thr Ser Trp Ser Tyr Phe Thr Leu 385 390 395 400 Leu Lys Thr Val Met His 405 <210> 6 <211> 1263 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 WT <400> 6 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaccaagat ccagaacagc cccatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagatca tcttcagagt gaagatgctg 180 aagcagacca agcagatcat ccacttctac ctgagcctgc agttcaccta cctggtggtg 240 gacaccaaga gcctgatcga cttcatcagc gtgctggtgc ccatcaccga gatcctgctg 300 accaacggca agatgattat ctgcaacgtg aagcggggca agatcatcaa cctgatcaac 360 caggtgcagg tcgcctggga tgagtgtgcc aagtctgagc acctggaaat ccagacactg 420 atcaccacca ccgccaagaa aagcaagatc ttcgtgatta tctacaccac cagctttctg 480 ctgatctgcg tggaatactc cagcatgccc ctgttcaagc tgatctacca cagcgccgtg 540 tacggcaagc agagcaacta cacaatcgcc ctgccttacc tgagcagatt cgcctacagc 600 accgagagca ccacaagctt cgcctggacc tacttcttca tcctgatcgg cgtgtacctg 660 ctggccctga cactgagcgg cttcgatagc ctgtttagca ccctggtcat gcacatcaag 720 atgatgttca aggtgctgaa gttcgagatc gagcagctgg gcctcgatct gtctgccggc 780 aaatctcacg tggaactcca ggccaagctg aagcaaatca tcctgaagca caagaccaac 840 ctgtctctga ttgagcagct cgaggacggc ttttcattct tcctgatggc ccagttcctg 900 accagcagca tcctcgtgtg tgtggtgctg tacgagctga ccatggtgtt cggctggaac 960 gaggacacct tcaagaccgt gacatacctg cctggcgcta tcctgcagct gttcctgttc 1020 tgttggtacg cccagcagat caccgaagag gccaggctgg tgtccgatca catctacaac 1080 atcccttggt atctggctga ccccaagctg cagaaggaca tcctgacctt catggtcaag 1140 gcccagaaac ctaccggcgt gaccgccagc aagttctaca tggtcaccct gcagaccttc 1200 cagagaatca gcagcacctc ctacagctac ttcaccctgc tgcagaccat caaccagcag 1260 taa 1263 <210> 7 <211> 1164 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 WT <400> 7 Ala Thr Gly Gly Thr Gly Gly Thr Gly Thr Thr Cys Gly Ala Cys Cys 1 5 10 15 Cys Thr Cys Thr Gly Gly Ala Cys Gly Ala Thr Cys Cys Cys Cys Thr 20 25 30 Gly Ala Ala Ala Gly Thr Gly Cys Thr Gly Cys Cys Thr Cys Thr Gly 35 40 45 Cys Cys Thr Cys Thr Gly Ala Ala Ala Cys Thr Gly Cys Thr Gly Gly 50 55 60 Cys Cys Cys Thr Gly Cys Thr Gly Gly Gly Cys Gly Thr Gly Ala Ala 65 70 75 80 Cys Ala Ala Gly Ala Ala Cys Cys Cys Thr Ala Gly Cys Gly Ala Gly 85 90 95 Cys Gly Gly Thr Thr Cys Ala Gly Ala Cys Thr Gly Thr Ala Cys Gly 100 105 110 Cys Cys Ala Thr Cys Thr Ala Cys Gly Cys Cys Thr Ala Cys Cys Thr 115 120 125 Gly Thr Gly Thr Ala Thr Cys Gly Cys Cys Cys Thr Gly Thr Thr Cys 130 135 140 Ala Thr Cys Cys Cys Cys Ala Ala Gly Cys Thr Gly Thr Gly Cys Cys 145 150 155 160 Thr Gly Gly Gly Cys Thr Ala Cys Gly Ala Gly Ala Cys Ala Ala Thr 165 170 175 Cys Cys Thr Gly Cys Ala Gly Thr Gly Cys Thr Thr Cys Cys Gly Gly 180 185 190 Thr Cys Thr Ala Thr Cys Gly Cys Cys Gly Ala Gly Gly Gly Cys Ala 195 200 205 Thr Gly Cys Thr Gly Ala Gly Cys Thr Thr Cys Ala Ala Thr Ala Cys 210 215 220 Cys Ala Cys Cys Ala Thr Cys Ala Cys Cys Thr Thr Cys Ala Thr Cys 225 230 235 240 Ala Thr Gly Cys Thr Gly Cys Cys Cys Cys Thr Gly Ala Ala Gly Ala 245 250 255 Thr Gly Gly Ala Cys Ala Ala Cys Cys Thr Gly Gly Ala Ala Gly Ala 260 265 270 Thr Cys Thr Gly Cys Thr Gly Ala Ala Gly Ala Ala Cys Cys Thr Gly 275 280 285 Ala Ala Gly Cys Gly Gly Thr Thr Cys Ala Cys Cys Gly Ala Gly Ala 290 295 300 Thr Cys Gly Thr Gly Ala Thr Cys Thr Thr Cys Ala Ala Cys Gly Ala 305 310 315 320 Gly Gly Ala Cys Thr Ala Cys Gly Ala Gly Cys Ala Gly Ala Thr Cys 325 330 335 Cys Thr Gly Ala Thr Cys Cys Gly Gly Cys Thr Gly Ala Ala Cys Ala 340 345 350 Cys Cys Gly Cys Cys Ala Thr Cys Cys Ala Cys Ala Ala Gly Thr Thr 355 360 365 Cys Ala Cys Cys Ala Ala Gly Thr Ala Cys Thr Ala Cys Thr Thr Cys 370 375 380 Ala Thr Cys Thr Thr Cys Ala Cys Cys Ala Ala Cys Gly Gly Cys Ala 385 390 395 400 Thr Cys Gly Thr Gly Thr Thr Cys Gly Cys Cys Ala Thr Gly Ala Cys 405 410 415 Cys Ala Gly Cys Thr Cys Thr Ala Cys Ala Ala Thr Cys Gly Cys Cys 420 425 430 Gly Gly Cys Ala Thr Gly Thr Thr Cys Thr Ala Cys Ala Cys Cys Thr 435 440 445 Ala Cys Thr Ala Cys Gly Cys Cys Ala Ala Gly Gly Ala Cys Ala Gly 450 455 460 Cys Gly Ala Gly Thr Ala Cys Ala Gly Cys Gly Cys Cys Gly Cys Cys 465 470 475 480 Thr Thr Thr Cys Cys Thr Cys Thr Gly Ala Thr Cys Ala Thr Gly Gly 485 490 495 Ala Ala Ala Ala Cys Cys Gly Gly Cys Thr Gly Thr Ala Cys Cys Thr 500 505 510 Gly Ala Thr Cys Gly Ala Cys Ala Gly Cys Cys Ala Cys Thr Ala Cys 515 520 525 Ala Ala Cys Cys Thr Gly Gly Gly Cys Cys Ala Cys Thr Gly Cys Thr 530 535 540 Thr Cys Gly Thr Gly Cys Ala Cys Cys Ala Gly Gly Cys Thr Cys Thr 545 550 555 560 Gly Ala Thr Gly Thr Thr Cys Thr Thr Thr Gly Cys Cys Cys Thr Gly 565 570 575 Thr Ala Cys Ala Thr Cys Cys Thr Gly Cys Thr Cys Gly Thr Gly Ala 580 585 590 Thr Gly Thr Thr Cys Ala Cys Cys Gly Cys Cys Ala Ala Gly Gly Cys 595 600 605 Cys Gly Gly Cys Ala Cys Ala Cys Thr Gly Thr Thr Cys Gly Gly Cys 610 615 620 Cys Thr Gly Ala Thr Cys Ala Gly Ala Thr Thr Cys Thr Gly Thr Ala 625 630 635 640 Gly Cys Ala Cys Cys Gly Thr Gly Cys Thr Gly Gly Gly Cys Ala Thr 645 650 655 Cys Ala Thr Cys Gly Thr Gly Cys Thr Gly Ala Ala Gly Ala Thr Cys 660 665 670 Gly Ala Gly Cys Gly Gly Cys Thr Gly Thr Cys Thr Cys Ala Gly Ala 675 680 685 Thr Cys Gly Gly Cys Cys Cys Cys Gly Thr Gly Gly Ala Thr Ala Ala 690 695 700 Gly Thr Ala Thr Ala Cys Cys Gly Cys Cys Gly Ala Gly Cys Thr Gly 705 710 715 720 Ala Ala Cys Gly Ala Gly Ala Thr Cys Ala Thr Cys Gly Ala Gly Cys 725 730 735 Thr Gly Cys Ala Cys Cys Ala Gly Cys Thr Gly Gly Cys Cys Ala Thr 740 745 750 Cys Ala Ala Gly Thr Gly Cys Ala Gly Cys Ala Gly Ala Cys Ala Gly 755 760 765 Cys Thr Gly Cys Ala Gly Ala Ala Cys Ala Thr Cys Cys Thr Gly Ala 770 775 780 Thr Gly Gly Ala Ala Ala Thr Cys Cys Thr Gly Cys Thr Gly Gly Cys 785 790 795 800 Thr Cys Ala Gly Thr Thr Cys Ala Cys Cys Gly Gly Cys Thr Gly Cys 805 810 815 Gly Thr Gly Thr Thr Cys Ala Thr Cys Thr Gly Gly Thr Gly Cys Thr 820 825 830 Thr Cys Ala Thr Gly Cys Thr Gly Thr Ala Cys Thr Ala Cys Gly Thr 835 840 845 Gly Ala Thr Gly Ala Thr Cys Ala Gly Cys Gly Gly Cys Ala Thr Cys 850 855 860 Ala Cys Cys Gly Cys Cys Gly Ala Gly Gly Gly Ala Ala Thr Thr Gly 865 870 875 880 Cys Cys Gly Thr Gly Gly Thr Gly Gly Cys Thr Ala Thr Gly Cys Thr 885 890 895 Gly Ala Thr Thr Gly Cys Cys Cys Thr Gly Thr Cys Thr Ala Cys Cys 900 905 910 Gly Ala Gly Ala Cys Thr Thr Thr Cys Ala Thr Cys Thr Thr Cys Thr 915 920 925 Gly Cys Cys Thr Gly Cys Thr Gly Gly Gly Ala Ala Ala Cys Gly Ala 930 935 940 Gly Cys Thr Gly Ala Cys Cys Cys Thr Gly Ala Ala Ala Gly Gly Cys 945 950 955 960 Cys Thr Gly Gly Ala Ala Ala Thr Cys Ala Gly Cys Ala Cys Cys Gly 965 970 975 Cys Cys Ala Thr Gly Thr Ala Cys Thr Thr Cys Ala Cys Ala Ala Ala 980 985 990 Thr Thr Gly Gly Thr Ala Cys Gly Ala Cys Cys Ala Gly Cys Cys Thr 995 1000 1005 Gly Thr Gly Ala Ala Gly Cys Thr Cys Cys Ala Gly Ala Ala Ala 1010 1015 1020 Ala Thr Gly Gly Thr Gly Gly Thr Gly Cys Cys Cys Ala Thr Cys 1025 1030 1035 Ala Thr Cys Cys Ala Gly Cys Ala Gly Thr Cys Cys Cys Ala Gly 1040 1045 1050 Cys Ala Gly Ala Gly Ala Ala Thr Cys Gly Gly Ala Ala Thr Cys 1055 1060 1065 Ala Cys Ala Gly Cys Cys Gly Cys Cys Ala Ala Gly Thr Thr Cys 1070 1075 1080 Thr Ala Cys Thr Ala Cys Ala Thr Cys Gly Ala Cys Thr Ala Cys 1085 1090 1095 Ala Ala Cys Ala Gly Ala Thr Ala Cys Gly Gly Cys Cys Ala Gly 1100 1105 1110 Ala Gly Cys Cys Thr Gly Ala Ala Ala Ala Cys Cys Gly Cys Cys 1115 1120 1125 Thr Ala Cys Ala Gly Cys Thr Thr Cys Thr Ala Cys Cys Thr Gly 1130 1135 1140 Cys Thr Gly Cys Thr Gly Ala Ala Gly Gly Ala Cys Ala Thr Cys 1145 1150 1155 Thr Thr Cys Thr Gly Ala 1160 <210> 8 <211> 1218 <212> DNA <213> Artificial Sequence <220> <223> AgOR6 WT <400> 8 atggtacgtc taagctttga agaaacgctt cgaaacacca acctgatgct actgatgatg 60 ggcattccac cgtgcgagga gccgtacccg ccgggcgtac tgccgtcgct caaacgcaac 120 gcgggcttca tcgcgtcctt cctgctgctc gcctacacca cgatcggtga gctgatctat 180 ctgaagcaga tgttcgagcg ggacgttacc ttcctggagg taacctttca agcgccctgc 240 atcgggtact gcaccatcgg tgtgctgaag atggtcatac tggcccgggg aaggaacacg atcgccgagc tggtcggttt gtttcgcgca aagtggacgt cggcgattgt aaccggtgcg 360 cattgggcgg tgtgcgagga cacaatgcgg cccgccattc gggtcacctc ggtaacggcg 420 ctcgcgaacg tcgtgatggg gatagcgttc accatcctgc cgatcgcgga gatgatctc 480 acccatcact acacgggccg gtggaaccgt cagcttgcct tcaacatctg gtggccgttc 540 gatgtgctgg gtggcgtaaa gtactactgg ttcgtctatc cactgtacgt cgtgattggg 600 ttcacgggca tcatcatcca tatggcgttc gactgtttgt tctgcatact ggcggcccat 660 ctctgtatgc agtttcgcat cctggcgcac aactttggcc atgtggtaga ggttgccat 720 ggtgctcgtg aaggtgacag tggcagtacg agtcggctac gggatgcgat cagaatccat caggagttga ttgggtacga aggaacccca ttggatgcgg gagtaatca atggcgtac ggatatatgc tggtaaagtt tgtcctcttc atgctgtgct ttctgatcga gctgctgatg 900 ctgtgtgcgt acggtgagga tattgtggaa tcggtaaggc accaggcggt gatgagcgag 960 tcgcgagtaa ttgaagcttt tgcttttaaa acacatcaga gccttggggt gattgatgcc 1020 gcttacggtt gcgaatggta ccgggaaggg tcggtggcgt tccatcgatc cgtgctgcaa 1080 attatacacc gcagccagca gtccgtcata ctgaccgcat ggaaaatttg gcccatccaa 1140 atgagtactt tcagtcagat cctgcaagct tcctggtcct actttaccct cctgaagacc 1200 gtctacggga ataagtaa 1218 <210> 9 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR15 WT <400> 9 atgaacttcc taagacagga gcaaccggct ggcatgcctc atatctccat caagctgctc 60 cgggtatttg gcgttaccaa ccattcagag gaacgctttc gtatcgtgcc ggttatgctg 120 gcctactttt tcttcatagt agtgcccaag tgcttcttcg gatatcccga ccttgagata 180 atgatcattg gcaccgctga gctgattttc caaaccaact ccttttgcgg aatgtttctg 240 ttgtttctga acagacgcaa actggctgag ttcattcaac atgctagaag tttctcccaa 300 acggttatct gtgcgtcacc tcccgcagtg gtccggcatt tgacgaccca gcacgacatg 360 atccacaaga taaccagaat cttctgcatc gtagtgatgt ttgcagctca cttctacgca 420 ttagctcctt ttctttctac actttacacg ttttacggta cggtacggaa caaaaacgca 