Expression cassette, strain for fermentative production of l-lysine and application thereof

By introducing the *Vibrio glutamicum* hemoglobin vhb gene into *Corynebacterium glutamicum* and expressing it using the Peftu or Psod promoter, the problem of insufficient L-lysine production in existing technologies was solved, resulting in shorter fermentation time and increased yield, especially high-efficiency production under straw hydrolysate conditions.

CN116179586BActive Publication Date: 2026-07-14CATHAY BIOTECH INC +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CATHAY BIOTECH INC
Filing Date
2021-11-26
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

There is a lack of genetically engineered bacteria in the current technology that can significantly increase the L-lysine production of Corynebacterium glutamicum, especially in terms of oxygen utilization and fermentation time.

Method used

By introducing the *Vibrio glutamicum* hemoglobin vhb gene into *Corynebacterium glutamicum* and expressing it using the Peftu or Psod promoter, the strain's oxygen uptake and transport functions were improved. Combined with the knockout of the ldh gene, fermentation conditions were optimized to increase L-lysine production.

Benefits of technology

It significantly shortens fermentation time and increases L-lysine yield, especially when using straw hydrolysate, showing significant production advantages and promising application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003378509740000081
    Figure BDA0003378509740000081
Patent Text Reader

Abstract

The application discloses an expression cassette for fermentative production of L-lysine, a strain and application thereof. The expression cassette comprises a promoter and a vhb gene of Vitreoscilla hemoglobin, and the promoter comprises Peftu or Psod. The application further discloses a nucleic acid comprising the expression cassette, a recombinant expression vector comprising the nucleic acid, a genetically engineered bacterium comprising the nucleic acid or the recombinant expression vector and application thereof. The application further discloses a preparation method of the genetically engineered bacterium and a method for preparing L-lysine by fermenting the genetically engineered bacterium. The application improves the oxygen absorption and transport function of the strain by imparting the hemoglobin function of Corynebacterium glutamicum, significantly shortens the fermentation time and improves the L-lysine yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an expression cassette, strain, and application for the fermentation production of L-lysine. Background Technology

[0002] Lysine, also known as 2,6-diaminohexanoic acid, is a basic amino acid. Lysine plays important nutritional and physiological roles and is widely used in the pharmaceutical, food, and feed industries. It can also be used as a precursor in the synthesis of nylon polymer materials. The main production methods for lysine include protein hydrolysis, chemical synthesis, and fermentation. Among these, microbial fermentation is the most widely used method for industrial production of lysine due to its low production cost, high production intensity, high specificity, and minimal environmental pollution.

[0003] Prokaryotic microorganisms used for lysine production mainly include Corynebacterium, Brevibacterium, Nocardia, Pseudomonas, Escherichia, and Bacillus. Corynebacterium glutamicum is the most important and safest strain for amino acid fermentation, and improving its ability to oversynthesize various amino acids through metabolic modification has been a research hotspot. For example, overexpressing genes related to the lysine synthesis pathway and feedback inhibition desensitization, strengthening the energy supply pathway starting from glucose metabolism, and optimizing lysine transport proteins on the cell membrane have all effectively improved lysine productivity.

[0004] Besides continuously enhancing the metabolic pathway for lysine production, fermentation methods that open up alternative pathways to non-lysine metabolism are also worth exploring in depth. Hemoglobin, an oxygen-binding protein, is widely found in plants, animals, and microorganisms, capable of storing and transporting oxygen. Three types of hemoglobin have been identified in bacteria: single-domain hemoglobin, flavin hemoglobin, and truncated hemoglobin. Taking *Vitreoscilla hemoglobin* (VHb) as an example, it contains two identical subunit molecules, each containing two heme b molecules. Expression of the *Vitreoscilla hemoglobin* gene (vhb) in different hosts can enhance the synthesis of proteins and metabolites in various hosts, thereby promoting growth. Currently, the application of hemoglobin in lysine production by *Corynebacterium glutamicum* has not been reported. Summary of the Invention

[0005] To address the lack of a high-yield L-lysine-producing genetically engineered bacterium in existing technologies, this invention provides an expression cassette that increases L-lysine production in *Corynebacterium glutamicum* and a genetically engineered bacterium for efficient L-lysine production. Studies on L-lysine production in *Corynebacterium glutamicum* from a hemoglobin perspective have not been reported. This invention improves the oxygen uptake and transport function of *Corynebacterium glutamicum* by endowing it with hemoglobin function, significantly shortening fermentation time and increasing L-lysine yield.

