A subunit vaccine for paratuberculosis and its preparation method and application
Patent Information
- Application Number
- CN202211635116.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-19
- Publication Date
- 2026-08-28
- Estimated Expiration
- 2042-12-19
AI Technical Summary
2002年,新西兰和澳大利亚用316F MAP减毒株和油剂佐剂研制成的Neoparasec疫苗,被用于牛、羊副结核病的治疗及免疫预防(KOHLER et al.,2001),但减毒活疫苗存在毒力返强的缺点
[0047] Currently, vaccines are considered effective because they can stimulate CD4. + T and CD8 + T cell responses involve the production of Th1 cytokines. IFN-γ is a major component of macrophage activation, and Th1 CD4+... + IFN-γ produced by T cells is a key cytokine controlling mycobacterial infection (COUSSENS et al., 2004). This invention compared the immunoprotective effects of the screened recombinant protein 66NC combined with the adjuvant MONTANIDEISA61 VG via subcutaneous immunization with that of recombinant protein 74F. The results showed that the 66NC recombinant subunit vaccine not only induced high levels of antibodies, but also that the IFN-γ secretion level induced by the 66NC immunization group was significantly higher than that of the 74F group. Furthermore, the IFN-γ produced was mainly generated by Th1 CD4+. + T cell production indicates CD4 + T cells play a crucial role in combating intracellular pathogens such as mycobacteria. Simultaneously, high levels of intracellular and serum cytokine secretion promoted the clearance of MAP in mice, demonstrating the excellent protective effect of the 66NC recombinant subunit vaccine. Pathological and histopathological observations showed a reduction in the number of granulomas in the liver of mice immunized with 66NC after infection. Furthermore, acid-fast staining and colony colonization revealed significantly lower bacterial loads in the liver and small intestine of the 66NC immunized group compared to the 74F immunized group after MAP K-10 infection, indicating that the 66NC recombinant subunit vaccine plays a vital role in combating MAP infection.
Smart Images

Figure QLYQS_1 
Figure BDA0004006880980000101 
Figure BDA0004006880980000111
Abstract
Description
Technical Field
[0001] This invention relates to a paratuberculosis subunit vaccine, its preparation method, and its application, belonging to the field of biomedical technology. Background Technology
[0002] Paratuberculosis, also known as John's disease (JD), is a chronic wasting infectious disease of ruminants caused by Mycobacterium paratuberculosis subsp. paratuberculosis (MAP). Affected animals primarily exhibit persistent diarrhea, progressive emaciation, and proliferative enteritis (OLSEN et al., 2002; WHITTINGTON et al., 2017). The disease mainly infects ruminants such as cattle, goats, and sheep, but MAP can also be isolated from many non-ruminant wild animals and primates, including rabbits, foxes, weasels, and ferrets (BEARD et al., 2001; FECHNER et al., 2017). Currently, paratuberculosis is widespread globally and is one of the most serious infectious diseases affecting dairy cows. It not only reduces milk production but also leads to culling due to excessive emaciation, causing significant economic losses to the livestock industry (HEMPEL et al., 2016). In recent years, with the continuous expansion of dairy and beef cattle farming in my country, the incidence of paratuberculosis has also gradually increased, and the harm caused by paratuberculosis is becoming increasingly serious. Therefore, it must be given high priority by the government and the livestock industry. Furthermore, paratuberculosis (MAP) has a potential link with Crohn's disease in humans (an autoimmune disease associated with chronic intestinal wasting in humans) (GARVEY, 2018), thus seriously endangering human public health and safety.
[0003] Paratuberculosis vaccines are mainly divided into three categories: live attenuated vaccines, whole-cell inactivated vaccines, and subunit vaccines.
[0004] Vallée and Rinjard first reported vaccination against MAP in 1926. This vaccine consisted of live attenuated MAP and an oil-based adjuvant. Since then, numerous live attenuated vaccines have been developed for the prevention of bovine and ovine paratuberculosis. Live attenuated vaccines can stimulate innate and adaptive immunity, triggering protective mucosal and systemic immune responses (GHOSH et al., 2014). Many candidate live attenuated vaccines primarily utilize techniques such as transposon mutation, allele exchange, and phage-mediated reduction to obtain attenuated strains of MAP. In 2002, New Zealand and Australia developed the Neoparasec vaccine using the 316F attenuated MAP strain and an oil-based adjuvant, which was used for the treatment and immunization against bovine and ovine paratuberculosis (KOHLER et al., 2001). However, live attenuated vaccines suffer from the drawback of virulence reversion. The Johns Hopkins Comprehensive Disease Program (JDIP) research consortium established a three-phase candidate vaccine evaluation strategy to improve the efficiency of efficacy testing for MAP (Monotrophic Attenuated Live Vaccine) vaccines (BANNANTINE et al., 2014). The first phase involved screening using an in vitro bovine mononuclear cell-derived macrophage (MDM) model. The second phase evaluated immunoprotective efficacy using a mouse model, and the third phase assessed immunoprotective efficacy using a goat model. Lamont et al. used the MDM model to evaluate many candidate live attenuated vaccines developed before 2014. The establishment of this candidate vaccine evaluation strategy provided technical support for screening live attenuated vaccines with good protective efficacy (LAMONT et al., 2014).
