Application of glioma immune escape molecular markers in auxiliary diagnosis and treatment of glioma

Abstract

The application discloses application of glioma immune escape molecular markers in auxiliary diagnosis and treatment of glioma. The application performs consistency clustering on glioma patients based on DNA methylation data of lncRNA, determines a glioma immune escape subtype, and identifies key lncRNA in the immune escape subtype. Research finds that the methylation level of LINC02447 and AL590428.1 is reduced in the glioma immune escape subtype, the expression is increased, and the expression and methylation level of the two lncRNAs are related to the prognosis of glioma, the protein level of immune escape markers FOXP3, PD-L1 and CTLA4 is reduced after the expression of the two lncRNAs is interfered, which indicates that the two lncRNAs are novel glioma immune escape markers. The application provides an auxiliary diagnosis method for immunotherapy of glioma and provides a new treatment target for the immunotherapy of glioma.

Description

Technical Field

[0001] This invention relates to a biomarker for glioma immune escape and its application, particularly to a long non-coding RNA as a biomarker for glioma immune escape and its application in the auxiliary diagnosis and treatment of glioma. This invention belongs to the field of medical technology. Background Technology

[0002] Gliomas are the most common and deadliest primary brain tumors, characterized by high proliferation rates, high invasiveness, a highly heterogeneous immunosuppressive microenvironment, and resistance to chemotherapy and targeted therapies. Immune checkpoint blockade (ICB) therapy has achieved significant success in improving the treatment of certain types of tumors. However, the unique immune microenvironment of the brain makes the application of immunotherapy in gliomas extremely challenging. During tumor development and progression, immune cells infiltrate tumor tissue, forming a tumor immune microenvironment that helps tumor cells achieve immune escape, promotes malignant tumor development, and is closely related to the response to immunotherapy.

[0003] Long non-coding RNAs (lncRNAs) are non-coding RNA molecules with transcript lengths greater than 200 bp, playing a crucial role in tumor immune regulation. Furthermore, DNA methylation is an epigenetic regulator influencing lncRNA expression, and complex regulatory relationships exist between them. However, the regulatory mechanisms between DNA methylation, lncRNAs, and immune escape in gliomas remain unclear. The inventors of this invention identify glioma immune subtypes based on lncRNA DNA methylation, thereby identifying immune escape-related lncRNA biomarkers, providing potential therapeutic targets for glioma immunotherapy. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker that can identify glioma immune subtypes, thereby assisting in the diagnosis and treatment of glioma immune subtypes.

[0005] To achieve the above objectives, the present invention employs the following technical means: In this invention, glioma patients are clustered using DNA methylation data based on lncRNAs to determine glioma immune escape subtypes and identify key lncRNAs within these subtypes. Studies have shown that glioma immune escape subtypes exhibit elevated immune cell infiltration and immune escape indices, and patients with these subtypes have poorer prognoses. LINC02447 and AL590428.1 (also known as CD109-AS1) show decreased methylation and increased expression in glioma immune escape subtypes, and both their expression and methylation levels are associated with glioma prognosis. In anti-PD1 immunotherapy, LINC02447 and AL590428.1 are expressed at low levels in patients responding to drug therapy, but highly in unresponsive patients, and high expression of LINC02447 and AL590428.1 is a risk factor for glioma patient prognosis.

[0006] Therefore, based on the above research, this invention proposes the application of glioma immune escape molecular markers in the preparation of glioma auxiliary diagnostic and therapeutic reagents, wherein the glioma immune escape molecular markers are selected from at least one of long non-coding RNAs LINC02447 and AL590428.1.

[0007] Preferably, the nucleic acid sequence of the long non-coding RNA LINC02447 transcript is shown in any one of SEQ ID NO:1-4, and the nucleic acid sequence of the long non-coding RNA AL590428.1 transcript is shown in SEQ ID NO:5.

[0008] Specifically, based on the detection results of at least one of LINC02447 and AL590428.1, if at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the glioma patient is considered to have immune escape characteristics and a poor prognosis; if at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the glioma patient is considered to have a better prognosis.

[0009] Specifically, based on the detection results of at least one of LINC02447 and AL590428.1, if at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the patient is considered unsuitable for immunotherapy and should undergo immunotherapy only after at least one of LINC02447 and AL590428.1 has been inhibited; if at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the glioma patient is considered to be able to benefit from immunotherapy.