[0006] To solve the above-mentioned technical problems, one of the technical solutions provided by the present invention is: an expression cassette, the expression cassette comprising a promoter and a *Vibrio hygroscopicus* hemoglobin vhb gene, the *Vibrio hygroscopicus* hemoglobin vhb gene being, for example, a codon-optimized vhb gene, and the promoter comprising Peftu or Psod.

[0007] The expression cassette as described in one of the technical solutions, wherein the amino acid sequence encoding the vhb gene and the nucleotide sequence of the vhb gene are shown in SEQ ID NO:20 and SEQ ID NO:1, respectively. Alternatively, a cassette having at least 95%, or more specifically, 97% or 99% or more of the same identity as SEQ ID NO:20 and SEQ ID NO:1 is considered to fall within the scope of protection of this patent.

[0008] The expression cassette as described in one of the technical solutions, wherein the nucleotide sequence of the Peftu promoter is shown in SEQ ID NO:2, and / or the nucleotide sequence of the Psod promoter is shown in SEQ ID NO:3.

[0009] To solve the above-mentioned technical problems, the second technical solution provided by the present invention is: an isolated nucleic acid, wherein the nucleic acid comprises an expression cassette as described in the first technical solution.

[0010] To solve the above-mentioned technical problems, the third technical solution provided by the present invention is: a recombinant expression vector, wherein the recombinant expression vector includes the expression cassette as described in the first technical solution, or includes the nucleic acid as described in the second technical solution.

[0011] In a preferred embodiment of the present invention, the backbone plasmid of the recombinant expression vector may be pK18mob.

[0012] To solve the above-mentioned technical problems, the fourth technical solution provided by the present invention is: a genetically engineered bacterium, wherein the genetically engineered bacterium is transformed with an expression cassette as described in the first technical solution, or a nucleic acid as described in the second technical solution, or a recombinant expression vector as described in the third technical solution.

[0013] Preferably, the originating bacterium of the genetically engineered bacteria is Corynebacterium glutamicum.

[0014] In some preferred embodiments, the starting strain is C. glutamicum B253. Although the starting strain in the embodiments of the present invention is C. glutamicum B253, which is resistant to straw hydrolysate, it can be seen from the examples that when the culture medium is a prepared glucose medium, the genetically engineered bacteria of the present invention also produce L-lysine better than the starting strain. That is, resistance to the inhibitory toxicity of straw hydrolysate is not a necessary condition for the starting strain. Other Corynebacterium glutamicum can also be selected as the starting strain.

[0015] As described in technical solution four, when the expression cassette as described in technical solution one, the nucleic acid as described in technical solution two, or the recombinant expression vector as described in technical solution three is introduced into the starting bacteria, the expression cassette is integrated into the genome of the starting bacteria through homologous recombination, or exists in the starting bacteria in a non-integrated form.

[0016] In a preferred embodiment of the present invention, when the genetically engineered bacteria includes the expression cassette, the expression cassette is integrated into the genome of the originating bacteria.

[0017] As described in technical solution four, the genetically engineered bacteria preferably do not express lactate dehydrogenase (LDH), for example, its ldh gene is knocked out.

[0018] In a preferred embodiment of the present invention, when the expression cassette as described in one technical solution, the nucleic acid as described in another technical solution, or the recombinant expression vector as described in a third technical solution is introduced into the starting bacterium, the expression cassette is integrated into the ldh gene locus on its genome. The locus_tag of the ldh gene is SB89_13725.

[0019] To solve the above-mentioned technical problems, the fifth technical solution provided by the present invention is: a method for preparing L-lysine, the method comprising fermenting the genetically engineered bacteria as described in the fourth technical solution in a fermentation medium.

[0020] The fermentation conditions described in this invention can be conventional in the art. For example, the fermentation medium is a medium containing not less than 25 g / L of glucose, and / or the fermentation conditions are: a temperature of 28-32°C, and / or an aeration rate of 1.0-1.7 vvm, and / or a pH of 6.8-7.2, and / or stirring during fermentation at a speed of 400-800 rpm.

[0021] In a preferred embodiment of the present invention, the fermentation medium contains 80-150 g / L of glucose, the fermentation temperature is 30°C, the pH is 7.0, the aeration rate is 1.4 vvm, and the stirring speed is 600 rpm.

[0022] The fermentation medium described in this invention can be conventional in the art. Preferably, the fermentation medium described in this invention contains glucose, such as straw hydrolysate. The straw hydrolysate is formed by the degradation of large-molecule carbohydrates such as cellulose, hemicellulose and lignin in crop straw into small-molecule carbohydrates such as glucose after enzymatic hydrolysis and saccharification.