[0005] Whole-cell inactivated MAP vaccines, including Mycopar, Gudair, and Silirum, are vaccines developed by mixing inactivated MAP strains with an oil-based adjuvant, but only Mycopar has been approved as a commercial vaccine in the United States. This commercial vaccine can reduce the clinical incidence of paratuberculosis by 90%, providing an effective measure for the control of paratuberculosis. However, vaccinated animals can still become infected, and MAP can be detected in their feces. Furthermore, whole-cell inactivated vaccines can cause damage to the injection site in animals (EPPLESTON WINDSOR, 2007; ROSSEELS HUYGEN, 2008). Recovery from injection site damage in vaccinated animals can take months and requires multiple treatments, often necessitating surgery for full recovery. Damage to the injection site is considered to be a result of the interaction between the adjuvant, the antigen, and the host's immune response. Studies have found that… Injection site damage from other MAP inactivated vaccines may be due to the use of different adjuvants. Inactivated vaccines developed using highly refined mineral oil as an adjuvant can reduce injection site damage compared to those using Freund's adjuvant (WINDSOR et al., 2005).
[0006] Subunit vaccine development utilizes well-defined recombinant MAP proteins or DNA encoding immunogenic antigens. MAP subunit vaccines may eliminate some of the drawbacks of whole-cell vaccines, such as severe inflammation and granuloma formation at the injection site. Th1-mediated immune responses induce IFN-γ, which is crucial for reducing bacterial numbers in the early stages of MAP infection; therefore, identifying antigens that induce strong Th1 responses is essential for subunit vaccine development. The P22 protein belongs to the mycobacterial lipoprotein family LppX / LprAFG. When used as a recombinant protein in a water-in-oil emulsion, this protein induces strong IFN-γ levels and antibody responses (RIGDEN et al., 2006). Two MAP proteins from the PPE family, MAP1518 and MAP3184, induced significant IFN-γ levels in experimentally infected Holstein calf PBMC cell suspensions (NAGATA et al., 2005). In addition, subunit vaccines developed from Ag85 complex, HSP65, and HSP70 can induce significant IFN-γ levels and are candidate antigens for MAP vaccines (ROSSEELS HUYGEN, 2008).
[0007] Ideally, a MAP vaccine would completely prevent infection, thus blocking both horizontal and vertical transmission. Existing paratuberculosis vaccines fall far short of this standard. MAP vaccines have been shown to be effective in reducing fecal shed levels, tissue colony colonization, or clinical disease incidence, but not in completely eliminating these three conditions (STRINGER et al., 2013). Efforts to improve existing vaccine formulations have long been hampered by the lack of standardized infection models and the high cost of trials in natural sheep, goat, deer, or cattle hosts. However, standardized animal models of Johns Hopkins disease (mice, goats, and cows) currently being developed by international researchers with support from the Johns Hopkins Comprehensive Disease Program (JDIP) are helping to facilitate comparisons between different vaccine trials (HINES et al., 2007). However, the cost of MAP vaccine trials, especially in natural hosts, remains a major concern. Even with effective vaccines, MAP is likely to persist in populations due to vertical transmission (LU et al., 2013).
[0008] Based on the three genes of MAP (map3527, map1609c, and Hsp70), this invention constructed four recombinant plasmids. After expressing and purifying the four recombinant proteins, the optimal adjuvant and immunogen were screened in a mouse model using the IFN-γELISPOT assay, and their immunogenicity, safety, and immunoprotective effect were evaluated in the mouse model, thus laying the foundation for the effective prevention and control of paratuberculosis. Summary of the Invention
[0009] The purpose of this invention is to provide a paratuberculosis subunit vaccine, its preparation method, and its application.
[0010] To achieve the above objectives, the present invention employs the following technical means:
[0011] This invention constructs four recombinant plasmids based on the map3527, map1609c, and Hsp70 genes of MAP, respectively. These plasmids are transformed into E. coli BL21 and successfully expressed. Based on protein size, they are named 66CN, 66NC, 90CN, and 90NC, respectively. After purification by Ni column affinity chromatography, four high-purity recombinant proteins are obtained. Three adjuvants—MONTANIDE ISA 61VG, MONTANIDE ISA206 VG, and MONTANIDE GEL 02PR—are selected and emulsified with the 66NC recombinant protein. Mice are immunized via subcutaneous and intramuscular routes. The IFN-γ ELISPOT assay confirms that 61VG is the optimal adjuvant and subcutaneous immunization is the optimal route. The four recombinant proteins are emulsified with 61VG adjuvant and immunized subcutaneously. The IFN-γ / IL-4 ELISPOT assay confirms that the 66NC recombinant protein is the optimal immunogenic protein, i.e., a candidate for a recombinant subunit vaccine.
[0012] Based on the immunization and various indicator tests in mice, the immunogenicity and safety of recombinant protein 66NC were comprehensively analyzed and evaluated. The reported 74F recombinant subunit vaccine was used as a positive control, and adjuvant 61VG was used as a blank control. The results showed that recombinant protein 66NC induced high levels of IgG and IgM antibodies in mice, with both IgG and IgM antibody titers higher than those in the 74F immunization group. Recombinant protein 66NC not only induced high levels of IFN-γ and IL-4 secretion from splenic lymphocytes, but also induced high levels of IFN-γ, TNF-α, and IL-17A secretion from CD4+ T and CD8+ T cells, and the secretion levels of these cytokines were significantly higher than those in the 74F immunization group. Simultaneously, no significant pathological damage was observed in the liver and small intestine of mice in the 66NC, 74F, and 61VG adjuvant groups, indicating that 66NC, 74F recombinant protein, and 61VG adjuvant have good safety profiles.