480 accatgcact acacgctgca aatggaggaa aacttctacg gactacagac tcgcacctcg 540 ggtacgcact acctgatctt cggtgtcgtc atgacgccta ccgcgtatct ctgtgccttt 600 accggcacgg tgaagactct aaccatctgt aatattacta cctactgtac cctttacttt 660 caactggtac aactgaagct acgaaccgtc acgcaagaca acacgttccg ccaggagttg 720 aagtcggtga tcaagatgca tcaggatgca cttaactgtg caagtctggt agaatctatc 780 acgtcactag cgctattaca gcaactgctt ctatgcgtat tgatctggag ctcaatgctg 840 ctttacttca ccgtatcggg attcaatgtg aactttatga accttttcgt actgttcgtg 900 ttcgacacaa cggaaacctt tgcctactgt tatcttgggg aaaagctatc gtacgagagt 960 gctcgtgtag cacataccat ttacgaaagt gggtgggaaa ctcaaaccac cgacatacag 1020 aaagatcttc agctaattct tgtccgtgct caaagtccag ttggcatcac tgctggaaag 1080 ttttactaca tgaacatgga acagtttggc attatagtaa aaactaccta ctcgttcttt 1140 gtgatattgc gggatcagat ttaa 1164 <210> 10 <211> 1221 <212> DNA <213> Artificial Sequence <220> <223> AaOR4 WT <400> 10 atgactcaat cccttgagtt tgaccaaacc tttggcttca tcgccaaggt cttgcaaatg 60 atcggttatc caagctgttt agcaccgtac ccaacgacct tcgccagtcg actcaagtcc 120 agtgccggtt tcgtggtatg cttcctcatg ttgacctatt gcgttttcgg tcagatcatc 180 aacatcggcc tgctgatgat gggtcaccgc cagacggatc aggtcgtcga agaggtcgcc 240 atccaggtca gcagcacagg cttttgcatc atcggactgg cgaagatgta cagtttgtcg 300 tacaaccggg ccattctgag ctggctcatt gcggacttca gagtcaagtg gaatgccggg 360 gaactcacag ataaggaccg ttccatacgg gacgggacgt tacgtccaac ggtggccatt 420 acgactgtag cggcattagg gaacatcata atggtgtcgg cgttcaactt tcaaccggtg 480 gtggagatga tctacggtcg ggtggttacc ggagaatggg tcaagctatt tctgtacgtg 540 atttggttcc ctttcaattc gactcacggg gcgatctact atctggtgta cttgtttgag 600 gttattcgg gagttagt ggccgttgga aacgtggggt tcaactgtat cttctgtttg 660 ctgacttcac acttgtcgat gcagttaaag ctgttgtgca gttggatcga ggatatggtt 720 gaagttgagg acgagaaggg ggtgcaatcg aagaagaagc tctacaggat tgtgcggtat 780 catcaggact tgatcagagg aaggaatgcg ttacaatcaa tgttcagcac aacgctgttc 840 ctgaacttct ccgcaagttc tgttctgatg tgcatgcagc tttacctcat aactaccgca 900 ggcattactc tgatggtcaa gttactctt ttcatgcttt gtattttgat ggagatttc 960 attctctgct actacggtga agagattctc gctaatatagtt catcgattgc cgctggagcg 1020 ttcaactcga attggtacca gtcgaaggtg agccaacaga atcctcgttt tggcaaaaat 1080 ttgattccga ttatccagca agggcagagg cccatggttc tgacggcgtg gaagttttgg 1140 cccataacca ttcggacgtt cagcgccata ttgcaaacat catggtccta ttttaccttg 1200 ctgaaaactg taatgcatta g 1221 <210> 11 <211> 420 <212> PRT <213> Artificial Sequence <220> <223> AgOR28 T25K <400> 11 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Lys Lys Ile Gln Asn Ser Pro Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Ile Ile Phe Arg Val Lys Met Leu Lys Gln Thr Lys 50 55 60 Gln Ile Ile His Phe Tyr Leu Ser Leu Gln Phe Thr Tyr Leu Val Val 65 70 75 80 Asp Thr Lys Ser Leu Ile Asp Phe Ile Ser Val Leu Val Pro Ile Thr 85 90 95 Glu Ile Leu Leu Thr Asn Gly Lys Met Ile Ile Cys Asn Val Lys Arg 100 105 110 Gly Lys Ile Ile Asn Leu Ile Asn Gln Val Gln Val Ala Trp Asp Glu 115 120 125 Cys Ala Lys Ser Glu His Leu Glu Ile Gln Thr Leu Ile Thr Thr Thr 130 135 140 Ala Lys Lys Ser Lys Ile Phe Val Ile Ile Tyr Thr Thr Ser Phe Leu 145 150 155 160 Leu Ile Cys Val Glu Tyr Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr 165 170 175 His Ser Ala Val Tyr Gly Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro 180 185 190 Tyr Leu Ser Arg Phe Ala Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala 195 200 205 Trp Thr Tyr Phe Phe Ile Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr 210 215 220 Leu Ser Gly Phe Asp Ser Leu Phe Ser Thr Leu Val Met His Ile Lys 225 230 235 240 Met Met Phe Lys Val Leu Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp 245 250 255 Leu Ser Ala Gly Lys Ser His Val Glu Leu Gln Ala Lys Leu Lys Gln 260 265 270 Ile Ile Leu Lys His Lys Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu 275 280 285 Asp Gly Phe Ser Phe Phe Leu Met Ala Gln Phe Leu Thr Ser Ser Ile 290 295 300 Leu Val Cys Val Val Leu Tyr Glu Leu Thr Met Val Phe Gly Trp Asn 305 310 315 320 Glu Asp Thr Phe Lys Thr Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln 325 330 335 Leu Phe Leu Phe Cys Trp Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg 340 345 350 Leu Val Ser Asp His Ile Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro 355 360 365 Lys Leu Gln Lys Asp Ile Leu Thr Phe Met Val Lys Ala Gln Lys Pro 370 375 380 Thr Gly Val Thr Ala Ser Lys Phe Tyr Met Val Thr Leu Gln Thr Phe 385 390 395 400 Gln Arg Ile Ser Ser Thr Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr 405 410 415 Ile Asn Gln Gln 420 <210> 12 <211> 1263 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 T25K <400> 12 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaagaagat ccagaacagc cccatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagatca tcttcagagt gaagatgctg 180 aagcagacca agcagatcat ccacttctac ctgagcctgc agttcaccta cctggtggtg 240 gacaccaaga gcctgatcga cttcatcagc gtgctggtgc ccatcaccga gatcctgctg 300 accaacggca agatgattat ctgcaacgtg aagcggggca agatcatcaa cctgatcaac 360 caggtgcagg tcgcctggga tgagtgtgcc aagtctgagc acctggaaat ccagacactg 420 atcaccacca ccgccaagaa aagcaagatc ttcgtgatta tctacaccac cagctttctg 480 ctgatctgcg tggaatactc cagcatgccc ctgttcaagc tgatctacca cagcgccgtg 540 tacggcaagc agagcaacta cacaatcgcc ctgccttacc tgagcagatt cgcctacagc 600 accgagagca ccacaagctt cgcctggacc tacttcttca tcctgatcgg cgtgtacctg 660 ctggccctga cactgagcgg cttcgatagc ctgtttagca ccctggtcat gcacatcaag 720 atgatgttca aggtgctgaa gttcgagatc gagcagctgg gcctcgatct gtctgccggc 780 aaatctcacg tggaactcca ggccaagctg aagcaaatca tcctgaagca caagaccaac 840 ctgtctctga ttgagcagct cgaggacggc ttttcattct tcctgatggc ccagttcctg 900 accagcagca tcctcgtgtg tgtggtgctg tacgagctga ccatggtgtt cggctggaac 960 gaggacacct tcaagaccgt gacatacctg cctggcgcta tcctgcagct gttcctgttc 1020 tgttggtacg cccagcagat caccgaagag gccaggctgg tgtccgatca catctacaac 1080 atcccttggt atctggctga ccccaagctg cagaaggaca tcctgacctt catggtcaag 1140 gcccagaaac ctaccggcgt gaccgccagc aagttctaca tggtcaccct gcagaccttc 1200 cagagaatca gcagcacctc ctacagctac ttcaccctgc tgcagaccat caaccagcag 1260 taa 1263 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 13 cagaggcatg gccaagaaga tccagaacag c 31 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 14 gctgttctgg atcttcttgg ccatgcctct g 31 <210> 15 <211> 420 <212> PRT <213> Artificial Sequence <220> <223> AgOR28 P31T <400> 15 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Thr Lys Ile Gln Asn Ser Thr Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Ile Ile Phe Arg Val Lys Met Leu Lys Gln Thr Lys 50 55 60 Gln Ile Ile His Phe Tyr Leu Ser Leu Gln Phe Thr Tyr Leu Val Val 65 70 75 80 Asp Thr Lys Ser Leu Ile Asp Phe Ile Ser Val Leu Val Pro Ile Thr 85 90 95 Glu Ile Leu Leu Thr Asn Gly Lys Met Ile Ile Cys Asn Val Lys Arg 100 105 110 Gly Lys Ile Ile Asn Leu Ile Asn Gln Val Gln Val Ala Trp Asp Glu 115 120 125 Cys Ala Lys Ser Glu His Leu Glu Ile Gln Thr Leu Ile Thr Thr Thr 130 135 140 Ala Lys Lys Ser Lys Ile Phe Val Ile Ile Tyr Thr Thr Ser Phe Leu 145 150 155 160 Leu Ile Cys Val Glu Tyr Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr 165 170 175 His Ser Ala Val Tyr Gly Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro 180 185 190 Tyr Leu Ser Arg Phe Ala Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala 195 200 205 Trp Thr Tyr Phe Phe Ile Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr 210 215 220 Leu Ser Gly Phe Asp Ser Leu Phe Ser Thr Leu Val Met His Ile Lys 225 230 235 240 Met Met Phe Lys Val Leu Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp 245 250 255 Leu Ser Ala Gly Lys Ser His Val Glu Leu Gln Ala Lys Leu Lys Gln 260 265 270 Ile Ile Leu Lys His Lys Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu 275 280 285 Asp Gly Phe Ser Phe Phe Leu Met Ala Gln Phe Leu Thr Ser Ser Ile 290 295 300 Leu Val Cys Val Val Leu Tyr Glu Leu Thr Met Val Phe Gly Trp Asn 305 310 315 320 Glu Asp Thr Phe Lys Thr Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln 325 330 335 Leu Phe Leu Phe Cys Trp Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg 340 345 350 Leu Val Ser Asp His Ile Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro 355 360 365 Lys Leu Gln Lys Asp Ile Leu Thr Phe Met Val Lys Ala Gln Lys Pro 370 375 380 Thr Gly Val Thr Ala Ser Lys Phe Tyr Met Val Thr Leu Gln Thr Phe 385 390 395 400 Gln Arg Ile Ser Ser Thr Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr 405 410 415 Ile Asn Gln Gln 420 <210> 16 <211> 1263 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 P31T <400> 16 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaccaagat ccagaacagc accatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagatca tcttcagagt gaagatgctg 180 aagcagacca agcagatcat ccacttctac ctgagcctgc agttcaccta cctggtggtg 240 gacaccaaga gcctgatcga cttcatcagc gtgctggtgc ccatcaccga gatcctgctg 300 accaacggca agatgattat ctgcaacgtg aagcggggca agatcatcaa cctgatcaac 360 caggtgcagg tcgcctggga tgagtgtgcc aagtctgagc acctggaaat ccagacactg 420 atcaccacca ccgccaagaa aagcaagatc ttcgtgatta tctacaccac cagctttctg 480 ctgatctgcg tggaatactc cagcatgccc ctgttcaagc tgatctacca cagcgccgtg 540 tacggcaagc agagcaacta cacaatcgcc ctgccttacc tgagcagatt cgcctacagc 600 accgagagca ccacaagctt cgcctggacc tacttcttca tcctgatcgg cgtgtacctg 660 ctggccctga cactgagcgg cttcgatagc ctgtttagca ccctggtcat gcacatcaag 720 atgatgttca aggtgctgaa gttcgagatc gagcagctgg gcctcgatct gtctgccggc 780 aaatctcacg tggaactcca ggccaagctg aagcaaatca tcctgaagca caagaccaac 840 ctgtctctga ttgagcagct cgaggacggc ttttcattct tcctgatggc ccagttcctg 900 accagcagca tcctcgtgtg