[0023] In accordance with conventional practice, ammonium sulfate, methionine, and threonine are generally added to the hydrolysate. In a preferred embodiment of the present invention, 15–25 g / L of ammonium sulfate, 2–8 g / L of methionine, and 2–8 g / L of threonine are added to the hydrolysate.

[0024] Furthermore, in accordance with conventional practice in the art, the crop straw can generally undergo pretreatment before enzymatic hydrolysis to prepare the hydrolysate. This pretreatment may include screening, impurity removal, dry acid pretreatment, and / or detoxification treatment, thereby improving the saccharification efficiency of the crop straw and reducing the content of impurities such as acetic acid, furfural, and 5-hydroxybenzaldehyde. The detoxification treatment can be a biological detoxification treatment. This detoxification treatment removes inhibitors that are toxic to the fermentation cells.

[0025] To solve the above-mentioned technical problems, the sixth technical solution provided by the present invention is: a method for preparing genetically engineered bacteria as described in the third technical solution, comprising the following steps (in no particular order):

[0026] (1) The expression cassette as described in one of the technical solutions, the nucleic acid as described in the second of the technical solutions, or the recombinant expression vector as described in the third of the technical solutions is introduced into the starting bacteria;

[0027] (2) Knock out the ldh gene to obtain the genetically engineered bacteria.

[0028] In a preferred embodiment of the present invention, the expression cassette as described in technical solution three, the nucleic acid as described in technical solution two, or the recombinant expression vector as described in technical solution three is first introduced into the starting bacterium C. glutamicum B253, and the ldh gene is knocked out simultaneously to obtain the genetically engineered bacterium.

[0029] To solve the above-mentioned technical problems, the seventh technical solution provided by the present invention is: the application of the expression cassette as described in the first technical solution, the nucleic acid as described in the second technical solution, the recombinant expression vector as described in the third technical solution, or the genetically engineered bacteria as described in the fourth technical solution in the preparation of L-lysine.

[0030] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0031] The reagents and raw materials used in this invention are all commercially available.

[0032] The positive and progressive effects of this invention are as follows:

[0033] This invention improves the oxygen uptake and transport function of *Corynebacterium glutamicum* by conferring hemoglobin function, significantly shortening fermentation time and increasing L-lysine production. Furthermore, using Peftu and Psod as promoters for vhb in the expression cassette allows for efficient expression, improving cellular oxygen utilization, enhancing the oxygen uptake rate of the engineered bacteria, increasing glucose utilization efficiency, and thus increasing L-lysine production. When using straw hydrolysate, the lysine production of the genetically engineered bacteria of this invention is significantly higher than that of the original strain. The genetically engineered bacteria provided by this invention can effectively utilize agricultural waste such as straw for fermentation and has promising application prospects. Detailed Implementation

[0034] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0035] I. Strains used in this invention

[0036] Escherichia coli DH5α was used for the construction of expression plasmids and knockout plasmids.

[0037] Corynebacterium glutamicum B253: purchased from the Shanghai Institute of Industrial Microbiology.

[0038] In this experiment, C. glutamicum B253 was mainly used as the starting strain.

[0039] II. Reagents and Culture Media

[0040] Cellulase CTec 2.0, used for hydrolyzing cellulose and hemicellulose in lignocellulose, was purchased from Novozymes (China) Co., Ltd., Beijing, China. The filter paper activity of cellulase was 203.2 FPU / mL, and the cellobiase activity was 4900.0 CBU / mL, as determined by the NREL LAP-006 guideline. The protein concentration was 87.3 mg / mL, determined by the Bradford method. Restriction endonucleases, used to cut plasmids or gene fragments to generate sticky ends, were purchased from Thermo Scientific (Wilmington, DE, USA). DNA polymerase was used to amplify gene fragments, and DNA ligase was used to ligate digested gene fragments and plasmid vectors; both enzymes were purchased from Takara (Otsu, Japan). A seamless cloning kit was used to ligate gene fragments containing homologous fragments and plasmid vectors; this kit was purchased from Hanheng Biotechnology Co., Ltd. (Nanjing, China). Plasmid extraction kits, PCR product purification and recovery kits, and gel extraction kits were purchased from Shanghai Jierui Biotechnology Co., Ltd. (Shanghai, China). Other reagents were purchased from local suppliers.

[0041] The culture medium used to culture Escherichia coli was Luria-Bertani (LB) medium, with the following components: 10.0 g / L sodium chloride, 10.0 g / L peptone, and 5.0 g / L yeast extract.