[0013] The immunoprotective effect of the 66NC recombinant subunit vaccine was comprehensively evaluated by measuring and analyzing various indicators, including changes in body weight, pathological and histopathological findings, tissue bacterial load, and the correlation between cytokines and liver bacterial load in immunized mice after infection. The results showed that 2 weeks after MAP infection, the weight gain of mice in the 66NC immunized group was significantly higher than that in the 74F immunized group and significantly higher than that in the 61VG treatment group, indicating that 66NC subunit vaccine immunization can effectively promote weight gain in mice. The secretion levels of IFN-γ and TNF-α in splenic lymphocytes of mice in the 66NC immunized group were significantly higher than those in the 61VG treatment group and the 74F immunized group. Furthermore, the secretion levels of IFN-γ, TNF-α, and IL-17A in CD4+ T cells of the 66NC immunized group were also significantly higher than those in the 61VG treatment group and the 74F immunized group. However, there were no significant differences in the secretion levels of IFN-γ, TNF-α, and IL-17A in CD8+ T cells among the groups. Furthermore, compared to the 74F immunization group, the 66NC immunization group showed significantly reduced pathological damage to the liver and intestines, and a significant decrease in bacterial load in the liver and small intestine. This indicates that the 66NC recombinant subunit vaccine provides effective protection against MAP challenge, superior to the 74F recombinant subunit vaccine. Simultaneously, the secretion levels of IFN-γ, TNF-α, and IL-17A from CD4+ T and CD8+ T cells, as well as the serum secretion levels of IFN-γ and TNF-α, showed a significant negative correlation with the bacterial load in the liver. In conclusion, the 66NC recombinant subunit vaccine not only induces a strong immune response in mice but also provides robust protection against MAP challenge. The 66NC recombinant protein is an important subunit vaccine candidate for paratuberculosis, providing crucial scientific evidence for the development of novel paratuberculosis vaccines.
[0014] Therefore, based on the above research, this invention first proposes a paratuberculosis subunit vaccine composition containing a recombinant protein of Mycobacterium paratuberculosis (MAP), named 66NC, whose amino acid sequence is shown in SEQ ID NO.1.
[0015] Preferably, the vaccine composition further contains an adjuvant; more preferably, the adjuvant is MONTANIDE ISA61 VG.
[0016] Preferably, the recombinant protein 66NC is prepared by the following method:
[0017] (1) Construction of recombinant plasmids
[0018] 1) Construction of recombinant plasmids pET-28a-3527C-3527N and pET-28a-3527N-3527C
[0019] Using the genomic DNA of the MAPK-10 reference strain as a template, PCR amplification was performed with primers 3527NN-F / R and 3527CC-F / R to obtain the map3527N and map3527C ends, respectively.
[0020] 3527NN-F:GCTCCGTCGAC AAGCTT GCGCACCGTCGGGCCTGGCGCT(HindⅢ)3527NN-R:GTGGTGGTGGTG CTCGAG TGGCGGTGTCCACGCCGATCACCT(XhoⅠ)
[0021] 3527CC-F:AGCTCCGTCGAC AAGCTT GCACCGCCGCCACCGACAGCT(HindⅢ)3527CC-R:TGTGTGGTGGTG CTCGAG TGGCCGGCGGCCCCTCCGCCA(XhoⅠ)Hsp70NC-F:CGGCGTGGACACCGCCGAATTCATGAGAGTCGGAATCGACTTCGG
[0022] C(EcoRI)
[0023] Hsp70NC-R GGTGGCGGCGGTGC AAGCTT GGCTCGCCGATGCGCACCGCTC
[0024] :(HindⅢ)
[0025] 2) The pET-28a vector was double-digested with NdeⅠ and EcoRI and ligated to map3527N to obtain the pET-28a-3527N plasmid. This plasmid was then double-digested with HindⅢ and Xho I and ligated to the C end of map3527 to obtain the pET-28a-3527N-3527C plasmid.
[0026] 3) Amplification of the Hsp70NC gene
[0027] Using the genomic DNA of the MAPK-10 reference strain as a template, PCR amplification was performed with primers Hsp70NC-F / R to obtain the Hsp70NC fragment;
[0028] 4) Construction of the recombinant plasmid pET-28a-3527N-Hsp70-3527C
[0029] The recombinant plasmid pET-28a-3527N-3527C was digested with EcoRI and HindIII and then ligated with the Hsp70NC fragment to obtain pET-28a-3527N-Hsp70-3527C.
[0030] (2) Induced expression of 66NC protein
[0031] The correctly identified bacterial culture was centrifuged and the supernatant was discarded. The bacterial cell pellet was used to extract the recombinant plasmid using a plasmid extraction kit. The correctly sequenced recombinant plasmid pET-28a-3527N-Hsp70-3527C was transformed into E. coli BL21 competent cells by chemical transformation. The cells were recovered at 37°C and 180 rpm / min for 1 h, centrifuged at 8000 rpm / min for 10 min, and the supernatant was discarded. The cell pellet was evenly spread on LB solid medium containing 50 μg / mL kanamycin and cultured at 37°C for more than 12 h.
[0032] Single colonies were picked from LB solid medium and inoculated into LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37°C and 180 rpm / min for at least 12 h; 100 μL of the bacterial culture was then transferred to LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C and 180 rpm / min until OD500 reached. 600nm When the concentration was 0.8-1.0, IPTG was added to a final concentration of 1 mM to induce expression for 4 h. After centrifugation at 8000 rpm / min for 15 min, the bacterial cell pellet was collected. The bacterial cell pellet was resuspended in 1 mL of buffer A and then sonicated for 4 min using an ultrasonic cell disruptor with an amplitude of 37%, sonication for 3 s, and pause for 3 s. The sonicated bacterial solution was centrifuged at 8000 rpm / min at 4℃ for 15 min, and the supernatant and pellet were collected. The expression of four recombinant proteins was analyzed by SDS-PAGE gel electrophoresis, and the obtained protein was named 66NC protein. The buffer A contained 150 mM NaCl, 20 mM Tris-HCl, and 10% v / v glycerol, pH 8.0.