tgtggtgctg tacgagctga ccatggtgtt cggctggaac 960 gaggacacct tcaagaccgt gacatacctg cctggcgcta tcctgcagct gttcctgttc 1020 tgttggtacg cccagcagat caccgaagag gccaggctgg tgtccgatca catctacaac 1080 atcccttggt atctggctga ccccaagctg cagaaggaca tcctgacctt catggtcaag 1140 gcccagaaac ctaccggcgt gaccgccagc aagttctaca tggtcaccct gcagaccttc 1200 cagagaatca gcagcacctc ctacagctac ttcaccctgc tgcagaccat caaccagcag 1260 taa 1263 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 cagatccaga acagcaccat cgacctgtac gtg 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 cacgtacagg tcgatggtgc tgttctggat ctg 33 <210> 19 <211> 420 <212> PRT <213> Artificial Sequence <220> <223> AgOR28 T25K, P31T <400> 19 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Lys Lys Ile Gln Asn Ser Thr Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Ile Ile Phe Arg Val Lys Met Leu Lys Gln Thr Lys 50 55 60 Gln Ile Ile His Phe Tyr Leu Ser Leu Gln Phe Thr Tyr Leu Val Val 65 70 75 80 Asp Thr Lys Ser Leu Ile Asp Phe Ile Ser Val Leu Val Pro Ile Thr 85 90 95 Glu Ile Leu Leu Thr Asn Gly Lys Met Ile Ile Cys Asn Val Lys Arg 100 105 110 Gly Lys Ile Ile Asn Leu Ile Asn Gln Val Gln Val Ala Trp Asp Glu 115 120 125 Cys Ala Lys Ser Glu His Leu Glu Ile Gln Thr Leu Ile Thr Thr Thr 130 135 140 Ala Lys Lys Ser Lys Ile Phe Val Ile Ile Tyr Thr Thr Ser Phe Leu 145 150 155 160 Leu Ile Cys Val Glu Tyr Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr 165 170 175 His Ser Ala Val Tyr Gly Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro 180 185 190 Tyr Leu Ser Arg Phe Ala Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala 195 200 205 Trp Thr Tyr Phe Phe Ile Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr 210 215 220 Leu Ser Gly Phe Asp Ser Leu Phe Ser Thr Leu Val Met His Ile Lys 225 230 235 240 Met Met Phe Lys Val Leu Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp 245 250 255 Leu Ser Ala Gly Lys Ser His Val Glu Leu Gln Ala Lys Leu Lys Gln 260 265 270 Ile Ile Leu Lys His Lys Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu 275 280 285 Asp Gly Phe Ser Phe Phe Leu Met Ala Gln Phe Leu Thr Ser Ser Ile 290 295 300 Leu Val Cys Val Val Leu Tyr Glu Leu Thr Met Val Phe Gly Trp Asn 305 310 315 320 Glu Asp Thr Phe Lys Thr Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln 325 330 335 Leu Phe Leu Phe Cys Trp Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg 340 345 350 Leu Val Ser Asp His Ile Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro 355 360 365 Lys Leu Gln Lys Asp Ile Leu Thr Phe Met Val Lys Ala Gln Lys Pro 370 375 380 Thr Gly Val Thr Ala Ser Lys Phe Tyr Met Val Thr Leu Gln Thr Phe 385 390 395 400[[ID= XVI]]<00016 XVI>[[ID= XVII]]<00016 XVII>[[ID= XVIII]]<00016 XVIII>[[ID= XIX]]<00016 XIX>[[ID= XX]]<00016 XX>[[ID= XXI]]<00016 XXI>[[ID= XXII]]<00016 XXII>[[ID= XXIII]]<00016 XXIII>[[ID= XXIV]]<00016 XXIV>[[ID= XXV]]<210> 20[[ID= XXVI]]<00016 XXVI>[[ID= XXVII]]<211> 1263[[ID= XXVIII]]<00016 XXVIII>[[ID= XXIX]]<212> DNA[[ID= XXX]]<00016 XXX>[[ID= XXXI]]<213> Artificial Sequence[[ID= XXXII]]<00016 XXXII>[[ID= XXXIII]]<220>[[ID= XXXIV]]<00016 XXXIV>[[ID= XXXV]]<223> AgOR28 T25K, P31T[[ID= XXXVI]]<00016 XXXVI>[[ID= XXXVII]]<400> 20[[ID= XXXVIII]]<00016 XXXVIII>[[ID= XXXIX]]atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60[[ID= XL]]<00016 XL>[[ID= XLI]]agaggcatgg ccaagaagat ccagaacagc accatcgacc tgtacgtgta ctggttcctg 120[[ID= XLII]]<00016 XLII>[[ID= XLIII]]acattcatcc ctatcgccag cctgtgcgtg ccccagatca tcttcagagt gaagatgctg 180[[ID= XLIV]]<00016 XLIV>aagcagacca agcagatcat ccacttctac ctgagcctgc agttcaccta cctggtggtg 240 gacaccaaga gcctgatcga cttcatcagc gtgctggtgc ccatcaccga gatcctgctg 300 accaacggca agatgattat ctgcaacgtg aagcggggca agatcatcaa cctgatcaac 360 caggtgcagg tcgcctggga tgagtgtgcc aagtctgagc acctggaaat ccagacactg 420 atcaccacca ccgccaagaa aagcaagatc ttcgtgatta tctacaccac cagctttctg 480 ctgatctgcg tggaatactc cagcatgccc ctgttcaagc tgatctacca cagcgccgtg 540 tacggcaagc agagcaacta cacaatcgcc ctgccttacc tgagcagatt cgcctacagc 600 accgagagca ccacaagctt cgcctggacc tacttcttca tcctgatcgg cgtgtacctg 660 ctggccctga cactgagcgg cttcgatagc ctgtttagca ccctggtcat gcacatcaag 720 atgatgttca aggtgctgaa gttcgagatc gagcagctgg gcctcgatct gtctgccggc 780 aaatctcacg tggaactcca ggccaagctg aagcaaatca tcctgaagca caagaccaac 840 ctgtctctga ttgagcagct cgaggacggc ttttcattct tcctgatggc ccagttcctg 900 accagcagca tcctcgtgtg tgtggtgctg tacgagctga ccatggtgtt cggctggaac 960 accagcagca tcctcgtgtg tgtggtgctg tacgagctga ccatggtgtt cggctggaac 960 gaggacacct tcaagaccgt gacatacctg cctggcgcta tcctgcagct gttcctgttc 1020 gaggacacct tcaagaccgt gacatacctg cctggcgcta tcctgcagct gttcctgttc 1020 tgttggtacg cccagcagat caccgaagag gccaggctgg tgtccgatca catctacaac 1080 tgttggtacg cccagcagat caccgaagag gccaggctgg tgtccgatca catctacaac 1080 atcccttggt atctggctga ccccaagctg cagaaggaca tcctgacctt catggtcaag 1140 atcccttggt atctggctga ccccaagctg cagaaggaca tcctgacctt catggtcaag 1140 gcccagaaac ctaccggcgt gaccgccagc aagttctaca tggtcaccct gcagaccttc 1200 gcccagaaac ctaccggcgt gaccgccagc aagttctaca tggtcaccct gcagaccttc 1200 cagagaatca gcagcacctc ctacagctac ttcaccctgc tgcagaccat caaccagcag 1260 cagagaatca gcagcacctc ctacagctac ttcaccctgc tgcagaccat caaccagcag 1260 taa 1263 taa 1263 <210> 21<210> 21 <211> 398<211> 398 <212> PRT<212> PRT <213> 人工序列(Artificial Sequence)<213> Artificial Sequence <220><220> <223> AgOR28 22a.a del <223> AgOR28 22a.a del <400> 21 <400> 21 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Thr Lys Ile Gln Asn Ser Pro Ile Leu Tyr Ile Ser Arg Gly Met Ala Thr Lys Ile Gln Asn Ser Pro Ile 20 25 30 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 35 40 45 Cys Val Pro Gln Phe Thr Tyr Leu Val Val Asp Thr Lys Ser Leu Ile 50 55 60 Asp Phe Ile Ser Val Leu Val Pro Ile Thr Glu Ile Leu Leu Thr Asn 65 70 75 80 Gly Lys Met Ile Ile Cys Asn Val Lys Arg Gly Lys Ile Ile Asn Leu 85 90 95 Ile Asn Gln Val Gln Val Ala Trp Asp Glu Cys Ala Lys Ser Glu His 100 105 110 Leu Glu Ile Gln Thr Leu Ile Thr Thr Thr Ala Lys Lys Ser Lys Ile 115 120 125 Phe Val Ile Ile Tyr Thr Thr Ser Phe Leu Leu Ile Cys Val Glu Tyr 130 135 140 Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr His Ser Ala Val Tyr Gly 145 150 155 160 Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro Tyr Leu Ser Arg Phe Ala 165 170 175 Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala Trp Thr Tyr Phe Phe Ile 180 185 190 Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr Leu Ser Gly Phe Asp Ser 195 200 205 Leu Phe Ser Thr Leu Val Met His Ile Lys Met Met Phe Lys Val Leu 210 215 220 Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp Leu Ser Ala Gly Lys Ser 225 230 235 240 His Val Glu Leu Gln Ala Lys Leu Lys Gln Ile Ile Leu Lys His Lys 245 250 255 Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu Asp Gly Phe Ser Phe Phe 260 265 270 Leu Met Ala Gln Phe Leu Thr Ser Ser Ile Leu Val Cys Val Val Leu 275 280 285 Tyr Glu Leu Thr Met Val Phe Gly Trp Asn Glu Asp Thr Phe Lys Thr 290 295 300 Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln Leu Phe Leu Phe Cys Trp 305 310 315 320 Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg Leu Val Ser Asp His Ile 325 330 335 Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro Lys Leu Gln Lys Asp Ile 340 345 350 Leu Thr Phe Met Val Lys Ala Gln Lys Pro Thr Gly Val Thr Ala Ser 355 360 365 Lys Phe Tyr Met Val Thr Leu Gln Thr Phe Gln Arg Ile Ser Ser Thr 370 375 380 Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr Ile Asn Gln Gln 385 390 395 <210> 22 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 22a.a del <400> 22 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaccaagat ccagaacagc cccatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagttca cctacctggt ggtggacacc 180 aagagcctga tcgacttcat cagcgtgctg gtgcccatca ccgagatcct gctgaccaac 240 ggcaagatga ttatctgcaa cgtgaagcgg ggcaagatca tcaacctgat caaccaggtg 300 caggtcgcct gggatgagtg tgccaagtct gagcacctgg aaatccagac actgatcacc 360 accaccgcca agaaaagcaa gatcttcgtg attatctaca ccaccagctt tctgctgatc 420 tgcgtggaat actccagcat gcccctgttc aagctgatct accacagcgc cgtgtacggc 480 aagcagagca actacacaat cgccctgcct tacctgagca gattcgccta cagcaccgag agcaccaca gcttcgcctg gacctacttc ttcatcctga tcggcgtgta cctgctggcc 600 ctgacactga gcggcttcga tagcctgttt agcaccctgg tcatgcacat caagatgatg ttcaaggtgc tgaagttcga gatcgagcag ctgggcctcg atctgtctgc cggcaaatct 720 cacgtggac tccaggcca gctgagca atcatcctga agcacaagac caacctgtct ctgattgagc agctcgagga cggcttttca ttcttcctga tggcccagtt cctgaccagc 840 agcatcctcg tgtgtgtggt gctgtacgag ctgaccatgg tgttcggctg gaacgaggac 900 accttcaaga ccgtgacata cctgcctggc gctatcctgc agctgttcct gttctgttgg tacgcccagc agatcaccga agaggccagg ctggtgtccg atcacatcta caacatccct tggtatctgg ctgaccccaa gctgcagaag gacatcctga ccttcatggt caaggcccag aaacctaccg gcgtgaccgc cagcaagttc tacatggtca ccctgcagac cttccagaga atcagcagca cctcctacag ctacttcacc ctgctgcaga ccatcaacca gcagtaa 1197 <210> twenty three <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> twenty three taccgagctc ggatcatggc cagactggtg ctg 33 <210> twenty four <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> twenty four gatatctgca gaattttact gctggttgat ggtc 34 <210> 25 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> AgOR28 T25K, 22a.a del <400> 25 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Lys Lys Ile Gln Asn Ser Pro Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Phe Thr Tyr Leu Val Val Asp Thr Lys Ser Leu Ile 50 55 60 Asp Phe Ile Ser Val Leu Val Pro