[0042] The specific components of the culture medium used to culture Corynebacterium glutamicum are as follows:

[0043] (1) Seed culture medium: 25 g / L glucose, 1.5 g / L potassium dihydrogen phosphate, 2.5 g / L urea and 0.6 g / L magnesium sulfate, 25 g / L corn steep liquor.

[0044] (2) Fermentation medium: 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, 20 g / L corn steep liquor, and glucose as a carbon source as needed.

[0045] Example 1: Starting strain C. glutamicum B253

[0046] C. glutamicum B253 is a strain used for lysine production and was used as the starting strain in this experiment. It has been disclosed in the prior art that C. glutamicum B253 can tolerate toxic inhibitors (acetic acid, furfural, 5-hydroxybenzaldehyde, etc.) in straw hydrolysate and can carry out normal growth and lysine production.

[0047] Example 2: Construction of Peftu_vhb expression box

[0048] First, an integration plasmid for the hemoglobin gene vhb was constructed. The specific construction method is as follows: Using the genome of C. glutamicum as a template, the Peftu promoter (as shown in SEQ ID NO:2) was amplified by PCR using primers Peftu-F (as shown in SEQ ID NO:5) and Peftu-R (as shown in SEQ ID NO:6); using the codon-optimized hemoglobin vhb gene as a template, the vhb fragment (as shown in SEQ ID NO:1) was amplified by PCR using primers vhb-F (as shown in SEQ ID NO:7) and vhb-R (as shown in SEQ ID NO:8); using Peftu and vhb as templates, the Peftu_vhb fusion fragment (as shown in SEQ ID NO:9) was obtained by overlapping extension PCR using primers Peftu-F and vhb-R.

[0049] Peftu-F:gaaatcaggaagtgggatcgaaacgaaaagcaatttgcttttcgacg SEQ ID NO:5

[0050] Peftu-R:tgtatgtcctcctggacttcgtg SEQ ID NO:6

[0051] vhb-F:ccacgaagtccaggaggacatacaatgctggaccagcagaccatc SEQ ID NO:7

[0052] vhb-R:ttactcaacagcctgagcgtac SEQ ID NO:8

[0053] Example 3: Integration of the Peftu_vhb expression cassette into the ldh gene locus

[0054] Using the genome of *C. glutamicum* as a template, the ldh-up fragment (as shown in SEQ ID NO:12) was amplified by PCR using primers ldh-up-F (as shown in SEQ ID NO:10) and ldh-up-R (as shown in SEQ ID NO:11); using the genome of *C. glutamicum* as a template, the ldh-down fragment (as shown in SEQ ID NO:13) was amplified by PCR using primers ldh-down-F (as shown in SEQ ID NO:14) and ldh-down-R (as shown in SEQ ID NO:14). (As shown in NO:15); Using the ldh-up fragment, Peftu_vhb, and ldh-down fragment as templates, the Δldh::vhb fusion fragment was obtained by overlapping extension PCR using ldh-up-F and ldh-down-R primers. This fragment was then treated with EcoRI and HindIII restriction enzymes, and subsequently inserted into the pK18mob plasmid (available for purchase at http: / / www.biovector.net / product / 1089.html) using T4 ligase to obtain the pK18-Δldh::vhb plasmid. During this process, successfully ligated plasmids can be screened using seed culture plates containing kanamycin resistance.

[0055] lhd-up-F:tcccccgggggaacaccatgcgattaaggtgc SEQ ID NO:10

[0056] lhd-up-R:caaattgcttttcgtttcgatcccacttcctgatttccctaac SEQ ID NO:11

[0057] lhd-down-F:tacgctcaggctgttgagtaaatctttggcgcctagttggc SEQ ID NO:13

[0058] lhd-down-R:gtaagcttgtctgggacgttgatgacgctg SEQ ID NO:14

[0059] Next, the integration plasmid pK18-Δldh::vhb was transformed into C. glutamicum via electroporation, and it integrated into the locus_tag at SB89_13725. Strains exhibiting correct homologous recombination were then screened using PCR verification to obtain recombinant Corynebacterium glutamicum, named cg_vhb01.

[0060] Example 4: Performance analysis of lysine production by genetically engineered bacteria

[0061] The performance of the genetically engineered strain in lysine production was evaluated by shake-flask fermentation. The fermentation process consisted of a fermentation medium containing 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, and 20 g / L corn steep liquor, with 120 g / L glucose added as a carbon source and 25 μg / mL kanamycin added. Fermentation was carried out in 250 mL shake flasks at 30 °C and 200 rpm for 48 h. NMR analysis revealed that the glucose-lysine conversion rates of the starting strain and the genetically engineered strain were 24.78% and 33.15%, respectively, indicating that the introduction of the vhb protein improved the lysine conversion rate.