[0033] (3) Purification of 66NC protein
[0034] 1) Pick a single colony for overnight culture. After culture, transfer the bacterial culture to 1L of LB liquid medium containing 50ug / mL kanamycin and culture until OD500. 600nm When the concentration is 0.8-1.0, add IPTG at a final concentration of 1mM to induce expression;
[0035] 2) Centrifuge at 8000 rpm / min, 4℃ for 10 min, discard the supernatant, resuspend the bacterial pellet in 50 mL of buffer A, and sonicate for 45 min.
[0036] 3) Centrifuge 3000g of the broken bacterial solution at 4℃ for 10min to remove incompletely broken cells and cell debris;
[0037] 4) Resuspend the precipitate in 50 mL of buffer B and stir at room temperature for at least 4 hours. After the solution becomes clear, centrifuge at 10,000 rpm / min for 40 minutes, discard the precipitate and keep the supernatant; the buffer B contains 150 mM NaCl, 0.5% SKL, 20 mM Tis-HCl and 10% v / v glycerol, pH 8.0;
[0038] 5) Transfer the obtained supernatant to a pre-boiled dialysis bag and place it in 1L of refolding solution for refolding. After 24 hours, transfer it to a refolding solution without glutathione and refold for another 24 hours. The refolding solution contains 0.54g of reduced glutathione, 0.06g of oxidized glutathione, 150mM NaCl, 20mM Tris-HCl, 10% v / v glycerol, and pH 8.0.
[0039] 6) After refolding, centrifuge the protein at 15000 rpm / min, 4℃ for 40 min. Discard the precipitate and retain the supernatant;
[0040] 7) After equilibration with buffer A, pass the supernatant through the Ni-NAT chromatography column 6 times. Then pass the supernatant through the Ni-NAT chromatography column with 40 mL buffer C, 40 mL buffer D, 40 mL buffer E, 40 mL buffer F, 40 mL buffer G, and 40 mL buffer H respectively to remove impurities.
[0041] Buffer C contains 500 mM NaCl, 3% v / v glycerol, 20 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer D contains 500 mM NaCl, 3% v / v glycerol, 40 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer E contains 500 mM NaCl, 3% v / v glycerol, 60 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer F contains 500 mM NaCl, 3% v / v glycerol, 80 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer G contains 500 mM NaCl, 3% v / v glycerol, and pH 8.0; Buffer H contains 20 mM Tris-HCl, 1 M NaCl, 3% v / v glycerol, 20 mM Tris-HCl, and pH 8.0.
[0042] 8) Elute the target protein with 5 mL of buffer I and 5 mL of buffer J respectively to obtain the final product;
[0043] Buffer I contains 150 mM NaCl, 200 mM imidazole, 5% v / v glycerol, 20 mM Tris HCl, and pH 8.0; Buffer J contains 150 mM NaCl, 500 mM imidazole, 5% v / v glycerol, 20 mM Tis-HCl, and pH 8.0.
[0044] Furthermore, the present invention also proposes the application of the aforementioned paratuberculosis subunit vaccine composition in the preparation of paratuberculosis subunit vaccines.
[0045] Preferably, the paratuberculosis subunit vaccine is obtained by emulsifying recombinant protein 66NC with adjuvant MONTANIDE ISA61 VG at a volume ratio of 1:1.5.
[0046] Compared with the prior art, the beneficial effects of the present invention are:
[0047] Currently, vaccines are considered effective because they can stimulate CD4. + T and CD8 + T cell responses involve the production of Th1 cytokines. IFN-γ is a major component of macrophage activation, and Th1 CD4+... + IFN-γ produced by T cells is a key cytokine controlling mycobacterial infection (COUSSENS et al., 2004). This invention compared the immunoprotective effects of the screened recombinant protein 66NC combined with the adjuvant MONTANIDEISA61 VG via subcutaneous immunization with that of recombinant protein 74F. The results showed that the 66NC recombinant subunit vaccine not only induced high levels of antibodies, but also that the IFN-γ secretion level induced by the 66NC immunization group was significantly higher than that of the 74F group. Furthermore, the IFN-γ produced was mainly generated by Th1 CD4+. + T cell production indicates CD4 + T cells play a crucial role in combating intracellular pathogens such as mycobacteria. Simultaneously, high levels of intracellular and serum cytokine secretion promoted the clearance of MAP in mice, demonstrating the excellent protective effect of the 66NC recombinant subunit vaccine. Pathological and histopathological observations showed a reduction in the number of granulomas in the liver of mice immunized with 66NC after infection. Furthermore, acid-fast staining and colony colonization revealed significantly lower bacterial loads in the liver and small intestine of the 66NC immunized group compared to the 74F immunized group after MAP K-10 infection, indicating that the 66NC recombinant subunit vaccine plays a vital role in combating MAP infection.
[0048] The advantages of the paratuberculosis subunit vaccine of the present invention are mainly reflected in the following aspects:
[0049] (1) The vaccine can induce mice to produce high levels of IgG and IgM;
[0050] (2) The vaccine can induce splenic lymphocytes to secrete high levels of IFN-γ and IL-4;
[0051] (3) The vaccine can induce CD4+T and CD8+T cells to secrete high levels of IFN-γ, TNF-α and IL-17A cytokines;
[0052] (4) The vaccine provides effective protection against MAP attack, reduces the number of bacteria in organs and alleviates pathological damage, and does not cause organ pathological damage to immunized animals, so it is safe.
[0053] The present invention provides a highly effective and safe technical means for the prevention and treatment of paratuberculosis. Attached Figure Description
[0054] Figure 1 Schematic diagram of the construction mode of pET-28a-3527C-3527N and pET-28a-3527N-3527C recombinant plasmids;
[0055] Figure 2 Diagrams illustrating the construction patterns of recombinant plasmids pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527, and pET-28a-3527N-Hsp70-3527C.