[0010] Furthermore, the present invention also proposes the application of reagents for detecting the methylation level and expression level of glioma immune escape molecular markers in the preparation of glioma auxiliary diagnostic and therapeutic reagents, wherein the glioma immune escape molecular markers are selected from at least one of long non-coding RNAs LINC02447 and AL590428.1.

[0011] Preferably, the reagents used to detect the methylation level of glioma immune escape molecular markers are methylation-specific PCR primers designed for at least one of LINC02447 and AL590428.1, and the reagents used to detect the expression level of glioma immune escape molecular markers are qRT-PCR primers designed for at least one of LINC02447 and AL590428.1.

[0012] Reagents used to detect the methylation and expression levels of molecular markers for glioma immune escape are known in the art. For example, reagents for detecting the methylation level of molecular markers for glioma immune escape could be methylation-specific PCR (MSP) primers. Genomic DNA is treated with bisulfite, converting all unmethylated cytosine to uracil, while methylated cytosine remains unchanged. Primers targeting both methylated and unmethylated sequences are then designed for PCR. The MSP amplification products are detected by electrophoresis. If an amplified fragment is obtained using primers targeting the treated methylated DNA strand, it indicates that methylation exists at that site; otherwise, it indicates that the detected site is not methylated. Alternatively, bisulfite sequencing PCR (BSP) primers can be used. Using BSP primers, genomic DNA is treated with bisulfite, converting unmethylated cytosine to uracil, while methylated cytosine remains unchanged. Subsequently, BSP primers are designed for PCR. During amplification, uracil is completely converted to thymine. Finally, sequencing the PCR product determines whether CpG sites are methylated; this is known as the BSP-direct sequencing method. Alternatively, a pair of primers targeting bisulfite-modified DNA double strands can be designed using High Resolution Melting (HRM) at non-CpG island locations. The fragment between these primers contains the CpG islands of interest. If these CpG islands are methylated, after bisulfite treatment, the unmethylated cytosine is converted to thymine after PCR amplification, while the methylated cytosine remains unchanged. This alters the GC content in the sample, leading to a change in the melting temperature.

[0013] Reagents used to detect the expression levels of the aforementioned molecular markers of immune escape in gliomas include real-time quantitative PCR primers, etc.

[0014] Other reagents known in the art that can be used to detect the methylation level and expression level of the above-mentioned molecular markers of immune escape in gliomas are also within the scope of protection of this invention, and will not be described in detail here.

[0015] Preferably, the reagent used to detect the methylation level of LINC02447 is a methylation-specific PCR primer designed for LINC02447, with the sequence shown below: Forward: AGCGAATATTAGGAGAGGGTC Reverse: ACGCTACCTCTAATTCCCG The reagents used to detect the methylation level of AL590428.1 are methylation-specific PCR primers designed for AL590428.1, and their sequences are shown below: Forward: GGTGGGTTTTGTATTTCGAC Reverse: TACTATTAAACGCGCCCATT.

[0016] Preferably, the reagent used to detect the expression level of LINC02447 is a qRT-PCR primer designed for LINC02447, the sequence of which is shown below: Forward: CTGGTTGCTCCCCAGAAACA Reverse: TCTCTCCAGACGCCTAGTCC The reagents used to detect the expression level of AL590428.1 were qRT-PCR primers designed for AL590428.1, and their sequences are shown below: Forward: TAGCGCTCTACCAACGATGC Reverse: AGAGCCAACCCACCCTAAC.

[0017] Preferably, based on the detection results of at least one of LINC02447 and AL590428.1, if at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the glioma patient is considered to have immune escape characteristics and a poor prognosis; if at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the glioma patient is considered to have a better prognosis.

[0018] Preferably, based on the detection results of at least one of LINC02447 and AL590428.1, if at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the patient is considered unsuitable for immunotherapy and needs to have at least one of LINC02447 and AL590428.1 inhibited before immunotherapy is administered; if at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the glioma patient is considered to be able to benefit from immunotherapy.