[0062] Example 5: Fermentation of genetically engineered bacteria constructed using the Psod promoter

[0063] The preparation of the genetically engineered bacteria is the same as in Examples 2 and 3, except that in Example 5, the promoter is replaced with Psod (nucleotide sequence as shown in SEQ ID NO:3), and the primers used are Psod-F / Psod-R (as shown in SEQ ID NO:16 and SEQ ID NO:17).

[0064] Psod-F:gaaatcaggaagtgggatcgaaaagcggtaaccatcacgggttc SEQ ID NO:16

[0065] Psod-R:gggtaaaaaatcctttcgtaggtttcc SEQ ID NO:17

[0066] Comparative Example 1: Fermentation of genetically engineered bacteria constructed using the PH36 promoter

[0067] The preparation of the genetically engineered bacteria is the same as in Examples 2 and 3, except that in Comparative Example 1, the promoter is replaced with PH36 (nucleotide sequence as shown in SEQ ID NO:4), and the primers used are PH36-F / PH36-R (as shown in SEQ ID NO:18 and SEQ ID NO:19).

[0068] PH36-F:gaaatcaggaagtggggatcgaaacaaaagctgggtacctctatctg SEQ ID NO:18

[0069] PH36-R:ggatcccatgctactcctaccaac SEQ ID NO:19

[0070] The fermentation process of Example 5 and Comparative Example 1 was the same as that of Example 4, and the fermentation results are shown in Table 1. It was found that the Peftu and Psod promoters achieved better results in regulating hemoglobin, and the Peftu promoter was preferred.

[0071] Table 1. Promotional Screening

[0072]

[0073] Example 6: Lysine fermentation of modified strains in lignocellulose hydrolysate

[0074] Wheat straw was crushed and then sieved through a 10 mm diameter sieve. The sieved straw was then washed to remove impurities such as mud, stones, and metal. After drying to constant weight in a 105℃ oven, it was stored in sealed plastic bags for later use. Following dry acid pretreatment, biological detoxification, and enzymatic saccharification, a wheat straw hydrolysate containing 95.4 g / L glucose was obtained. 20 g / L ammonium sulfate, 5 g / L methionine, and 5 g / L threonine were added to the hydrolysate. The modified strain cg_vhb01 obtained in Example 3 and the original strain C. glutamicum B253 were cultured in the wheat straw hydrolysate for comparative fermentation. The fermentation temperature was 30℃, the pH was controlled at 7.0 with ammonia, the aeration rate was 1.4 vvm, and the fermentation speed was 600 rpm. Fermentation was terminated when glucose was exhausted. Lysine production was detected by nuclear magnetic resonance (NMR).

[0075] The results showed a significant difference in fermentation time between the two strains when wheat straw hydrolysate was used as the culture medium. The original strain required 72 hours to metabolize all glucose, while the recombinant strain cg_vhb01 completed fermentation within 56 hours, reducing the fermentation time by 16 hours. Furthermore, the recombinant strain achieved a final lysine yield of 26.4 g / L, which was 9.54% higher than the control strain. Therefore, the recombinant strain obtained in this invention possesses strong inhibitor tolerance and high-efficiency lysine production capacity, demonstrating promising application prospects.