[0056] Figure 3 The results are from the PCR amplification of the target gene.
[0057] Wherein, M: DL2000 DNA marker; 1,2,3,4: PCR products of the Hsp70CN gene; 5,6,7,8: PCR products of the Hsp70NC gene; 9,10,11,12: PCR products of the 1609CN gene; 13,14,15,16: PCR products of the 1609NC gene.
[0058] Figure 4 The results are from the double enzyme digestion identification of the recombinant plasmid.
[0059] Wherein, M: DL2000 DNA marker; 1: pET-28a-3527C-1609c-3527N; 2: pET-28a-3527N-1609c-3527C; 3: pET-28a-3527C-Hsp70-3527N; 4:
[0060] pET-28a-3527N-Hsp70-3527C
[0061] Figure 5 SDS-PAGE analysis was performed to analyze the expression of 90CN, 90NC, 66CN, and 66NC proteins.
[0062] In this table, A represents the expression results of 90CN and 90NC proteins. M represents the protein marker; 1: 90CN before induction; 2: 90CN after induction; 3: 90CN supernatant after sonication; 4: 90CN precipitate after sonication; 5: 90NC before induction; 6: 90NC before induction; 7: 90NC supernatant after sonication; 8: 90NC precipitate after sonication. B represents the expression results of 66CN and 66NC proteins. M represents the protein marker; 1: 66CN before induction; 2: 66CN after induction; 3: 66CN supernatant after sonication; 4: 66CN precipitate after sonication; 5: 66NC before induction; 6: 66NC before induction; 7: 66NC supernatant after sonication; 8: 66NC precipitate after sonication.
[0063] Figure 6 Ni column affinity chromatography purification of 90CN protein;
[0064] Wherein, M: protein marker; 1: supernatant after dialysis; 2: flow-through solution; 3: medium before washing; 4: medium after washing; 5: 200mM imidazole; 6: 500mM imidazole; 7: medium after elution;
[0065] Figure 7 Ni column affinity chromatography purification of 90NC protein;
[0066] Wherein, M: protein marker; 1: supernatant after dialysis; 2: flow-through solution; 3: medium before washing; 4: medium after washing; 5: 200mM imidazole; 6: 500mM imidazole; 7: medium after elution;
[0067] Figure 8 Ni column affinity chromatography purification of 66CN and 66NC proteins;
[0068] Wherein, M: protein marker; 1: 66CN flow-through buffer; 2: 66CN pre-wash medium; 3: 66CN post-wash medium; 4: 66CN 200mM imidazole; 5: 66CN 500mM imidazole; 6: 66CN post-elution medium; 7: 66NC flow-through buffer; 8: 66NC pre-wash medium; 9: 66NC post-wash medium; 10: 66NC 200mM imidazole; 11: 66NC 500mM imidazole; 12: 66NC post-elution medium;
[0069] Figure 9 Ni column affinity chromatography purification of 74F protein;
[0070] Wherein, M: protein marker; 1: flow-through buffer; 2: pre-wash medium; 3: post-wash medium; 4: 200mM imidazole; 5: 500mM imidazole; 6: post-elution medium;
[0071] Figure 10 To detect IFN-γ expression in splenic lymphocytes after antigen stimulation using an enzyme-linked spot analyzer;
[0072] A: IFN-γ formation was observed using an enzyme-linked spot analyzer. Splenic lymphocytes were stimulated with PMA and RPMI 1640 to form positive and negative controls, respectively; the blank control only received RPMI 1640. B: IFN-γ spot statistical graph; IH: subcutaneous injection; IM: intramuscular injection;
[0073] Figure 11 To detect IFN-γ expression in splenic lymphocytes after antigen stimulation using an enzyme-linked spot analyzer;
[0074] A: IFN-γ formation was observed using an enzyme-linked spot analyzer. Splenic lymphocytes were stimulated with PMA and RPMI 1640 to form positive and negative controls, while the blank control only received RPMI 1640. B: IFN-γ spot statistical graph;
[0075] Figure 12 To detect IL-4 expression in spleen lymphocytes after antigen stimulation using an enzyme-linked spot analyzer;
[0076] Among them, A: IL-4 formation was observed using an enzyme-linked spot analyzer; spleen lymphocytes were stimulated with PMA and the culture medium used to resuspend the cells to form positive and negative controls, and the blank control was only added with RPMI 1640 to observe IL-4 expression; B: IL-4 spot statistical graph;
[0077] Figure 13 For mouse immunization procedures;
[0078] Note: wpv: weeks post-vaccination;
[0079] Figure 14 The results are from the detection of specific antibodies in mouse serum;
[0080] Where, A: IgG antibody monitoring results; B: IgM antibody monitoring results;
[0081] Figure 15 This is the subtype detection result;
[0082] Where A: serum IgG1 antibody level; B: serum IgG2a antibody level; C: IgG2a / IgG1;
[0083] Figure 16 To detect IFN-γ expression 3 weeks after the second immunization using an enzyme-linked spot analyzer;
[0084] Among them, A: IFN-γ formation was observed using an enzyme-linked spot analyzer; positive and negative controls were formed by stimulating splenic lymphocytes with PMA and RPMI1640, while the blank control was only treated with RPMI1640; B: IFN-γ spot statistics.
[0085] Figure 17 To detect IL-4 expression 3 weeks after the second immunization using an enzyme-linked spot analyzer;
[0086] A: IL-4 formation was observed using an ELISA speckle analyzer; splenic lymphocytes were stimulated with PMA and RPMI 1640 to form positive and negative controls, while the blank control only received RPMI 1640. B: IL-4 speckle statistics.