[0019] Compared with the prior art, the beneficial effects of the present invention are: This invention proposes a novel immune escape biomarker for gliomas. Research results indicate that LINC02447 and AL590428.1 are novel immune escape biomarkers for gliomas, and the methylation and expression levels of LINC02447 and AL590428.1 are correlated with immune escape and prognosis in gliomas. When at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the glioma patient is considered to have immune escape characteristics and a poor prognosis; when at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the glioma patient is considered to have a better prognosis. Furthermore, this invention provides guidance on whether glioma patients are suitable for immunotherapy. Based on the detection results of LINC02447 and AL590428.1, when at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the patient is considered unsuitable for immunotherapy and should undergo inhibition of the corresponding lncRNA before immunotherapy. Conversely, when at least one of LINC02447 and AL590428.1 is hypermethylated or low expressed, the glioma patient is considered to be able to benefit from immunotherapy. This invention provides an auxiliary diagnostic method for glioma immunotherapy and offers a new therapeutic target for glioma immunotherapy. Attached Figure Description

[0020] Figure 1 Identification of glioma immune escape subtypes; The following are included: A. Consistent cluster analysis of gliomas; B. Distribution of immune infiltration levels among glioma subtypes; C. Prognostic analysis of glioma subtypes; D. Comparison of immune escape indices among glioma subtypes.

[0021] Figure 2 The effect of LINC02447 on immune escape in gliomas; The study included: A. The distribution of methylation and expression levels of LINC02447 in glioma subtypes; B. The expression level of LINC02447 in glioma patients undergoing immunotherapy; C. The impact of LINC02447 expression levels on glioma prognosis; and D. The impact of LINC02447 methylation levels on glioma prognosis.

[0022] Figure 3 The effect of AL590428.1 on immune escape in gliomas.

[0023] The study focuses on: A. the distribution of methylation and expression levels of AL590428.1 in glioma subtypes; B. the expression level of AL590428.1 in glioma patients undergoing immunotherapy; C. the impact of AL590428.1 expression level on glioma prognosis; and D. the impact of AL590428.1 methylation level on glioma prognosis.

[0024] Figure 4 Molecular biology experiments were conducted to demonstrate that LINC02447 is a novel immune escape marker for gliomas; The assays included: A. qRT-PCR detection of LINC02447 expression in the U251 cell line after siRNA transfection. B. CCK-8 assay detection of decreased proliferation of the U251 cell line after LINC02447 interference. C. Western blot detection of FOXP3, PD-L1, and CTLA4 protein levels in the U251 cell line after LINC02447 interference, using GAPDH as an internal control. D. Cell scratch assay showing reduced migration ability of U251 cells after LINC02447 interference. E. Chamber assay showing reduced invasion ability of U251 cells after LINC02447 interference. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001.

[0025] Figure 5 Molecular biology experiments were conducted to demonstrate that AL590428.1 is a novel immune escape marker for gliomas; The assays included: A. qRT-PCR detection of AL590428.1 expression in the U251 cell line after siRNA transfection. B. CCK-8 assay detection of decreased proliferation of U251 cell lines after AL590428.1 interference. C. Western blot detection of FOXP3, PD-L1, and CTLA4 protein levels in the U251 cell line after AL590428.1 interference, using GAPDH as an internal control. D. Cell scratch assay showing reduced migration ability of U251 cells after AL590428.1 interference. E. Chamber assay showing reduced invasion ability of U251 cells after AL590428.1 interference. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001. Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description of the specific embodiments. However, the embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0027] Example 1: Determination of novel immune escape biomarkers for gliomas 1. Identifying glioma immune subtypes based on DNA methylation The high-throughput DNA methylome and transcriptome data from gliomas used in the experiment were collected from the Cancer Genome Atlas (TCGA, https: / / portal.gdc.cancer.gov / ) database. Based on human genome location information and methylation microarray probe information, methylation 450K microarray probes were first mapped to the lncRNA promoter region (2kb upstream and downstream of the transcription start site), and the lncRNA methylation level was quantified based on the average methylation level of the probes. ConsensusClusterPlus R package was used to perform consensus clustering on the lncRNA methylation of the top 5% of the standard deviation as features, and C1 and C2 subtypes with more than 5 samples were selected for subsequent analysis. Figure 1 A). The level of immune cell infiltration in glioma subtypes was assessed using the Timer algorithm from the tumor immune assessment platform. Figure 1 B), it was found that the infiltration levels of B cells, CD8T cells, neutrophils, macrophages and dendritic cells in the C1 subtype were significantly higher than those in the C2 subtype, indicating that the C1 subtype is an immune-heat subtype.