[0076] The above description of operational examples of the technical solution of the present invention is not intended to limit the application of the present invention. All equivalent substitutions of operational conditions are within the protection scope of the present invention. SEQUENCE LISTING <110> Shanghai Kaisai Biotechnology Co., Ltd. CIBT USA <120> Expression cassettes, strains, and applications for the fermentation production of L-lysine. <130> P21018212C <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 441 <212> DNA <213> Artificial Sequence <220> <223> vhb snowflakes <400> 1 atgctggacc agcagaccat caacatcatc aaggctaccg ttccagttct gaaggagcac 120. ggcgttacca tcaccaccac cttctacaag aacctgttcg ctaagcaccc agaggttcgc 180. ccctgttcg acatgggccg ccggagtcc ctggagcagc caaaggctct ggctatgacc gttctggctg ctgctcagaa catcgagaac ctgccagcta tcctgccagc tgttaagaag atcgctgtta agcactgcca ggctggcgtt gctgctgctc actacccaat cgttggccag 360. gagctgctgg gcgctatcaa ggaggttctg ggcgacgctg ctaccgacga catcctggac gcttggggca aggcttacgg cgttatcgct gacgttttca tccaggttga ggctgacctg 420 tacgctcagg ctgttgagta a <210> 2 <211> 335 <212> DNA <213> Artificial Sequence <220> <223> Peftu snowflakes <400> 2 cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60 cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60 tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120 tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120 ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180 ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180 aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240 aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240 tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300 tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300 agtcgtagcc accacgaagt ccaggaggac ataca 335 agtcgtagcc accacgaagt ccaggaggac ataca 335 <210> 3<210> 3 <211> 288<211> 288 <212> DNA<212> DNA <213> Artificial Sequence<213> Artificial Sequence <220> <220> <223> Psod promoter <223> Psod promoter <400> 3 <400> 3 agcggtaacc atcacgggtt cgggtgcgaa aaaccatgcc ataacaggaa tgttcctttc 60 agcggtaacc atcacgggtt cgggtgcgaa aaaccatgcc ataacaggaa tgttcctttc 60 gaaaattgag gaagccttat gccctacaac cctacttagc tgccaattat tccgggcttg 120 gaaaattgag gaagccttat gccctacaac cctacttagc tgccaattat tccgggcttg 120 tgacccgcta cccaataaat aggtgggctg aaaaatttcg ttgcaatatc aacaaaaagg 180 tgacccgcta cccaataaat aggtgggctg aaaaatttcg ttgcaatatc aacaaaaagg 180 cctatcattg ggaagtgtcg caccaagtac ttttgcgaag cgccatctga cggattttca 240 cctatcattg ggaagtgtcg caccaagtac ttttgcgaag cgccatctga cggattttca 240 aaagatgtat atgctcggtg cggaaaccta cgaaaggatt ttttaccc 288 <210> 4 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> PH36String <400> 4 60. caaaagctgg gtacctctat ctggtgccct aaacggggga attackcgg gcccagggtg gtcgcacctt ggttggtagg agtagcatgg gatcc 95 <210> 5 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Peftu‐F <400> 5 gaatcagga agtgggatcg aaacgaaaag caatttgctt ttcgacg <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Peftu‐R <400> 6 tgtatgtcct cctggacttc gtg <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> vhb‐F <400> 7 ccacgaagtc caggaggaca tacaatgctg gaccagcaga ccatc 45 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> vhb‐R <400> 8 ttactcaaca gcctgagcgt ac 22 <210> 9 <211> 776 <212> DNA <213> Artificial Sequence <220> <223> Peftu_vhb <400> 9 cgaaaagcaa tttgctttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60 tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120 ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180 aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240 tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300 agtcgtagcc accacgaagt ccaggaggac atacaatgct ggaccagcag accatcaaca 360 tcatcaaggc taccgttcca gttctgaagg agcacggcgt taccatcacc accaccttct 420 acaagaacct gttcgctaag cacccagagg ttcgcccact gttcgacatg ggccgccagg 480 agtccctgga gcagccaaag gctctggcta tgaccgttct ggctgctgct cagaacatcg 540 agaacctgcc agctatcctg ccagctgtta agaagatcgc tgttaagcac tgccaggctg 600 gcgttgctgc tgctcactac ccaatcgttg gccaggagct gctgggcgct atcaaggagg 660 ttctgggcga cgctgctacc gacgacatcc tggacgcttg gggcaaggct tacggcgtta 720 tcgctgacgt