[0087] Figure 18 The results of serum cytokine detection 3 weeks after the second immunization;
[0088] Figure 19 The percentage of positive cytokines (%Cyt+) and antigen-specific T lymphocyte response were measured by ICS 3 weeks after the second immunization.
[0089] Where A: Percentage of cytokine positivity (%Cyt+) of antigen-specific CD4+ T lymphocyte response. B: Percentage of cytokine positivity (%Cyt+) of antigen-specific CD8+ T lymphocyte response;
[0090] Figure 20 The pathological and histopathological results were obtained 3 weeks after the second immunization.
[0091] Among them, A: Liver and intestinal pathology results; B: Liver and intestinal histopathology results (scale bar: 200μm);
[0092] Figure 21 The weight gain of mice 2 weeks after infection;
[0093] Figure 22The results of serum cytokine testing 2 weeks after infection;
[0094] Figure 23 To detect IFN-γ expression 2 weeks after infection using an enzyme-linked spot analyzer;
[0095] A: IFN-γ formation was observed using an enzyme-linked spot analyzer. Splenic lymphocytes were stimulated with PMA and RPMI 1640 to form positive and negative controls, while the blank control only received RPMI 1640. B: IFN-γ spot statistical graph;
[0096] Figure 24 To detect IL-4 expression 2 weeks after infection using an enzyme-linked spot analyzer;
[0097] A: IL-4 formation was observed using an ELISA spectrophotometer. Splenic lymphocytes were stimulated with PMA and RPMI 1640 to form positive and negative controls, while the blank control only received RPMI 1640. B: IL-4 speckle statistics.
[0098] Figure 25 The percentage of positive cytokines (%Cyt+) and antigen-specific T lymphocyte responses were measured by ICS 2 weeks after infection.
[0099] Wherein, A: percentage of positive cytokines (%Cyt+) antigen-specific CD4+ T lymphocyte response; B: percentage of positive cytokines (%Cyt+) antigen-specific CD8+ T lymphocyte response.
[0100] Figure 26 Results of MAP bacterial load in mouse tissues 2 weeks and 4 weeks after infection;
[0101] Wherein, A: MAP colonization in mouse liver; B: MAP colonization in mouse intestine.
[0102] Figure 27 The results of acid-fast staining were obtained 2 weeks after infection. Scale bar (top): 200 μm; Scale bar (bottom): 10 μm.
[0103] Figure 28 The Pearson correlation between intracellular cytokines and liver colony colonization;
[0104] Figure 29 The Pearson correlation between serum cytokines and liver colony colonization;
[0105] Among them, A: IFN-γ; B: TNF-α; C: IFN-γ+TNF-α;
[0106] Figure 30 The pathological damage to the organs of mice;
[0107] Among them, A: Liver and intestinal pathological damage results 2 weeks after infection; B: Liver and intestinal histopathological damage results 2 weeks after infection; C: Liver pathological scoring results; D: Liver histopathological scoring results; E: Intestinal pathological scoring results; F: Intestinal histopathological scoring results (scale bar: 200μm). Detailed Implementation
[0108] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.
[0109] Example 1: Expression and purification of paratuberculosis subunit vaccine
[0110] 1. Experimental Materials
[0111] 1.1 Vectors and strains
[0112] The pET-28a vector and MAPK-10 genomic DNA were both preserved in our laboratory. E. coli DH5α and E. coli BL21 competent cells were purchased from Tiangen Biotech Co., Ltd.
[0113] 1.2 Main Reagents
[0114] Table 1 Main Reagents
[0115]
[0116] 2 Experimental Methods
[0117] 2.1 Primer Design and Synthesis
[0118] Based on the MAP K-10 reference strain genome sequence (Accession: NC_002944.2) published in Gene Bank, specific primers for map3527, map1609c and Hsp70 were designed (Table 2). The primers were synthesized by Kumei Biotechnology Co., Ltd.
[0119] Table 2 Primers and sequences used for amplification of the map3527, map1609c, and Hsp70 genes.
[0120]
[0121] 2.2 Construction of recombinant plasmids
[0122] 2.2.1 Construction of pET-28a-3527C-3527N and pET-28a-3527N-3527C recombinant plasmids
[0123] Using MAP K-10 reference strain genomic DNA as a template, PCR amplification was performed using primers 3527C-F / R, 3527N-F / R, 3527NN-F / R, and 3527CC-F / R, yielding ligated map3527C-terminus (amino acids 2-152), map3527N-terminus (amino acids 448-640), map3527N (amino acids 21-214), and map3527C-terminus (amino acids 510-640), respectively. The PCR amplification system consisted of 25 μL PrimerSTARMax DNA polymerase, 80 ng MAP K-10 genomic DNA, 1 μL each primer, and sterile water to a final volume of 50 μL. The PCR amplification program was: 98℃ for 1 min (pre-denaturation), 98℃ for 10 s (denaturation), 67℃ for 5 s (annealing), and 72℃ for 10 s (extension), for a total of 30 cycles, followed by a final extension at 72℃ for 1 min. After the obtained PCR products were identified as correct by 1% agarose gel electrophoresis, they were recovered using the PCR gel recovery kit instructions, and the concentration was determined before being frozen and stored at -20°C for later use.
[0124] The pET-28a vector was double-digested with NdeI and EcoRI and ligated to the C-terminus (amino acids 2-152) of map3527 to obtain the pET-28a-3527C plasmid. This plasmid was then double-digested with HindIII and XhoI and ligated to the N-terminus (amino acids 448-640) of map3527 to obtain the pET-28a-3527C-3527N plasmid. The pET-28a vector was double-digested with NdeI and EcoRI and ligated to the N-terminus (amino acids 21-214) of map3527 to obtain the pET-28a-3527N plasmid. This plasmid was then double-digested with HindIII and XhoI and ligated to the C-terminus (amino acids 510-640) of map3527 to obtain the pET-28a-3527N-3527C plasmid (see...). Figure 1 ).