[0028] 2. Confirmation of glioma immune escape subtypes Although C1 is an immune-thermal subtype, survival analysis revealed a poor prognosis for the C1 subtype (Log-rank P value less than 0.05). Figure 1 Therefore, it was inferred that glioma patients in the C1 subtype may have experienced immune escape. Further analysis was conducted using the Tumor Immune Dysfunction and Rejection (TIDE, http: / / tide.dfci.harvard.edu / ) algorithm to assess the proportion of patients responding to immunotherapy in different immune subtypes. The Wilcox rank-sum test was used to compare the differences in immunotherapy benefit, T-cell rejection, and T-cell dysregulation scores among different subtypes. It was found that the number of patients benefiting from immunotherapy was smaller in the C1 subtype, and their TIDE scores, as well as their T-cell rejection and T-cell dysregulation scores, were significantly higher than those in the C2 subtype. Figure 1 (D) indicates that patients with the C1 subtype experienced immune escape. Therefore, C1 is defined as the immune escape subtype, and C2 as other subtypes.

[0029] 3. Confirm the effect of lncRNA on tumor immune escape. The differences in lncRNA expression and methylation levels between the immune escape subtype and other subtypes were compared using the Wilcox rank-sum test. It was found that LINC02447 and AL590428.1 showed decreased methylation levels (change in methylation level > -0.2, P < 0.05) and increased expression (fold change > 2, P < 0.05) in the immune escape subtype. Figure 2 A, Figure 3 A). Transcriptomic lncRNA expression quantification of glioma anti-PD1 immunotherapy data was performed using Tophat and Cufflinks (PRJNA482620). Wilcox rank-sum test revealed that LINC02447 and AL590428.1 were significantly downregulated in patients who responded to immunotherapy (P < 0.05). Figure 2 B. Figure 3 B). Survival analysis using the Kaplan-Meier test revealed that high expression and low methylation levels of LINC02447 and AL590428.1 were prognostic risk factors for glioma. Figure 2 C and D Figure 3 (C and D, Log-rank P value < 0.05). Therefore, LINC02447 and AL590428.1 are hypomethylated in the immune escape subtype, leading to increased expression. High expression and hypomethylation of lncRNAs are risk factors for prognosis in glioma patients, and LINC02447 and AL590428.1 are expressed at low levels in glioma patients who respond to immunotherapy. In conclusion, LINC02447 and AL590428.1 are novel biomarkers for glioma immune escape.

[0030] 4. Molecular biological experiments have demonstrated that lncRNA is a novel biomarker for glioma immune escape. For LINC02447 and AL590428.1, their expression was first knocked down in the U251 cell line using siRNA interference technology. Compared with the control group, the expression of LINC02447 and AL590428.1 was significantly reduced, revealing the effectiveness of lentiviral transfection of siRNA sequences. Figure 4 A, Figure 5 A). The effects of LINC02447 and AL590428.1 on glioma cell proliferation were investigated using the CCK8 assay. It was found that knockdown of lncRNA significantly reduced the proliferation capacity of U251 cells. Figure 4 B. Figure 5 B). Western blot and qRT-PCR results showed that knockdown of LINC02447 and AL590428.1 significantly downregulated the protein levels of classic immune escape markers FOXP3, PD-L1, and CTLA4 in glioma cell lines, indicating that lncRNAs are associated with immune escape. Figure 4 C Figure 5 C). Furthermore, cell scratch assays and chamber experiments also revealed that lncRNA knockdown significantly reduced the migration and invasion abilities of glioma cells. Figure 4 D and E, Figure 5 (D and E). The above results indicate that LINC02447 and AL590428.1 play a pro-cancer role in gliomas and can serve as a novel marker of glioma immune escape.

[0031] Example 2: Clinical Auxiliary Diagnosis and Prognostic Assessment of Gliomas In clinical practice, the immune characteristics and prognosis of glioma patients can be determined by detecting the methylation or expression levels of at least one of LINC02447 and AL590428.1.