Ile Thr Glu Ile Leu Leu Thr Asn 65 70 75 80 Gly Lys Met Ile Ile Cys Asn Val Lys Arg Gly Lys Ile Ile Asn Leu 85 90 95 Ile Asn Gln Val Gln Val Ala Trp Asp Glu Cys Ala Lys Ser Glu His 100 105 110 Leu Glu Ile Gln Thr Leu Ile Thr Thr Thr Ala Lys Lys Ser Lys Ile 115 120 125 Phe Val Ile Ile Tyr Thr Thr Ser Phe Leu Leu Ile Cys Val Glu Tyr 130 135 140 Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr His Ser Ala Val Tyr Gly 145 150 155 160 Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro Tyr Leu Ser Arg Phe Ala 165 170 175 Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala Trp Thr Tyr Phe Phe Ile 180 185 190 Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr Leu Ser Gly Phe Asp Ser 195 200 205 Leu Phe Ser Thr Leu Val Met His Ile Lys Met Met Phe Lys Val Leu 210 215 220 Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp Leu Ser Ala Gly Lys Ser 225 230 235 240 His Val Glu Leu Gln Ala Lys Leu Lys Gln Ile Ile Leu Lys His Lys 245 250 255 Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu Asp Gly Phe Ser Phe Phe 260 265 270 Leu Met Ala Gln Phe Leu Thr Ser Ser Ile Leu Val Cys Val Val Leu 275 280 285 Tyr Glu Leu Thr Met Val Phe Gly Trp Asn Glu Asp Thr Phe Lys Thr 290 295 300 Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln Leu Phe Leu Phe Cys Trp 305 310 315 320 Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg Leu Val Ser Asp His Ile 325 330 335 Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro Lys Leu Gln Lys Asp Ile 340 345 350 Leu Thr Phe Met Val Lys Ala Gln Lys Pro Thr Gly Val Thr Ala Ser 355 360 365 Lys Phe Tyr Met Val Thr Leu Gln Thr Phe Gln Arg Ile Ser Ser Thr 370 375 380 Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr Ile Asn Gln Gln 385 390 395 <210> 26 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 T25K, 22a.a del <400> 26 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaagaagat ccagaacagc cccatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagttca cctacctggt ggtggacacc 180 aagagcctga tcgacttcat cagcgtgctg gtgcccatca ccgagatcct gctgaccaac 240 ggcaagatga ttatctgcaa cgtgaagcgg ggcaagatca tcaacctgat caaccaggtg 300 caggtcgcct gggatgagtg tgccaagtct gagcacctgg aaatccagac actgatcacc 360 accaccgcca agaaaagcaa gatcttcgtg attatctaca ccaccagctt tctgctgatc 420 tgcgtggaat actccagcat gcccctgttc aagctgatct accacagcgc cgtgtacggc 480 aagcagagca actacacaat cgccctgcct tacctgagca gattcgccta cagcaccgag agcaccaca gcttcgcctg gacctacttc ttcatcctga tcggcgtgta cctgctggcc 600 ctgacactga gcggcttcga tagcctgttt agcaccctgg tcatgcacat caagatgatg ttcaaggtgc tgaagttcga gatcgagcag ctgggcctcg atctgtctgc cggcaaatct 720 cacgtggac tccaggcca gctgagca atcatcctga agcacaagac caacctgtct ctgattgagc agctcgagga cggcttttca ttcttcctga tggcccagtt cctgaccagc 840 agcatcctcg tgtgtgtggt gctgtacgag ctgaccatgg tgttcggctg gaacgaggac 900 accttcaaga ccgtgacata cctgcctggc gctatcctgc agctgttcct gttctgttgg tacgcccagc agatcaccga agaggccagg ctggtgtccg atcacatcta caacatccct tggtatctgg ctgaccccaa gctgcagaag gacatcctga ccttcatggt caaggcccag aaacctaccg gcgtgaccgc cagcaagttc tacatggtca ccctgcagac cttccagaga atcagcagca cctcctacag ctacttcacc ctgctgcaga ccatcaacca gcagtaa 1197 <210> 27 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> AgOR28 P31T, 22a.a del <400> 27 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Met Ala Met 1 5 10 15 Leu Tyr Ile Ser Arg Gly Met Ala Thr Lys Ile Gln Asn Ser Thr Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Phe Thr Tyr Leu Val Val Asp Thr Lys Ser Leu Ile 50 55 60 Asp Phe Ile Ser Val Leu Val Pro Ile Thr Glu Ile Leu Leu Thr Asn 65 70 75 80 Gly Lys Met Ile Ile Cys Asn Val Lys Arg Gly Lys Ile Ile Asn Leu 85 90 95 Ile Asn Gln Val Gln Val Ala Trp Asp Glu Cys Ala Lys Ser Glu His 100 105 110 Leu Glu Ile Gln Thr Leu Ile Thr Thr Thr Ala Lys Lys Ser Lys Ile 115 120 125 Phe Val Ile Ile Tyr Thr Thr Ser Phe Leu Leu Ile Cys Val Glu Tyr 130 135 140 Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr His Ser Ala Val Tyr Gly 145 150 155 160 Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro Tyr Leu Ser Arg Phe Ala 165 170 175 Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala Trp Thr Tyr Phe Phe Ile 180 185 190 Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr Leu Ser Gly Phe Asp Ser 195 200 205 Leu Phe Ser Thr Leu Val Met His Ile Lys Met Met Phe Lys Val Leu 210 215 220 Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp Leu Ser Ala Gly Lys Ser 225 230 235 240 His Val Glu Leu Gln Ala Lys Leu Lys Gln Ile Ile Leu Lys His Lys 245 250 255 Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu Asp Gly Phe Ser Phe Phe 260 265 270 Leu Met Ala Gln Phe Leu Thr Ser Ser Ile Leu Val Cys Val Val Leu 275 280 285 Tyr Glu Leu Thr Met Val Phe Gly Trp Asn Glu Asp Thr Phe Lys Thr 290 295 300 Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln Leu Phe Leu Phe Cys Trp 305 310 315 320 Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg Leu Val Ser Asp His Ile 325 330 335 Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro Lys Leu Gln Lys Asp Ile 340 345 350 Leu Thr Phe Met Val Lys Ala Gln Lys Pro Thr Gly Val Thr Ala Ser 355 360 365 Lys Phe Tyr Met Val Thr Leu Gln Thr Phe Gln Arg Ile Ser Ser Thr 370 375 380 Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr Ile Asn Gln Gln 385 390 395 <210> 28 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 P31T, 22a.a del <400> 28 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaccaagat ccagaacagc accatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagttca cctacctggt ggtggacacc 180 aagagcctga tcgacttcat cagcgtgctg gtgcccatca ccgagatcct gctgaccaac 240 ggcaagatga ttatctgcaa cgtgaagcgg ggcaagatca tcaacctgat caaccaggtg 300 caggtcgcct gggatgagtg tgccaagtct gagcacctgg aaatccagac actgatcacc 360 accaccgcca agaaaagcaa gatcttcgtg attatctaca ccaccagctt tctgctgatc 420 tgcgtggaat actccagcat gcccctgttc aagctgatct accacagcgc cgtgtacggc 480 aagcagagca actacacaat cgccctgcct tacctgagca gattcgccta cagcaccgag 540 agcaccacaa gcttcgcctg gacctacttc ttcatcctga tcggcgtgta cctgctggcc 600 ctgacactga gcggcttcga tagcctgttt agcaccctgg tcatgcacat caagatgatg 660 ttcaaggtgc tgaagttcga gatcgagcag ctgggcctcg atctgtctgc cggcaaatct 720 cacgtggac tccaggcca gctgagca atcatcctga agcacaagac caacctgtct ctgattgagc agctcgagga cggcttttca ttcttcctga tggcccagtt cctgaccagc 840 agcatcctcg tgtgtgtggt gctgtacgag ctgaccatgg tgttcggctg gaacgaggac 900 accttcaaga ccgtgacata cctgcctggc gctatcctgc agctgttcct gttctgttgg tacgcccagc agatcaccga agaggccagg ctggtgtccg atcacatcta caacatccct tggtatctgg ctgaccccaa gctgcagaag gacatcctga ccttcatggt caaggcccag aaacctaccg gcgtgaccgc cagcaagttc tacatggtca ccctgcagac cttccagaga atcagcagca cctcctacag ctacttcacc ctgctgcaga ccatcaacca gcagtaa <210> 29 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> AgOR28 T25K, P31T, 22nd <400> 29 Met Ala Arg Leu Val Leu His Glu Val Arg Tyr Val Leu Free Mp3 Download 1 5 10 15 Leu Tyr Ile Serves Arg Gly Met Ala Lys Lys Ile Gln Asn Serves Thr Ile 20 25 30 Asp Leu Tyr Val Tyr Trp Phe Leu Thr Phe Ile Pro Ile Ala Ser Leu 35 40 45 Cys Val Pro Gln Phe Thr Tyr Leu Val Val Asp Thr Lys Ser Leu Ile 50 55 60 Asp Phe Ile Ser Val Leu Val Pro Ile Thr Glue Ile Leu Leu Thr Asn 65 70 75 80 Gly Lys Met Ile Ile Cys Asn Val Lys Arg Gly Lys Ile Ile Asn Leu 85 90 95 Contains Gln Asn Gln Val Ala Trp Asp Glu Cys Ala Lys Ser Glu His 100 105 110 Leu Glu Ile Gln Thr Leu Ile Three Three Ala Lys Ser Lys Ile 115 120 125 Where Is The Tyr Thr Thr Ser Why Is The Lion And The Cys Is Glu Tyr 130 135 140 Ser Ser Met Pro Leu Phe Lys Leu Ile Tyr His Ser Ala Val Tyr Gly 145 150 155 160 Lys Gln Ser Asn Tyr Thr Ile Ala Leu Pro Tyr Leu Ser Arg Phe Ala 165 170 175 Tyr Ser Thr Glu Ser Thr Thr Ser Phe Ala Trp Thr Tyr Phe Phe Ile 180 185 190 Leu Ile Gly Val Tyr Leu Leu Ala Leu Thr Leu Ser Gly Phe Asp Ser 195 200 205 Leu Phe Ser Thr Leu Val Met His Ile Lys Met Met Phe Lys Val Leu 210 215 220 Lys Phe Glu Ile Glu Gln Leu Gly Leu Asp Leu Ser Ala Gly Lys Ser 225 230 235 240 His Val Glu Leu Gln Ala Lys Leu Lys Gln Ile Ile Leu Lys His Lys 245 250 255 Thr Asn Leu Ser Leu Ile Glu Gln Leu Glu Asp Gly Phe Ser Phe Phe 260 265 270 Leu Met Ala Gln Phe Leu Thr Ser Ser Ile Leu Val Cys Val Val Leu 275 280 285 Tyr Glu Leu Thr Met Val Phe Gly Trp Asn Glu Asp Thr Phe Lys Thr 290 295 300 Val Thr Tyr Leu Pro Gly Ala Ile Leu Gln Leu Phe Leu Phe Cys Trp 305 310 315 320 Tyr Ala Gln Gln Ile Thr Glu Glu Ala Arg Leu Val Ser Asp His Ile 325 330 335 Tyr Asn Ile Pro Trp Tyr Leu Ala Asp Pro Lys Leu Gln Lys Asp Ile 340 345 350 Leu Thr Phe Met Val Lys Ala Gln Lys Pro Thr Gly Val Thr Ala Ser 355 360 365 Lys Phe Tyr Met Val Thr Leu Gln Thr Phe Gln Arg Ile Ser Ser Thr 370 375 380 Ser Tyr Ser Tyr Phe Thr Leu Leu Gln Thr Ile Asn Gln Gln 385 390 395 <210> 30 <211> 1197 <212> DNA <213> Artificial Sequence <220> <223> AgOR28 T25K, P31T, 22a.a del <400> 30 atggccagac tggtgctgca cgaagtccgc tatgtgctga tggccatgct gtacatcagc 60 agaggcatgg ccaagaagat ccagaacagc accatcgacc tgtacgtgta ctggttcctg 120 acattcatcc ctatcgccag cctgtgcgtg ccccagttca cctacctggt ggtggacacc 180 aagagcctga tcgacttcat cagcgtgctg gtgcccatca ccgagatcct gctgaccaac 240 ggcaagatga ttatctgcaa cgtgaagcgg ggcaagatca tcaacctgat caaccaggtg 300 caggtcgcct gggatgagtg tgccaagtct gagcacctgg aaatccagac actgatcacc 360 420. accaccgcca agaaaagcaa gatcttcgtg attatctaca ccaccagctt tctgctgatc tgcgtggaat actccagcat gcccctgttc aagctgatct accacagcgc cgtgtacggc 480 aagcagagca actacacaat cgccctgcct tacctgagca gattcgccta cagcaccgag agcaccaca gcttcgcctg gacctacttc ttcatcctga