[0125] 2.2.2 Double enzyme digestion of pET-28a-3527C-3527N / pET-28a-3527N-3527C vector plasmid
[0126] The pET-28a-3527C-3527N or pET-28a-3527N-3527C vector was digested with EcoRI and HindIII (see Table 3). The reaction conditions were: 37°C water bath for 30 min. After the digestion products were confirmed to be correct by 1% agarose gel electrophoresis, the products were recovered using a gel extraction kit and their concentrations were determined.
[0127] Table 3. Double enzyme digestion of pET-28a-3527C-3527N or pET-28a-3527N-3527C vectors
[0128]
[0129] 2.2.3 Amplification of the 1609CN, 1609NC, Hsp70CN, and Hsp70NC genes
[0130] Using MAP K-10 reference strain genomic DNA as a template, PCR amplification was performed using primers 1609CN-F / R, 1609NC-F / R, Hsp70CN-F / R, and Hsp70NC-F / R. The PCR amplification system consisted of 25 μL PrimerSTAR Max DNA polymerase, 80 ng MAP K-10 genomic DNA, 1 μL of each primer, and sterile water to a final volume of 50 μL. The PCR amplification program was as follows: 98℃ for 1 min (pre-denaturation), 98℃ for 10 s (denaturation), 67℃ for 5 s (annealing), and 72℃ for 10 s (extension), for a total of 30 cycles, followed by a final extension at 72℃ for 1 min. After confirming the PCR products were correct by 1% agarose gel electrophoresis, they were recovered using a PCR gel recovery kit, and their concentration was determined before freezing to -20℃ for later use.
[0131] 2.2.4 Construction of recombinant plasmids pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, and pET-28a-3527N-Hsp70-3527C
[0132] The recombinant plasmids pET-28a-3527C-3527N and pET-28a-3527N-3527C were double-digested with EcoRI and HindIII and then ligated with fragments 1609CN, 1609NC, Hsp70CN, and Hsp70NC, respectively, to obtain four recombinant plasmids: pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, and pET-28a-3527N-Hsp70-3527C (see [link]). Figure 2 ).
[0133] 2.2.5 Identification of recombinant plasmids
[0134] Multiple single colonies were picked and cultured overnight at 37°C and 180 rpm for at least 12 h in 5 mL LB broth containing 50 μg / mL kanamycin. Under aseptic conditions, 5 mL of the bacterial culture was transferred to a 15 mL centrifuge tube and centrifuged at 3500 rpm for 10 min. The supernatant was discarded, and the recombinant plasmids were extracted from the bacterial pellet using a plasmid extraction kit. Four recombinant plasmids (pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, and pET-28a-3527N-Hsp70-3527C) were identified by double enzyme digestion using EcoRI and HindIII. The correctly identified bacterial cultures were sent to Jilin Kumei Biotechnology Co., Ltd. for sequencing verification.
[0135] 2.3 Inducible expression of 90CN, 90N, 66CN and 66NC proteins
[0136] Centrifuge the correctly identified bacterial culture at 3500 rpm for 10 min, discard the supernatant, and extract the recombinant plasmids from the bacterial pellet using a plasmid extraction kit. Transform 2 μL of the four correctly sequenced recombinant plasmids (pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, pET-28a-3527N-Hsp70-3527C) into 100 μL of L. coli BL21 competent cells using chemical transformation. Recover at 37°C, 180 rpm for 1 h, centrifuge at 8000 rpm for 10 min, discard the supernatant, and evenly spread the cell pellet onto LB solid medium containing 50 μg / mL kanamycin. Incubate at 37°C for at least 12 h.
[0137] Single colonies were picked from LB solid medium and inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin. The culture was incubated at 37°C and 180 rpm for at least 12 h. 100 μL of the bacterial culture was then transferred to 10 mL of LB liquid medium containing 50 μg / mL kanamycin and incubated at 37°C and 180 rpm for at least 12 h. 600nmWhen the pH was 0.8-1.0, IPTG was added to a final concentration of 1 mM to induce expression for 4 h. After centrifugation at 8000 rpm / min for 15 min, the bacterial cell pellet was collected. The bacterial cell pellet was resuspended in 1 mL buffer A (150 mM NaCl, 20 mM Tris-HCl, 10% glycerol, pH 8.0) and then disrupted using an ultrasonic cell disruptor with a program of 37% amplitude, 3 s sonication, 3 s pause, and 4 min. The sonicated bacterial culture was centrifuged at 8000 rpm / min at 4℃ for 15 min, and the supernatant and pellet were collected. The expression of the four recombinant proteins was analyzed by SDS-PAGE gel electrophoresis, and they were named 90CN, 90NC, 66CN, and 66NC proteins according to their size.
[0138] 2.4 Purification of 90CN, 90NC, 66CN, and 66NC proteins
[0139] 2.4.1 Ni column affinity chromatography purification
[0140] (1) Select single colonies according to method 2.3 and incubate overnight. After incubation, transfer the bacterial culture to 1L of LB liquid medium containing 50ug / mL kanamycin and incubate until OD. 600nm When the concentration is 0.8-1.0, add IPTG at a final concentration of 1mM to induce expression.
[0141] (2) Centrifuge at 8000 rpm / min and 4℃ for 10 min, discard the supernatant, resuspend the bacterial pellet in 50 mL of buffer A, and sonicate for 45 min.
[0142] (3) Centrifuge 3000g of the broken bacterial solution at 4℃ for 10min to remove incompletely broken cells and cell fragments.