[0032] The methods for detecting the expression levels of LINC02447 and AL590428.1 are as follows: 1. RNA extraction Cell sample: Glioma cells. Slowly discard the culture medium in the culture flask. Gently wash the cell surface with 2 mL of PBS, being careful not to wash away the cells. After the PBS is removed, add 1 mL of Trizol to each cell flask and incubate at room temperature for 5 min to allow for complete lysis. Transfer the Trizol to a 1.5 mL centrifuge tube, add 200 μL of chloroform, shake vigorously for 30 s, incubate on ice for 5 min, centrifuge at 13500 rpm for 15 min at 4°C. Gently remove the 1.5 mL centrifuge tube; the RNA will be present in the upper aqueous phase. Transfer the upper aqueous phase to another centrifuge tube, add isopropanol at a ratio of 0.5 mL isopropanol / mL Trizol, mix well, incubate on ice for 10 min, centrifuge at 13500 rpm for 10 min at 4°C, discard the supernatant, and discard the RNA at the bottom of the tube. Add 75% ethanol at a ratio of 1 mL 75% ethanol / mL Trizol, gently shake the centrifuge tube to resuspend the precipitate, and centrifuge at 10600 rpm for 5 min at 4°C. After 5-10 minutes, discard the supernatant as much as possible and air dry at room temperature or under vacuum for 5-10 minutes (the RNA sample should not be too dry, otherwise it will be difficult to dissolve). The RNA precipitate can be dissolved in 20 μL LDPPC water. Finally, the RNA concentration is detected by UV spectrophotometer. The RNA sample is stored at -80°C.

[0033] 2. RNA concentration determination Add 1 μL of RNA solution to the sample well of the UV spectrophotometer and determine the RNA concentration and purity. RNA with an OD260 / OD280 ratio between 1.80 and 2.20 is considered to have high purity.

[0034] 3. Reverse transcription and qRT-PCR Reverse transcription was performed using a TOYOBO reverse transcription kit. A 10 μL system included 2 μL of 5×RT-buffer, 0.5 μL of RT enzyme mix, 0.5 μL of primer mix, and 500 ng of RNA, brought to a final volume of 10 μL with RNase-free water. The reverse transcription program was 37°C for 15 min (reverse transcription reaction); 98°C for 5 min (enzyme inactivation reaction); and incubation at 4°C. The transcribed cDNA was stored at -20°C. qRT-PCR was performed using the SYBR dye method. The 20 μL reaction system consisted of 10 μL SYBR, 1 μL upstream primer, 1 μL downstream primer, 7 μL deionized water, and 1 μL cDNA sample. Different common reaction systems were prepared according to the different genes being amplified. The common reaction system was first added to a 96-well PCR plate, followed by the cDNA. The plate was then sealed with sealing film and centrifuged at 1000 rpm for 1 min. The 96-well plate was placed on a PCR instrument for amplification. The reaction steps were: 95℃ for 10 min, (95℃ for 15 s, 60℃ for 30 s, 72℃ for 30 s) × 40. The primers used for qRT-PCR are shown in the table below. These primers can be used to detect four transcripts of LINC02447 (shown in SEQ ID NO. 1-4) and the AL590428.1 transcript (shown in SEQ ID NO. 5). ; The method for detecting the methylation levels of LINC02447 and AL590428.1 is as follows: 1. DNA extraction 1) After the sample is separated into layers by adding chloroform, remove the upper aqueous phase and precipitate the DNA in the intermediate and organic phases with ethanol. Add 0.3 ml of anhydrous ethanol to each 1 ml of TRIzol used and mix well. Incubate at room temperature for 3 minutes. 2) Centrifuge at 4℃ for no more than 2000×g for 5 minutes.

[0035] 3) Remove the supernatant (if protein separation is required, it can be retained; further procedures are described below). Wash the DNA precipitate with 0.1M sodium citrate containing 10% ethanol. Add 1 ml of sodium citrate to 1 ml of TRIzol, incubate at room temperature for 30 minutes, centrifuge at 2000×g for 5 minutes at 4°C, discard the supernatant, and repeat once.

[0036] 4) Wash the DNA precipitate again with 75% ethanol. Add 1.5 to 2 ml of 75% ethanol to every 1 ml of TRIzol. Incubate at room temperature for 10 to 20 minutes (inverting and mixing occasionally). Centrifuge at 2000×g for 5 minutes at 4℃ and discard the supernatant.

[0037] 5) Allow the DNA to air dry at room temperature for 5–15 minutes, then dissolve the DNA in 8 mM NaOH. DNA isolated from 50–70 mg of tissue or 10⁷ cells should be dissolved in 500 μl of 8 mM NaOH. The DNA concentration is usually 0.2–0.3 μg / μl.