tcggcgtgta cctgctggcc 600 ctgacactga gcggcttcga tagcctgttt agcaccctgg tcatgcacat caagatgatg ttcaaggtgc tgaagttcga gatcgagcag ctgggcctcg atctgtctgc cggcaaatct 720 cacgtggac tccaggcca gctgagca atcatcctga agcacaagac caacctgtct ctgattgagc agctcgagga cggcttttca ttcttcctga tggcccagtt cctgaccagc 840 agcatcctcg tgtgtgtggt gctgtacgag ctgaccatgg tgttcggctg gaacgaggac 900 accttcaaga ccgtgacata cctgcctggc gctatcctgc agctgttcct gttctgttgg tacgcccagc agatcaccga agaggccagg ctggtgtccg atcacatcta caacatccct tggtatctgg ctgaccccaa gctgcagaag gacatcctga ccttcatggt caaggcccag 1080 aaacctaccg gcgtgaccgc cagcaagttc tacatggtca ccctgcagac cttccagaga 1140 atcagcagca cctcctacag ctacttcacc ctgctgcaga ccatcaacca gcagtaa 1197 <210> 31 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L60P <400> 31 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Pro Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Has Glue Asn Arg Has Tyr Has Asp Has His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Serves as Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glue and Glu Identify Gln and Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 32 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L60P <400> 32 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcccg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt 900 gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 33 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 33 ctacgagaca atcccgcagt gcttccggtc 30 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 34 gaccggaagc actgcgggat tgtctcgtag 30 <210> 35 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L71F <400> 35 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Phe Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 36 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L71F <400> 36 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ttcagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt 900 gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 108 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 37 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 37 ctatcgccga gggcatgttc agcttcaata ccacc 35 <210> 38 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 38 ggtggtattg aagctgaaca tgccctcggc gatag 35 <210> 39 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 I134V <400> 39 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Val Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 40 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 I134V <400> 40 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggcg tcgtgttcgc catgaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt 900 gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 41 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 41 catcttcacc aacggcgtcg tgttcgccat gac 33 <210> 42 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Prier <400> 42 ggtcatggcg aacacgacgc cgttggtgaa gatg 34 <210> 43 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 S140G <400> 43 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Gly Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 44 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 S140G <400> 44 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccggc 420 tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt 900 gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 45 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 45 gtgttcgcca tgaccggctc tacaatcgcc gg 32 <210> 46 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 46 ccggcgattg tagagccggt catggcgaac ac 32 <210> 47 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 F147L <400> 47 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Leu Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 48 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 F147L <400> 48 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 240. cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc atgctgcccc tgaagatgga caacctgga gatctgctga agaacctga gcggttcacc gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctga caccgccatc cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc tctacaatcg ccggcatgct ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 49 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 49 caatcgccgg catgttctac acctactaca cc 32 <210> 50 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 50 ggtgtagtag gtgtagaaca tgccggcgat tg 32 <210> 51 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 D5E <400> 51 Met Val Val Phe Glu Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 52 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 D5E <400> 52 atggtggtgt tcgaacctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctgga gatctgctga agaacctga gcggttcacc gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctga caccgccatc cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 53 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 53 atggttgtgt tcgaaccact ggacgaccc 29 <210> 54 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 54 gggtcgtcca gtggttcgaa cacaaccat 29 <210> 55 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 K235Q <400> 55 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Gln Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 56 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 K235Q <400> 56 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctga caccgccatc cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg atcagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 57 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 57 gatcggaccc gttgaccagt atactgcaga gctg 34 <210> 58 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 58 cagctctgca gtatactggt caacgggtcc gatc 34 <210> 59 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 N241S <400> 59 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Ser Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 60 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 N241S <400> 60 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 bite tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 61 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 61 gtatactgca gagctgagtg aaattatcga acttcac 37 <210> 62 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 62 gtgaagttcg ataatttcac tcagctctgc agtatac 37 <210> 63 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 M138I <400> 63 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Ile Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 64 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 M138I <400> 64 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catcaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactaca cagatacggc cagagcctga aaaccgccta cagcttctac ctgctgctga aggacatctt ctga 1164 <210> 65 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 65 ggcgtcgtgt tcgccatcac cggctctaca atc 33 <210> 66 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 66 gattgtagag ccggtgatgg cgaacacgac gcc 33 <210> 67 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 A152T <400> 67 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Thr Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 68 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 A152T <400> 68 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacaccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactaca cagatacggc cagagcctga aaaccgccta cagcttctac ctgctgctga aggacatctt ctga <210> 69 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 69 ggaatgtttt acacctacta cacgaaagat tcggaatatt cc 42 <210> 70 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 70 ggaatattcc gaatctttcg tgtagtaggt gtaaaacatt cc 42 <210> 71 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L60P L71F A152T <400> 71 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Pro Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Met Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Thr Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 72 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L60P L71F A152T <400> 72 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcccg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catgaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacaccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactaca cagatacggc cagagcctga aaaccgccta cagcttctac ctgctgctga aggacatctt ctga <210> 73 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V A152T <400> 73 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Leu Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Ile Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Thr Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 74 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V A152T <400> 74 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcctg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catcaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacaccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt 900 gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 75 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V S140G A152T <400> 75 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Pro Gln Cys Phe Arg 50 55 60Ser Ile Ala Glu Gly Met Leu Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Ile Val Phe Ala Ile Thr Ser Ser Thr Ile Ala 130 135 140 Gly Met Phe Tyr Thr Tyr Tyr Thr Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 76 