tttcatccag gttgaggctg acctgtacgc tcaggctgtt gagtaa 776 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> lhd‑up‑F <400> 10 tcccccgggg gaacaccatg cgattaaggt gc 32 <210> 11 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> lhd‑up‑R <400> 11 caaattgctt ttcgtttcga tcccacttcc tgatttccct aac 43 <210> 12 <211> 943 <212> DNA <213> Artificial Sequence <220> <223> ldh‑up <400> 12 ggaacaccat gcgattaagg tgcgctgctt gaattgcaga attatgcaag atgcgccgca 60 acaaaacgcg atcggccaag gtcaaagtgg tcaatgtaat gaccgaaacc gctgcgatga 120 aactaatcca cggcggtaaa aacctctcaa ttaggagctt gacctcatta atgctgtgct 180 gggttaattc gccggtgatc agcagcgcgc cgtaccccaa ggtgccgaca ctaatgcccg 240 cgatcgtctc cttcggtcca aaattcttct gcccaatcag ccggatttgg gtgcgatgcc 300 tgatcaatcc cacaaccgtg gtggtcaacg tgatggcacc agttgcgatg tgggtggcgt 360 tgtaaatttt cctggatacc cgccggttgg ttctggggag gatcgagtgg attcccgtcg 420 ctgacgcatg ccccaccgct tgtaaaacag ccaggttagc agccgtaacc caccacggtt 480 tcggcaacaa tgacggcgag agagcccacc acattgcgat ttccgctccg ataaagccag 540 cgcccatatt tgcagggagg attcgcctgc ggtttggcga cattcggatc cccggaacca 600 gctctgcaat cacctgcgcg ccgagggaag cgaggtgggt ggcaggtttt agtgcgggtt 660 taagcgttgc caggcgagtg gtgagcagag acgctagtct ggggagcgaa accatattga 720 gtcatcttgg cagagcatgc acaattctgc agggcataga ttggttttgc tcgatttaca 780 atgtgatttt ttcaacaaaa ataacacatg gtctgaccac attttcggac ataatcgggc 840 ataattaaag gtgtaacaaa ggaatccggg cacaagctct tgctgatttt ctgagctgct 900 ttgtgggttg tccggttagg gaaatcagga agtgggatcg aaa 943 <210> 13 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> lhd‑down‑F <400> 13 tacgctcagg ctgttgagta aatctttggc gcctagttgg c 41 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lhd‑down‑R <400> 14 gtaagcttgt ctgggacgtt gatgacgctg 30 <210> 15 <211> 959 <212> DNA <213> Artificial Sequence <220> <223> ldh‑down <400> 15 atctttggcg cctagttggc gacgcaagtg tttcattgga acacttgcgc tgccaacttt 60 ttggtttacg ggcaaaatga aactgttgga tggaatttaa agtgtttgta gcttaaggag 120 ctcaaatgaa tgagtttgac caggacattc tccaggagat caagactgaa ctcgacgagt 180 taattctaga acttgatgag gtgacacaaa ctcacagcga ggccatcggg caggtctccc 240 caacccatta cgttggtgcc cgcaacctca tgcattacgc gcatcttcgc accaaagacc 300 tccgtggcct gcagcaacgc ctctcctctg tgggagctac ccgcttgact accaccgaac 360 cagcagtgca ggcccgcctc aaggccgccc gcaatgttat cggagctttc gcaggtgaag 420 gcccacttta tccaccctca gatgtcgtcg atgccttcga agatgccgat gagattctcg 480 acgagcacgc cgaaattctc cttggcgaac ccctaccgga tactccatcc tgcatcatgg 540 tcaccctgcc caccgaagcc gccaccgaca ttgaacttgt ccgtggcttc gccaaaagcg 600 gcatgaatct agctcgcatc aactgtgcac acgacgatga aaccgtctgg aagcagatga 660 tcgacaacgt ccacaccgtt gcagaagaag ttggccggga aatccgcgtc agcatggacc 720 ttgccggacc aaaagtacgc accggcgaaa tcgccccagg cgcagaagta ggtcgcgcac 780 gagtaacccg cgacgaaacc ggaaaagtac tgacgcccgc aaaactgtgg atcaccgccc 840 acggctccga accagtccca gcccccgaaa gcctgcccgg tcgccccgct ctgccgattg 900 aagtcacccc agaatggttc gacaaactag aaatcggcag cgtcatcaac gtcccagac 959 <210> 16 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Psod‑F <400> 16 gaaatcagga agtgggatcg aaaagcggta accatcacgg gttc 44 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Psod‑R <400> 17 gggtaaaaaa tcctttcgta ggtttcc 27 <210> 18 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> PH36‑F <400> 18 gaaatcagga agtgggatcg aaacaaaagc tgggtacctc tatctg 46 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PH36‑R <400> 19 ggatcccatg ctactcctac caac 24 <210> 20 <211> 146 <212> PRT <213> Artificial Sequence <220> <223> vhb amino acid sequence <400> 20 Met Leu Asp Gln Gln Thr Ile Asn Ile Ile Lys Ala Thr Val Pro Val 1 5 10 15 Leu Lys Glu His Gly Val Thr Ile Thr Thr Thr Phe Tyr Lys Asn Leu 20 25 30 Phe Ala Lys His Pro Glu Val Arg Pro Leu Phe Asp Met Gly Arg Gln 35 40 45 Glu Ser Leu Glu Gln Pro Lys Ala Leu Ala Met Thr Val Leu Ala Ala 50 55 60 Ala Gln Asn Ile Glu Asn Leu Pro Ala Ile Leu Pro Ala Val Lys Lys 65 70 75 80 Ile Ala Val Lys His Cys Gln Ala Gly Val Ala Ala Ala His Tyr Pro 85 90 95 Ile Val Gly Gln Glu Leu Leu Gly Ala Ile Lys Glu Val Leu Gly Asp 100 105 110 Ala Ala Thr Asp Asp Ile Leu Asp Ala Trp Gly Lys Ala Tyr Gly Val 115 120 125 Ile Ala Asp Val Phe Ile Gln Val Glu Ala Asp Leu Tyr Ala Gln Ala 130 135 140 Val Glu 145