[0038] The extracted DNA precipitate is not easily soluble in water and Tris buffer. It is recommended to dissolve it with a weak base, such as 8mM NaOH at pH 9. After dissolving the DNA, the pH can be adjusted with TE buffer or HEPES. DNA extracted from some samples (especially tissues) may contain some gelatinous insoluble matter, which can be removed by centrifugation at >12000×g for 10 minutes.

[0039] 6) The supernatant can be stored overnight at 4°C. For long-term storage, the pH needs to be adjusted to 7-8 with HEPES and 1 Mm EDTA. 2. Methylation monitoring was performed using a gene methylation-specific PCR amplification (MSP) kit. 1) Before starting the experiment, remove the reagents from the -20℃ freezer and place them in an ice bath to thaw. Then perform the following operations: For each sample, transfer 15 μL of amplification buffer (Reagent A) into a PCR tube, add 1 μL of DNA sample (total 100 ng), add 1 μL of methylation-specific primers F and R (350 ng or 25 μmol each), then add 7 μL of replenishment buffer (Reagent B) (total reaction volume 25 μL), immediately place in a mini benchtop centrifuge and centrifuge for 5 seconds at 500 g (or 2000 RPM; e.g., eppendorf 5415), add 50 μL of PCR-grade mineral oil, and immediately initiate a hot-start PCR reaction.

[0040] 2) After the reaction is complete, transfer 5 μL for 1.8% agarose gel electrophoresis or 15% polyacrylamide gel electrophoresis. If sequencing is to be performed, recover the PCR products from the gel (it is recommended to use a high-quality purification one-step gel recovery kit; 20051.1). Transfer 2 μL of the reaction solution to two different new 1.5 mL centrifuge tubes (100 ng / μL). Add 1 μL of methylation-specific nested primer F (350 ng / μL) to one of the 1.5 mL centrifuge tubes and label it. Add 1 μL of methylation-specific nested primer R (350 ng / μL) to the other 1.5 mL centrifuge tube and label it. Then proceed with the subsequent direct sequencing reaction.

[0041] The methylation-specific primers used in MSP are shown in Table 2 below. Using these primers, methylation detection of four transcripts of LINC02447 (SEQ ID NO. 1-4) and transcript of AL590428.1 (SEQ ID NO. 5) can be achieved. ; When at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the patient with the glioma is considered to have immune escape characteristics and a poor prognosis. When at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the patient with the glioma is considered to have a better prognosis.

[0042] Example 3: Prediction of the efficacy of immunotherapy for glioma In clinical practice, the efficacy of immunotherapy in glioma patients can be assessed by detecting the methylation or expression levels of at least one of LINC02447 and AL590428.1. The method for detecting the methylation or expression levels of LINC02447 and AL590428.1 is the same as in Example 2.

[0043] When at least one of LINC02447 and AL590428.1 is hypomethylated or highly expressed, the patient is considered unsuitable for immunotherapy and requires inhibition of the corresponding lncRNA before immunotherapy can be administered. Conversely, when at least one of LINC02447 and AL590428.1 is hypermethylated or lowly expressed, the glioma patient is considered to be able to benefit from immunotherapy.

Claims

1. The application of reagents for detecting the expression level of molecular markers of immune escape in glioma in the preparation of reagents for auxiliary diagnosis and prognosis of glioma, wherein the molecular marker of immune escape in glioma is non-coding RNA AL590428.1, and the nucleic acid sequence of the transcript of non-coding RNA AL590428.1 is shown in SEQ ID NO:5; according to the detection results of AL590428.1, if the expression of AL590428.1 is high, the glioma patient is considered to have immune escape characteristics and a poor prognosis; if the expression of AL590428.1 is low, the glioma patient is considered to have a better prognosis. Based on the AL590428.1 test results, if the expression of AL590428.1 is high, the patient is considered unsuitable for immunotherapy and AL590428.1 needs to be suppressed before immunotherapy can be administered; if the expression of AL590428.1 is low, the glioma patient is considered to be able to benefit from immunotherapy.

2. The application as described in claim 1, characterized in that, The reagent used to detect the expression level of molecular markers of immune escape in gliomas is a qRT-PCR primer designed for AL590428.

1.

3. The application as described in claim 2, characterized in that, The reagents used to detect the expression level of AL590428.1 were qRT-PCR primers designed for AL590428.1, and their sequences are shown below: Forward: TAGCGCTCTACCAACGATGC Reverse: AGAGCCAACCCACCCTAAC.

Images