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V S140G A152T <400> 76 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcccg 180 cagtgcttcc ggtctatcgc cgagggcatg ctgagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggca tcgtgttcgc catcaccagc 420 tctacaatcg ccggcatgtt ctacacctac tacaccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactaca cagatacggc cagagcctga aaaccgccta cagcttctac ctgctgctga aggacatctt ctga <210> 77 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V M138I S140G F147L A152T <400> 77 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Pro Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Phe Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Val Val Phe Ala Ile Thr Gly Ser Thr Ile Ala 130 135 140 Gly Met Leu Tyr Thr Tyr Tyr Thr Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 78 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V M138I S140G F147L A152T <400> 78 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcccg 180 cagtgcttcc ggtctatcgc cgagggcatg ttcagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggcg tcgtgttcgc catcaccggc 420 tctacaatcg ccggcatgct ctacacctac tacaccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt 900 gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc 960 ctggaaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag 1020 aaaatggtgg tgcccatcat ccagcagtcc cagcagagaa tcggaatcac agccgccaag 1080 ttctactaca tcgactacaa cagatacggc cagagcctga aaaccgccta cagcttctac 1140 ctgctgctga aggacatctt ctga 1164 <210> 79 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V M138I S140G F147L <400> 79 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Pro Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Phe Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Val Val Phe Ala Ile Thr Gly Ser Thr Ile Ala 130 135 140 Gly Met Leu Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 80 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47 L60P L71F I134V M138I S140G F147L <400> 80 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcccg 180 cagtgcttcc ggtctatcgc cgagggcatg ttcagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggcg tcgtgttcgc catcaccggc 420 tctacaatcg ccggcatgct ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg father cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactaca cagatacggc cagagcctga aaaccgccta cagcttctac ctgctgctga aggacatctt ctga <210> 81 <211> 405 <212> PRT <213> Artificial Sequence <220> <223> AgOR6 mute <400> 81 Met Val Arg Leu Ser Phe Glu Glu Thr Leu Arg Asn Thr Asn Leu Met 1 5 10 15 Leu Leu Met Met Gly Ile Pro Cys Glu Glu Pro Tyr Pro Pro Gly 20 25 30 Val Leu Pro Ser Leu Lys Arg Asn Ala Gly Phe Ile Ala Ser Phe Leu 35 40 45 Leu Leu Ala Tyr Thr Thr Ile Gly Glu Leu Ile Tyr Leu Lys Gln Met 50 55 60 Phe Glu Arg Asp Val Thr Phe Leu Glu Val Thr Phe Gln Ala Pro Cys 65 70 75 80 Ile Gly Tyr Cys Thr Ile Gly Val Leu Lys Met Val Ile Leu Ala Arg 85 90 95 Gly Arg Asn Thr Ile Ala Glu Leu Val Gly Leu Phe Arg Ala Lys Trp 100 105 110 Thr Ala Ala Ile Val Thr Gly Glu His Trp Ala Val Cys Glu Asp Thr 115 120 125 Met Arg Pro Ala Ile Arg Val Thr Ser Val Thr Ala Leu Ala Asn Val 130 135 140 Val Met Gly Ile Ala Phe Thr Ile Leu Pro Ile Ala Glu Met Ile Tyr 145 150 155 160 Thr Tyr His Tyr Thr Gly Arg Trp Asn Arg Gln Leu Ala Phe Asn Ile 165 170 175 Trp Trp Pro Phe Asp Val Leu Gly Gly Ala Lys Tyr Tyr Trp Phe Val 180 185 190 Tyr Pro Leu Tyr Val Val Ile Gly Phe Thr Gly Ile Ile Ile His Met 195 200 205 Ala Phe Asp Cys Leu Phe Cys Ile Leu Ala Ala His Leu Cys Met Gln 210 215 220 Phe Arg Ile Leu Ala His Asn Phe Gly His Val Val Glu Val Ala Asn 225 230 235 240 Gly Ala Gly Glu Gly Ile Gly Asp Ser Gly Ser Thr Ser Arg Leu Gln 245 250 255 Asp Ala Ile Arg Ile His Gln Glu Leu Ile Gly Cys Ser Val Phe Met 260 265 270 Gln Asn Val Phe Gly Asn Ala Leu Phe Ile Asn Phe Leu Gly Ser Ser 275 280 285 Ile Ile Ile Cys Ile Gln Ala Phe Met Ile Thr Thr Val Ser Gly Tyr 290 295 300 Met Leu Val Lys Phe Val Leu Phe Met Leu Cys Phe Leu Ile Glu Leu 305 310 315 320 Leu Met Leu Cys Ala Tyr Gly Glu Asp Ile Val Glu Ser Ser Leu Gly 325 330 335 Val Ile Asp Ala Ala Tyr Gly Cys Glu Trp Tyr Arg Glu Gly Ser Met 340 345 350 Ala Phe His Arg Ser Val Leu Gln Ile Ile His Arg Ser Gln Gln Pro 355 360 365 Val Ile Leu Thr Ala Trp Lys Ile Trp Pro Ile Gln Met Ser Thr Phe 370 375 380 Ser Gln Ile Leu Gln Ala Ser Trp Ser Tyr Phe Thr Leu Leu Lys Thr 385 390 395 400 Val Tyr Gly Asn Lys 405 <210> 82 <211> 1218 <212> DNA <213> Artificial Sequence <220> <223> AgOR6 mut <400> 82 atggtacgtc taagctttga agaaacgcta cgaaacacca acctgatgct actgatgatg 60 ggcattccac cgtgcgagga gccgtacccg ccgggcgtac tgccgtcgct caaacgcaac 120 gcgggcttta tcgcgtcctt cctgctgctc gcctacacca cgatcggtga gctgatctat 180 ctgaagcaga tgtttgagcg ggacgttacc ttcctggagg taacctttca agcgccctgc 240 atcgggtact gcaccatcgg tgtgctgaag atggtcatac tggcccgggg aaggaacacg 300 atcgccgagc tggtcggttt gtttcgcgca aagtggaccg cggcgattgt aaccggtgag 360 cattgggcgg tgtgcgagga cacaatgcgg cccgccattc gggtcacctc ggtaacggcg 420 ctcgcgaacg tcgtgatggg gatagcgttc accatcctgc cgatcgcgga gatgatctac 480 acctatcact acaccggccg gtggaaccgt cagcttgcct tcaacatctg gtggccgttc 540 gatgtgctgg gaggcgcgaa gtactactgg ttcgtctatc cactgtacgt ggtgattggg 600 ttcacgggca tcatcatcca tatggcgttc gactgtttgt tctgcatact ggcggcccat 660 ctctgtatgc agtttcgcat cctggcgcac aactttggcc atgtggtaga ggttgccaat 720 ggtgctggtg aaggtatagg tgacagtggc agtacgagtc ggctacagga tgcgatcaga 780 atccatcagg agttgattgg ctgcagcgtg ttcatgcaga acgtgtttgg caatgcgctg 840 tttattaact tcctcggcag ctccatcata atctgcatcc aggcgtttat gataacgacg 900 gttagcggat atatgctggt aaagtttgtc ctcttcatgc tgtgctttct gatcgagctg 960 ctgatgctgt gtgcgtacgg tgaggatatt gtggaatcga gccttggggt gattgatgcc 1020 gcttacggtt gcgaatggta ccgggaaggg tcgatggcgt tccatcgatc cgtgctgcaa 1080 attatacacc gcagccagca gcccgtcata ctgacggcgt ggaaaatctg gcccatccaa 1140 atgagtacct tcagtcagat cctgcaagct tcctggtcct actttaccct cctgaagacc 1200 gtctacggga ataagtaa 1218 <210> 83 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR15 mut <400> 83 Met Asn Phe Leu Arg Gln Glu Gln Pro Ala Gly Met Pro His Ile Ser 1 5 10 15 Ile Lys Leu Leu Arg Val Phe Gly Val Thr Asn His Ser Glu Glu Arg 20 25 30 Phe Arg Ile Val Pro Val Met Leu Ala Tyr Phe Phe Phe Ile Val Val 35 40 45 Pro Lys Cys Phe Phe Gly Tyr Pro Asp Leu Glu Ile Thr Ile Ile Gly 50 55 60 Thr Ala Glu Leu Ile Phe Gln Thr Asn Ser Phe Cys Gly Met Phe Leu 65 70 75 80 Leu Phe Leu Asn Arg Arg Lys Leu Ala Glu Phe Ile Gln His Ala Arg 85 90 95 Ser Phe Ser Gln Thr Val Ile Arg Ala Ser Pro Pro Ala Val Val Gln 100 105 110 His Leu Thr Thr Gln His Asp Met Ile His Lys Ile Thr Arg Ile Phe 115 120 125 Cys Ile Val Val Met Phe Ala Ala His Phe Tyr Ala Leu Ala Pro Phe 130 135 140 Leu Ser Thr Leu Tyr Thr Phe Tyr Gly Thr Val Arg Asn Lys Asn Ala 145 150 155 160 Thr Met His Tyr Thr Leu Gln Met Glu Glu Asn Phe Tyr Gly Leu Gln 165 170 175 Thr Arg Thr Ser Ala Thr His Tyr Leu Ile Phe Gly Ile Val Met Thr 180 185 190 Pro Thr Ala Tyr Leu Cys Ala Phe Thr Gly Thr Val Lys Thr Leu Thr 195 200 205 Ile Cys Asn Ile Thr Thr Tyr Cys Thr Leu Tyr Phe Gln Leu Val Gln 210 215 220 Leu Lys Leu Arg Thr Val Thr Gln Asp Asn Thr Phe Arg Gln Glu Leu 225 230 235 240 Lys Ser Val Ile Lys Met His Gln Asp Ala Leu Asn Cys Ala Ser Leu 245 250 255 Val Glu Ser Ile Thr Ser Leu Ala Leu Leu Gln Gln Leu Leu Leu Cys 260 265 270 Val Leu Ile Trp Ser Ser Met Leu Leu Tyr Phe Thr Val Ser Gly Phe 275 280 285 Asn Val Asn Phe Met Asn Leu Phe Val Leu Phe Val Phe Asp Thr Thr 290 295 300 Glu Thr Phe Ala Tyr Cys Tyr Leu Gly Glu Lys Leu Ser Tyr Glu Ser 305 310 315 320 Ala Arg Val Ala His Thr Val Tyr Glu Ser Gly Trp Glu Thr Gln Thr 325 330 335 Thr Asp Ile Gln Lys Asp Leu Gln Leu Ile Leu Val Arg Ala Gln Ser 340 345 350 Pro Val Gly Ile Thr Ala Gly Lys Phe Tyr Tyr Met Asn Met Glu Gln 355 360 365 Phe Gly Ile Ile Val Lys Thr Thr Tyr Ser Phe Phe Val Ile Leu Arg 370 375 380 Asp Gln Ile 385 <210> 84 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR15 mut <400> 84 atgaacttcc taagacagga gcaaccggct ggcatgcctc atatctccat caagctgctc 60 cgggtatttg gcgttaccaa tcattcagag gaacgctttc gtatcgtgcc ggttatgctg 120 gcctactttt tcttcatagt agtgcccaag tgtttcttcg gatatcccga ccttgagata 180 acgatcattg gcaccgctga gctgattttc caaaccaact ccttttgtgg aatgtttctg 240 ttgtttctga acagacgcaa actggctgag ttcattcaac atgctagaag tttctcccaa 300 acggttatcc gtgcgtcacc tcccgcggtg gtccagcatt tgacgaccca gcacgacatg 360 atccacaaga taaccagaat cttctgcatc gtagtgatgt ttgcagctca cttctacgca 420 ttagctcctt ttctttctac gctttacacg ttttacggta cggtacggaa caaaaacgca 480 accatgcact acacgctgca aatggaggaa aacttctacg gactacagac tcgcacctcg 540 gctacgcact acctgatctt cggtatcgtc atgacgccta ccgcgtatct ctgtgccttc 600 accggcacgg tgaagactct aaccatctgt aatattacta cctactgtac cctttacttt 660 caattggtac aactgaagct acgaaccgtc acgcaggaca acacattccg tcaagagttg 720 aagtcggtga tcaagatgca tcaggatgca cttaactgtg caagtctggt agaatctatc 780 acgtcactag cgctattaca gcaactgctt ctatgcgtat tgatctggag ctcaatgttg 840 ctttacttca ccgtatcggg attcaatgtg aactttatga atcttttcgt actgttcgtg 900 ttcgacacaa cggaaacctt tgcctactgt tatcttgggg aaaagctatc gtacgagagt 960 gctcgtgtag cacataccgt ttacgaaagt ggctgggaaa ctcaaaccac cgacatacag 1020 aaagatcttc agctaattct tgtccgtgct caaagtccag ttggcatcac tgctggcaag 1080 ttttactaca tgaacatgga acagtttggc attatagtaa aaactaccta ctcgttcttt 1140 gtgatattgc gggatcagat ttaa 1164 <210> 85 <211> 406 <212> PRT <213> Aedes aegypti <400> 85 Met Thr Gln Ser Leu Glu Phe Asp Gln Thr Phe Gly Phe Ile Ala Lys 1 5 10 15 Val Leu Gln Met Ile Gly Tyr