Claims

1. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria have been transferred with an expression cassette, or nucleic acid containing the expression cassette, or a recombinant expression vector containing the expression cassette or the nucleic acid; the expression cassette contains a promoter and vitreous hemoglobin. vhb The gene, whose promoter is Peftu; the hyaline vibrio hemoglobin vhb The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the nucleotide sequence of the Peftu is shown in SEQ ID NO: 2; The origin of the genetically engineered bacteria is Corynebacterium glutamicum.

2. The genetically engineered bacteria as described in claim 1, characterized in that, The originating bacteria is C. glutamicum B253.

3. The genetically engineered bacteria as described in claim 1, characterized in that, The backbone plasmid of the recombinant expression vector is pK18mob.

4. The genetically engineered bacteria as described in claim 1, characterized in that, When the expression cassette, the nucleic acid, or the recombinant expression vector is transferred into the starting bacterium, it integrates into the genome of the genetically engineered bacterium through homologous recombination, or exists in the genetically engineered bacterium in a non-integrated form.

5. The genetically engineered bacteria as described in claim 4, characterized in that, The expression cassette is integrated into the genome of the genetically engineered bacteria.

6. The genetically engineered bacteria according to any one of claims 1-5, characterized in that, The genetically engineered bacteria do not express lactate dehydrogenase.

7. The genetically engineered bacteria as described in claim 6, characterized in that, The genetically engineered bacteria ldh The gene was knocked out.

8. The genetically engineered bacteria as described in claim 6, characterized in that, The expression cassette, or the nucleic acid, or the recombinant expression vector is transferred into the starting bacterium, causing the expression cassette to integrate into its genome. ldh Gene loci, the ldh The gene's locus_tag is SB89_13725.

9. A method for preparing L-lysine, characterized in that, The method includes fermenting the genetically engineered bacteria as described in any one of claims 1 to 8 in a fermentation medium; The fermentation medium is a medium containing not less than 25 g / L glucose, and / or the fermentation conditions are: temperature of 28-32℃, and / or aeration rate of 1.0-1.7 vvm, and / or pH of 6.8-7.2, and / or stirring during fermentation at a speed of 400-800 rpm.

10. The method as described in claim 9, characterized in that, The fermentation medium contains 80-150 g / L of glucose, the fermentation temperature is 30℃, the pH is 7.0, the aeration rate is 1.4 vvm, and the stirring speed is 600 rpm.

11. The method as described in claim 9 or 10, characterized in that, The fermentation medium is a lignocellulose hydrolysate, and / or, ammonium sulfate, methionine and threonine are added to the lignocellulose hydrolysate.

12. The method as described in claim 11, characterized in that, The lignocellulose hydrolysate is a straw hydrolysate, which is a hydrolysate formed by enzymatic hydrolysis and saccharification of crop straw.

13. The method as described in claim 12, characterized in that, Add 15-25 g / L ammonium sulfate, 2-8 g / L methionine, and 2-8 g / L threonine to the hydrolysate.

14. The method as described in claim 12 or 13, characterized in that, Before the crop straw is enzymatically hydrolyzed to prepare straw hydrolysate, it undergoes pretreatment, which includes sieving, impurity removal, dry acid pretreatment, and / or detoxification treatment.

15. A method for preparing genetically engineered bacteria as described in any one of claims 1 to 8, characterized in that, The steps include the following, and the order of these steps is not important: 1) The expression cassette, or the nucleic acid, or the recombinant expression vector is introduced into the starting bacteria; 2) Knockout ldh Genes, thus obtaining the genetically engineered bacteria.

16. The preparation method according to claim 15, characterized in that, In the preparation method, the expression cassette, the nucleic acid, or the recombinant expression vector is introduced into the starting bacteria. C. glutamicum In B253, simultaneously knock out ldh Genes, thus obtaining the genetically engineered bacteria.

17. The use of the genetically engineered bacteria as described in any one of claims 1 to 8 in the preparation of L-lysine.