Pro Ser Cys Leu Ala Pro Tyr Pro Thr 20 25 30 Thr Phe Ala Ser Arg Leu Lys Ser Ser Ala Gly Phe Val Val Cys Phe 35 40 45 Leu Met Leu Thr Tyr Cys Val Phe Gly Gln Ile Ile Asn Ile Gly Leu 50 55 60 Leu Met Met Gly His Arg Gln Thr Asp Gln Val Val Glu Glu Val Ala 65 70 75 80 Ile Gln Val Ser Ser Thr Gly Phe Cys Ile Ile Gly Leu Ala Lys Met 85 90 95 Tyr Ser Leu Ser Tyr Asn Arg Ala Ile Leu Ser Trp Leu Ile Ala Asp 100 105 110 Phe Arg Val Lys Trp Asn Ala Gly Glu Leu Thr Asp Lys Asp Arg Ser 115 120 125 Ile Arg Asp Gly Thr Leu Arg Pro Thr Val Ala Ile Thr Thr Val Ala 130 135 140 Ala Leu Gly Asn Ile Ile Met Val Ser Ala Phe Asn Phe Gln Pro Val 145 150 155 160 Val Glu Met Ile Tyr Gly Arg Val Val Thr Gly Glu Trp Val Lys Leu 165 170 175 Phe Pro Tyr Val Ile Trp Phe Pro Phe Asn Ser Thr His Gly Ala Ile 180 185 190 Tyr Tyr Leu Val Tyr Leu Phe Glu Val Tyr Ser Gly Val Ile Val Ala 195 200 205 Val Gly Asn Val Gly Phe Asn Cys Ile Phe Cys Leu Leu Thr Ser His 210 215 220 Leu Ser Met Gln Leu Lys Leu Leu Cys Ser Trp Ile Glu Asp Met Val 225 230 235 240 Glu Val Glu Asp Glu Lys Gly Val Gln Ser Lys Lys Lys Leu Tyr Arg 245 250 255 Ile Val Arg Tyr His Gln Asp Leu Ile Arg Gly Arg Asn Ala Leu Gln 260 265 270 Ser Met Phe Ser Thr Thr Leu Phe Leu Asn Phe Ser Ala Ser Ser Val 275 280 285 Leu Met Cys Met Gln Leu Tyr Leu Ile Thr Thr Ala Gly Ile Thr Leu 290 295 300 Met Val Lys Phe Thr Leu Phe Met Leu Cys Ile Leu Met Glu Ile Phe 305 310 315 320 Ile Leu Cys Tyr Tyr Gly Glu Glu Ile Leu Ala Asn Ser Ser Ser Ile 325 330 335 Ala Ala Gly Ala Phe Asn Ser Asn Trp Tyr Gln Ser Lys Val Ser Gln 340 345 350 Gln Asn Pro Arg Phe Gly Lys Asn Leu Ile Pro Ile Ile Gln Gln Gly 355 360 365 Gln Arg Pro Met Val Leu Thr Ala Trp Lys Phe Trp Pro Ile Thr Ile 370 375 380 Arg Thr Phe Ser Ala Ile Leu Gln Thr Ser Trp Ser Tyr Phe Thr Leu 385 390 395 400 Leu Lys Thr Val Met His 405 <210> 86 <211> 1221 <212> DNA <213> Aedes aegypti <400> 86 atgactcaat cccttgagtt tgaccaaacc tttggcttca tcgccaaggt cttgcaaatg 60 atcggttatc caagctgttt agcaccgtac ccaacgacct tcgccagtcg actcaagtcc 120 agtgccggtt tcgtggtatg cttcctcatg ttgacctatt gcgtttttcgg tcagatcatc 180 aacatcggcc tgctgatgat gggtcaccgc cagacggatc aggtcgtcga agaggtcgcc 240 atccaggtca gcagcacagg cttttgcatc atcggactgg cgaagatgta cagtttgtcg 300 tacaaccggg ccattctgag ctggctcatt gcggacttca gagtcaagtg gaatgccggg 360 420 acgactgtag cggcattagg gaacatcata atggtgtcgg cgttcaactt tcaaccggtg 480 gtggagatga tctacggtcg ggtggttacc ggagaatggg tcaagctatt tccgtacgtg 540 atttggttcc ctttcaattc gactcacggg gcgatctact atctggtgta cttgtttgag 600 gtttattcgg gagttatagt ggccgttgga aacgtggggt tcaactgtat cttctgtttg 660 ctgacttcac acttgtcgat gcagttaaag ctgttgtgca gttggatcga ggatatggtt 720 gaagttgagg acgagaaggg ggtgcaatcg aagaagaagc tctacaggat tgtgcggtat 780 catcaggact tgatcagagg aaaggaatgcg ttacaatcaa tgttcagcac aacgctgttc 840 ctgaacttct ccgcaagttc tgttctgatg tgcatgcagc tttacctcat aactaccgca 900 ggcattactc tgatggtcaa gtttactctt ttcatgcttt gtattttgat ggagattttc 960 attctctgct actacggtga agagattctc gctaatagtt catcgattgc cgctggagcg 1020 ttcaactcga attggtacca gtcgaaggtg agccaacaga atcctcgttt tggcaaaaat 1080<s ttgattccga ttatccagca agggcagagg cccatggttc tgacggcgtg gaagttttgg 1140 cccataacca ttcggacgtt cagcgccata ttgcaaacat catggtccta ttttaccttg 1200 ctgaaaactg taatgcatta g 1221 <210> 87 <211> 344 <212> PRT <213> Artificial Sequence <220> <223> rho‑myc‑mOlfr256_17 <400> 87 Met Asn Gly Thr Glu Gly Pro Asn Phe Tyr Val Pro Phe Ser Asn Lys 1 5 10 15 Thr Gly Val Val Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Glu Phe 20 25 30 Met Glu Val Asp Ser Asn Ser Ser Ser Gly Ser Phe Ile Leu Met Gly 35 40 45 Val Ser Asp His Pro His Leu Glu Ile Ile Phe Phe Ala Val Ile Leu 50 55 60 Ala Ser Tyr Leu Leu Thr Leu Val Gly Asn Leu Thr Ile Ile Leu Leu 65 70 75 80 Ser Arg Leu Asp Ala Arg Leu His Thr Pro Met Tyr Phe Phe Leu Ser 85 90 95 Asn Leu Ser Ser Leu Asp Leu Ala Phe Thr Thr Ser Ser Val Pro Gln 100 105 110 Met Leu Lys Asn Leu Trp Gly Pro Asp Lys Thr Ile Ser Tyr Gly Gly 115 120 125 Cys Val Thr Gln Leu Tyr Val Phe Leu Trp Leu Gly Ala Thr Glu Cys 130 135 140 Ile Leu Leu Val Val Met Ala Phe Asp Arg Tyr Val Ala Val Cys Arg 145 150 155 160 Pro Leu His Tyr Met Thr Val Met Asn Pro Arg Leu Cys Trp Gly Leu 165 170 175 Ala Ala Ile Ser Trp Leu Gly Gly Leu Gly Asn Ser Val Ile Gln Ser 180 185 190 Thr Phe Thr Leu Gln Leu Pro Phe Cys Gly His Arg Lys Val Asp Asn 195 200 205 Phe Leu Cys Glu Val Pro Ala Met Ile Lys Leu Ala Cys Gly Asp Thr 210 215 220 Ser Leu Asn Glu Ala Val Leu Asn Gly Val Cys Thr Phe Phe Thr Val 225 230 235 240 Val Pro Val Ser Val Ile Leu Val Ser Tyr Cys Phe Ile Ala Gln Ala 245 250 255 Val Met Lys Ile Arg Ser Val Glu Gly Arg Arg Lys Ala Phe Asn Thr 260 265 270 Cys Val Ser His Leu Val Val Val Phe Leu Phe Tyr Gly Ser Ala Ile 275 280 285 Tyr Gly Tyr Leu Leu Pro Ala Lys Ser Ser Asn Gln Ser Gln Gly Lys 290 295 300 Phe Ile Ser Leu Phe Tyr Ser Val Val Thr Pro Met Val Asn Pro Leu 305 310 315 320 Ile Tyr Thr Leu Arg Asn Lys Glu Val Lys Gly Ala Leu Gly Arg Leu 325 330 335 Leu Gly Lys Gly Arg Gly Ala Ser 340 <210> 88 <211> 374 <212> PRT <213> House mouse (Mus musculus) <400> 88 Met Ala Arg Ser Leu Thr Trp Gly Cys Cys Pro Trp Cys Leu Thr Glu 1 5 10 15 Glu Glu Lys Thr Ala Ala Arg Ile Asp Gln Glu Ile Asn Arg Ile Leu 20 25 30 Leu Glu Gln Lys Lys Gln Glu Arg Glu Glu Leu Lys Leu Leu Leu Leu 35 40 45 Gly Pro Gly Glu Ser Gly Lys Ser Thr Phe Ile Lys Gln Met Arg Ile 50 55 60 Ile His Gly Val Gly Tyr Ser Glu Glu Asp Arg Arg Ala Phe Arg Leu 65 70 75 80 Leu Ile Tyr Gln Asn Ile Phe Val Ser Met Gln Ala Met Ile Asp Ala 85 90 95 Met Asp Arg Leu Gln Ile Pro Phe Ser Arg Pro Asp Ser Lys Gln His 100 105 110 Ala Ser Leu Val Met Thr Gln Asp Pro Tyr Lys Val Ser Thr Phe Glu 115 120 125 Lys Pro Tyr Ala Val Ala Met Gln Tyr Leu Trp Arg Asp Ala Gly Ile 130 135 140 Arg Ala Cys Tyr Glu Arg Arg Arg Glu Phe His Leu Leu Asp Ser Ala 145 150 155 160 Val Tyr Tyr Leu Ser His Leu Glu Arg Ile Ser Glu Asp Ser Tyr Ile 165 170 175 Pro Thr Ala Gln Asp Val Leu Arg Ser Arg Met Pro Thr Thr Gly Ile 180 185 190 Asn Glu Tyr Cys Phe Ser Val Lys Lys Thr Lys Leu Arg Ile Val Asp 195 200 205 Val Gly Gly Gln Arg Ser Glu Arg Arg Lys Trp Ile His Cys Phe Glu 210 215 220 Asn Val Ile Ala Leu Ile Tyr Leu Ala Ser Leu Ser Glu Tyr Asp Gln 225 230 235 240 Cys Leu Glu Glu Asn Asp Gln Glu Asn Arg Met Glu Glu Ser Leu Ala 245 250 255 Leu Phe Ser Thr Ile Leu Glu Leu Pro Trp Phe Lys Ser Thr Ser Val 260 265 270 Ile Leu Phe Leu Asn Lys Thr Asp Ile Leu Glu Asp Lys Ile His Thr 275 280 285 Ser His Leu Ala Thr Tyr Phe Pro Ser Phe Gln Gly Pro Arg Arg Asp 290 295 300 Ala Glu Ala Ala Lys Ser Phe Ile Leu Asp Met Tyr Ala Arg Val Tyr 305 310 315 320 Ala Ser Cys Ala Glu Pro Gln Asp Gly Gly Arg Lys Gly Ser Arg Ala 325 330 335 Arg Arg Phe Phe Ala His Phe Thr Cys Ala Thr Asp Thr Gln Ser Val 340 345 350 Arg Ser Val Phe Lys Asp Val Arg Asp Ser Val Leu Ala Arg Tyr Leu 355 360 365 Lys Gln Tyr Glu Leu Leu 370 <210> 89 <211> 227 <212> PRT <213> Mus musculus <400> 8游<400> Met Cys Lys Ser Val Thr Thr Gly Glu Trp Lys Lys Val Phe Tyr Glu 1 5 10 15 Lys Met Glu Glu Val Lys Pro Ala Asp Ser Trp Asp Phe Ile Ile Asp 20 25 30 Pro Asn Leu Lys His Asn Val Leu Ala Pro Gly Trp Lys Gln Tyr Leu 35 40 45 Glu Leu His Ala Ser Gly Arg Phe His Cys Ser Trp Cys Trp His Thr 50 55 60 Trp Gln Ser Pro His Val Val Ile Leu Phe His Met Tyr Leu Asp Lys 65 70 75 80 It should be noted that there seems to be an incorrect "8游" in the translation of line . You may want to check and correct it if necessary.Ala Gln Arg Ala Gly Ser Val Arg Met Arg Val Phe Lys Gln Leu Cys 85 90 95 Tyr Glu Cys Gly Thr Ala Arg Leu Asp Glu Ser Ser Met Leu Glu Glu 100 105 110 Asn Ile Glu Ser Leu Val Asp Asn Leu Ile Thr Ser Leu Arg Glu Gln 115 120 125 Cys Tyr Gly Glu Arg Gly Gly His Tyr Arg Ile His Val Ala Ser Arg 130 135 140 Gln Asp Asn Arg Arg His Arg Gly Glu Phe Cys Glu Ala Cys Gln Glu 145 150 155 160 Gly Ile Val His Trp Lys Pro Ser Glu Lys Leu Leu Glu Glu Glu Ala 165 170 175 Thr Thr Tyr Thr Phe Ser Arg Ala Pro Ser Pro Thr Lys Pro Gln Ala 180 185 190 Glu Thr Gly Ser Gly Cys Asn Phe Cys Ser Ile Pro Trp Cys Leu Phe 195 200 205 Trp Ala Thr Val Leu Met Leu Ile Ile Tyr Leu Gln Phe Ser Phe Arg 210 215 220 Thr Ser Val 225 <210> 90 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 90 gccagcctgt gcgtgcccca gttcacctac ctggtggtgg acaccaag 48 <210> 91 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 91 caccaggtag gtgaactggg gcacgcacag gctggcgata gggatg 46 <210> 92 <211> 480 <212> PRT <213> Artificial Sequence <220> <223> Dm(NT‑TM4)AaORCO <400> 92 Met Thr Thr Ser Met Gln Pro Ser Lys Tyr Thr Gly Leu Val Ala Asp 1 5 10 15 Leu Met Pro Asn Ile Arg Ala Met Lys Tyr Ser Gly Leu Phe Met His 20 25 30 Asn Phe Thr Gly Gly Ser Ala Phe Met Lys Lys Val Tyr Ser Ser Val 35 40 45 His Leu Val Phe Leu Leu Met Gln Phe Thr Phe Ile Leu Val Asn Met 50 55 60 Ala Leu Asn Ala Glu Glu Val Asn Glu Leu Ser Gly Asn Thr Ile Thr 65 70 75 80 Thr Leu Phe Phe Thr His Cys Ile Thr Lys Phe Ile Tyr Leu Ala Val 85 90 95 Asn Gln Lys Asn Phe Tyr Arg Thr Leu Asn Ile Trp Asn Gln Val Asn 100 105 110 Thr His Pro Leu Phe Ala Glu Ser Asp Ala Arg Tyr His Ser Ile Ala 115 120 125 Leu Ala Lys Met Arg Lys Leu Phe Phe Leu Val Met Leu Thr Thr Val 130 135 140 Ala Ser Ala Thr Ala Trp Thr Thr Ile Thr Phe Phe Gly Asp Ser Val 145 150 155 160 Lys Met Val Val Asp His Glu Thr Asn Ser Ser Ile Pro Val Glu Ile 165 170 175 Pro Arg Leu Pro Ile Lys Ser Phe Tyr Pro Trp Asn Ala Ser His Gly 180 185 190 Met Phe Tyr Met Ile Ser Phe Ala Phe Gln Ile Tyr Tyr Val Leu Phe 195 200 205 Ser Met Ile His Ser Asn Leu Cys Asp Val Met Phe Cys Ser Trp Leu 210 215 220 Ile Phe Ala Cys Glu Gln Leu Gln His Leu Lys Asn Ile Met Lys Pro 225 230 235 240 Leu Met Glu Phe Ser Ala Thr Leu Asp Thr Val Val Pro Asn Ser Gly 245 250 255 Glu Leu Phe Lys Ala Gly Ser Ala Glu Gln Pro Lys Glu Gln Glu Pro 260 265 270 Leu Pro Pro Val Thr Pro Pro Gln Gly Glu Asn Met Leu Asp Met Asp 275 280 285 Leu Arg Gly Ile Tyr Ser Asn Arg Thr Asp Phe Thr Thr Thr Phe Arg 290 295 300 Pro Thr Ala Gly Met Thr Phe Asn Gly Gly Val Gly Pro Asn Gly Leu 305 310 315 320 Thr Lys Lys Gln Glu Met Leu Val Arg Ser Ala Ile Lys Tyr Trp Val 325 330 335 Glu Arg His Lys His Ile Val Arg Leu Val Thr Ala Ile Gly Asp Ala 340 345 350 Tyr Gly Val Ala Leu Leu Leu His Met Leu Thr Thr Thr Ile Thr Leu 355 360 365 Thr Leu Leu Ala Tyr Gln Ala Thr Lys Ile His Ala Val Asp Thr Tyr 370 375 380 Ala Ala Ser Val Val Gly Tyr Leu Leu Tyr Ser Leu Gly Gln Val Phe 385 390 395 400 Met Leu Cys Ile Phe Gly Asn Arg Leu Ile Glu Glu Ser Ser Ser Val 405 410 415 Met Glu Ala Ala Tyr Ser Cys His Trp Tyr Asp Gly Ser Glu Glu Ala 420 425 430 Lys Thr Phe Val Gln Ile Val Cys Gln Gln Cys Gln Lys Ala Met Ser 435 440 445 Ile Ser Gly Ala Lys Phe Phe Thr Val Ser Leu Asp Leu Phe Ala Ser 450 455 460 Val Leu Gly Ala Met Val Thr Tyr Phe Met Val Leu Val Gln Leu Lys 465 470 475 480 <210> 93 <211> 1443 <212> DNA <213> Artificial Sequence <220> <223> Dm(NT‑TM4)AaORCO <400> 93 atgacaacct cgatgcagcc gagcaagtac acgggcctgg tcgccgacct gatgcccaac 60 atccgggcga tgaagtactc cggcctgttc atgcacaact tcacgggcgg cagtgccttc 120 atgaagaagg tgtactcctc cgtgcacctg gtgttcctcc tcatgcagtt caccttcatc 180 ctggtcaaca tggccctgaa cgccgaggag gtcaacgagc tgtcgggcaa cacgatcacg 240 accctcttct tcacccactg catcacgaag tttatctacc tggctgttaa ccagaagaat 300 ttctacagaa cattgaatat atggaaccag gtgaacacgc atcccttgtt cgccgagtcg 360 gatgctcgtt accattcgat cgcactggcg aagatgagga agctgttctt tctggtgatg 420 ctgaccacag tcgcctcggc caccgcctgg accacgatca ccttctttgg cgacagcgta 480 aaaatggtgg tggaccatga gacgaactcc agcatcccgg tggagatacc ccggctgccg 540 attaagtcct tctacccgtg gaacgccagc cacggcatgt tctacatgat cagctttgcc 600 tttcagatct actacgtgct cttctcgatg atccactcca atctatgcga cgtgatgttc 660 tgctcttggc tgatattcgc ctgcgagcag ctgcagcact tgaagaatat catgaagcct 720 ttgatggaat tcagcgccac gctggacacc gtcgtgccaa acagtgggga actgttcaag 780 gctggcagtg cagagcagcc gaaggaacag gagccattgc caccagtcac gccgccccag 840 ggtgaaaaca tgttggacat ggatcttcga gggatatata gcaacaggac cgacttcacg 900 accaccttcc ggccaactgc tggaatgacg ttcaacggcg gggtcgggcc aaatgggttg 960 accaagaaac aggaaatgct ggtacgaagc gccatcaagt actgggtaga gagacacaag 1020 catatcgtta gactcgtaac tgcaattgga gacgcctatg gtgtagcttt gctgctacat 1080 atgttgacta ctactattac gttaactttg ctcgcttacc aagcaacaaa gatacatgca 1140 gtagatacat acgcagcatc agtagtaggt tatttgctat attctttagg acaagtcttt 1200 atgctctgta tatttggaaa tcgtctcatt gaagagagct catcagtgat ggaagcagct 1260 tattcttgtc actggtatga tggatcagag gaggccaaaa catttgtaca gattgtttgc 1320 cagcagtgtc agaaagcgat gtcgatttca ggggcaaagt tcttcactgt atctttggat 1380 ctctttgctt cggtgttggg agctatggtt acctacttca tggtgttggt gcaactgaag 1440 tga 1443 <210> 94 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 94 cccgaccttg agataacgat cattggcacc gctg 34 <210> 95 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 95 cagcggtgcc aatgatcgtt atctcaaggt cggg 34 <210> 96 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 96 cccaaacggt tatccgtgcg tcacctcccg cg 32 <210> 97 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 97 cgcgggaggt gacgcacgga taaccgtttg gg 32 <210> 98 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 98 cctcccgcgg tggtccagca tttgacgacc cag 33 <210> 99 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 99 ctgggtcgtc aaatgctgga ccaccgcggg agg 33 <210> 100 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 100 cagactcgca cctcggctac gcactacctg atc 33 <210> 101 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 101 gatcaggtag tgcgtagccg aggtgcgagt ctg 33 <210> 102 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 102 ctacctgatc ttcggtatcg tcatgacgcc tacc 34 <210> 103 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 103 ggtaggcgtc atgacgatac cgaagatcag gtag 34 <210> 104 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 104 cgtgtagcac ataccgttta cgaaagtggc tgg 33 <210> 105 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 105 ccagccactttcgtaaacgg tatgtgctacacg 33 <210> 106 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 106 gggtcaagct atttccgtac gtgatttggt tc 32 <210> 107 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 107 gaaccaaatc acgtacggaa atagcttgac cc 32 <210> 108 <211> 387 <212> PRT <213> Artificial Sequence <220> <223> AgOR47·L60P‑L71F‑I134V‑S140G‑F147L <400> 108 Met Val Val Phe Asp Pro Leu Asp Asp Pro Leu Lys Val Leu Pro Leu 1 5 10 15 Pro Leu Lys Leu Leu Ala Leu Leu Gly Val Asn Lys Asn Pro Ser Glu 20 25 30 Arg Phe Arg Leu Tyr Ala Ile Tyr Ala Tyr Leu Cys Ile Ala Leu Phe 35 40 45 Ile Pro Lys Leu Cys Leu Gly Tyr Glu Thr Ile Pro Gln Cys Phe Arg 50 55 60 Ser Ile Ala Glu Gly Met Phe Ser Phe Asn Thr Thr Ile Thr Phe Ile 65 70 75 80 Met Leu Pro Leu Lys Met Asp Asn Leu Glu Asp Leu Leu Lys Asn Leu 85 90 95 Lys Arg Phe Thr Glu Ile Val Ile Phe Asn Glu Asp Tyr Glu Gln Ile 100 105 110 Leu Ile Arg Leu Asn Thr Ala Ile His Lys Phe Thr Lys Tyr Tyr Phe 115 120 125 Ile Phe Thr Asn Gly Val Val Phe Ala Met Thr Gly Ser Thr Ile Ala 130 135 140 Gly Met Leu Tyr Thr Tyr Tyr Ala Lys Asp Ser Glu Tyr Ser Ala Ala 145 150 155 160 Phe Pro Leu Ile Met Glu Asn Arg Leu Tyr Leu Ile Asp Ser His Tyr 165 170 175 Asn Leu Gly His Cys Phe Val His Gln Ala Leu Met Phe Phe Ala Leu 180 185 190 Tyr Ile Leu Leu Val Met Phe Thr Ala Lys Ala Gly Thr Leu Phe Gly 195 200 205 Leu Ile Arg Phe Cys Ser Thr Val Leu Gly Ile Ile Val Leu Lys Ile 210 215 220 Glu Arg Leu Ser Gln Ile Gly Pro Val Asp Lys Tyr Thr Ala Glu Leu 225 230 235 240 Asn Glu Ile Ile Glu Leu His Gln Leu Ala Ile Lys Cys Ser Arg Gln 245 250 255 Leu Gln Asn Ile Leu Met Glu Ile Leu Leu Ala Gln Phe Thr Gly Cys 260 265 270 Val Phe Ile Trp Cys Phe Met Leu Tyr Tyr Val Met Ile Ser Gly Ile 275 280 285 Thr Ala Glu Gly Ile Ala Val Val Ala Met Leu Ile Ala Leu Ser Thr 290 295 300 Glu Thr Phe Ile Phe Cys Leu Leu Gly Asn Glu Leu Thr Leu Lys Gly 305 310 315 320 Leu Glu Ile Ser Thr Ala Met Tyr Phe Thr Asn Trp Tyr Asp Gln Pro 325 330 335 Val Lys Leu Gln Lys Met Val Val Pro Ile Ile Gln Gln Ser Gln Gln 340 345 350 Arg Ile Gly Ile Thr Ala Ala Lys Phe Tyr Tyr Ile Asp Tyr Asn Arg 355 360 365 Tyr Gly Gln Ser Leu Lys Thr Ala Tyr Ser Phe Tyr Leu Leu Leu Lys 370 375 380 Asp Ile Phe 385 <210> 109 <211> 1164 <212> DNA <213> Artificial Sequence <220> <223> AgOR47·L60P‑L71F‑I134V‑S140G‑F147L <400> 109 atggtggtgt tcgaccctct ggacgatccc ctgaaagtgc tgcctctgcc tctgaaactg 60 ctggccctgc tgggcgtgaa caagaaccct agcgagcggt tcagactgta cgccatctac 120 gcctacctgt gtatcgccct gttcatcccc aagctgtgcc tgggctacga gacaatcccg 180 cagtgcttcc ggtctatcgc cgagggcatg ttcagcttca ataccaccat caccttcatc 240 atgctgcccc tgaagatgga caacctggaa gatctgctga agaacctgaa gcggttcacc 300 gagatcgtga tcttcaacga ggactacgag cagatcctga tccggctgaa caccgccatc 360 cacaagttca ccaagtacta cttcatcttc accaacggcg tcgtgttcgc catgaccggc 420 tctacaatcg ccggcatgct ctacacctac tacgccaagg acagcgagta cagcgccgcc 480 tttcctctga tcatggaaaa ccggctgtac ctgatcgaca gccactacaa cctgggccac 540 tgcttcgtgc accaggctct gatgttcttt gccctgtaca tcctgctcgt gatgttcacc 600 gccaaggccg gcacactgtt cggcctgatc agattctgta gcaccgtgct gggcatcatc 660 gtgctgaaga tcgagcggct gtctcagatc ggccccgtgg ataagtatac cgccgagctg 720 aacgagatca tcgagctgca ccagctggcc atcaagtgca gcagacagct gcagaacatc 780 ctgatggaaa tcctgctggc tcagttcacc ggctgcgtgt tcatctggtg cttcatgctg 840 tactacgtga tgatcagcgg catcaccgcc gagggaattg ccgtggtggc tatgctgatt gccctgtcta ccgagacttt catcttctgc ctgctgggaa acgagctgac cctgaaaggc ctggaatca gcaccgccat gtacttcaca aattggtacg accagcctgt gaagctccag aaaatggtgg tgcccatcat ccagcagtcc cagcagaga tcggaatcac agccgccaag ttctactaca tcgactaca cagatacggc cagagcctga aaaccgccta cagcttctac ctgctgctga aggacatctt ctga
Claims
1. The use of olfactory receptor proteins in the manufacture of nitro compound detection elements, wherein, The olfactory receptor protein consists of the amino acid sequence shown in SEQ ID NO: 21, 25, 27 or 29.
2. The use according to claim 1, wherein, The nitro compound is a compound containing a structure in which a nitro group is directly attached to a benzene ring, and / or a compound containing two or more nitro groups.
3. An olfactory receptor protein, wherein, The olfactory receptor protein consists of the amino acid sequence shown in SEQ ID NO: 25, 27 or 29.
4. A polynucleotide containing the coding sequence of the olfactory receptor protein of claim 3.
5. A cell containing the polynucleotide of claim 4.
6. A nitro compound detection sensor, comprising: a lipid bilayer membrane containing a nitro compound detection element, a cell, or a non-human animal containing said cell, wherein, The nitro compound detection element is composed of olfactory receptor proteins, which are composed of amino acid sequences shown in 25, 27, or 29.
Citation Information
Patent Citations
Chemical substance detection sensor and chemical substance detection method
JP2012078351A
Smell sensor
JP2013027376A
Olfactory receptor co-receptor
JP2018050556A
Device and method for detecting target material using olfactory receptor complex and method for manufacturing the detector
JP2018059786A