[0143] (4) The precipitate was resuspended in 50 mL of buffer B (150 mM NaCl, 0.5% SKL, 20 mM Tis-HCl, 10% glycerol, pH 8.0) and stirred at room temperature for at least 4 hours. After the solution became clear, it was centrifuged at 10,000 rpm for 40 minutes. The precipitate was discarded and the supernatant was retained.
[0144] (5) Transfer the obtained supernatant into a pre-boiled dialysis bag and place it in 1L of refolding solution (0.54g reduced glutathione, 0.06g oxidized glutathione, 150mM NaCl, 20mM Tris-HCl, 10% glycerol, pH 8.0) for refolding. After 24h, transfer it to a refolding solution without glutathione and refold for another 24h.
[0145] (6) After refolding, the protein was centrifuged at 15,000 rpm / min and 4°C for 40 min. The precipitate was discarded, and the supernatant was retained.
[0146] (7) After equilibration with buffer A, the supernatant of the Ni-NAT chromatography column was passed through the column 6 times. Then, the supernatant was passed through the column using 40 mL of buffer C (500 mM NaCl, 3% glycerol, 20 mM imidazole, 20 mM Tris-HCl, pH 8.0), 40 mL of buffer D (500 mM NaCl, 3% glycerol, 40 mM imidazole, 20 mM Tris-HCl, pH 8.0), 40 mL of buffer E (500 mM NaCl, 3% glycerol, 60 mM imidazole, 20 mM Tris-HCl, pH 8.0), 40 mL of buffer F (500 mM NaCl, 3% glycerol, 80 mM imidazole, 20 mM Tris-HCl, pH 8.0), 40 mL of buffer G (500 mM NaCl, 3% glycerol, pH 8.0), and 40 mL of buffer H (20 mM Tris-HCl, 1 M NaCl, 3% glycerol, 20 mM Tris-HCl, 1 M NaCl, 3% glycerol, 20 mM Tris-HCl, pH 8.0), respectively. Tris-HCl (pH 8.0) was passed through a Ni-NAT chromatography column to remove contaminating proteins.
[0147] (8) The target protein was eluted with 5 mL of buffer I (150 mM NaCl, 200 mM imidazole, 5% glycerol, 20 mM Tris HCl, pH 8.0) and 5 mL of buffer J (150 mM NaCl, 500 mM imidazole, 5% glycerol, 20 mM Tis-HCl, pH 8.0).
[0148] (9) The collected protein samples were identified and analyzed by SDS-PAGE gel electrophoresis.
[0149] 2.5 Construction of 74F protein
[0150] Refer to the literature reported by Chen et al. (CHEN LH, KATHAPERUMAL K, HUANG CJ, MCDONOUGH SP, STEHMAN S, AKEY B, HUNTLEY J, BANNANTINE JP, CHANG CF, CHANG YF, 2008.Immuneresponses in mice to Mycobacterium avium subsp.paratuberculosis followingvaccination with a novel 74F recombinant polyprotein.Vaccine,26(9):1253-1262.DOI:10.1016 / j.vaccine.2007.12.014.), the full-length sequence encoding Map1519 was ligated into the pET-17b-Map3527C plasmid, and then the N-terminal fragment of Map3527 was cloned into the pET-17b-Map3527C-Map1519 plasmid. The constructed recombinant plasmid pET-17b-Map3527C-Map1519-Map3527N was transformed into Escherichia coli BL21 competent cells. After IPTG induction, the protein was successfully expressed, and the 74F recombinant protein was obtained by affinity chromatography purification.
[0151] 3 Experimental Results
[0152] 3.1 Construction and identification of recombinant plasmids pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, and pET-28a-3527N-Hsp70-3527C
[0153] Using genomic DNA from the MAPK-10 reference strain as a template, the target gene was amplified by PCR. The amplification results were analyzed by 1% agarose gel electrophoresis, and the amplified bands were consistent in size with the target gene. Figure 3 The purified PCR product was ligated with the vector plasmid to obtain the recombinant plasmid. The successfully constructed recombinant plasmid was identified by double digestion with EcoRI and Hind III, and the bands were consistent with the size of the target gene. Figure 4 This indicates that the four recombinant plasmids pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, and pET-28a-3527N-Hsp70-3527C were successfully constructed.
[0154] 3.2 Expression and purification of 90CN, 90NC, 66CN, and 66NC proteins
[0155] 3.2.1 Expression of 90CN, 90NC, 66CN, and 66NC proteins
[0156] The recombinant plasmids pET-28a-3527C-1609c-3527N, pET-28a-3527N-1609c-3527C, pET-28a-3527C-Hsp70-3527N, and pET-28a-3527N-Hsp70-3527C were transformed into E. coli BL21 competent cells. After IPTG induction, four proteins, 90CN, 90NC, 66CN, and 66NC, were successfully expressed. Figure 5 A and 5B).
[0157] 3.2.2 Affinity chromatography purification of 90CN, 90NC, 66CN, and 66NC proteins
[0158] Four proteins, 90CN, 90NC, 66CN, and 66NC, were denatured and renatured, and then purified by Ni column affinity chromatography to obtain high-purity versions of the four proteins. Figure 6 , 7 and 8).
[0159] 3.3 Affinity chromatography purification of 74F protein
[0160] Following the literature reported by Chen et al., a 74F recombinant protein was constructed and expressed. The protein was then purified by Ni column affinity chromatography to obtain a high-purity recombinant protein. Figure 9 ).
[0161] Example 2: Screening and Evaluation of Candidate Vaccines for Recombinant Subunit of Paratuberculosis
[0162] 1. Experimental Materials
[0163] 1.1 Laboratory Animals
[0164] Fifty-one 6-week-old female C57BL / 6 mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd. and raised at the Harbin Veterinary Research Institute.
[0165] 1.2 Main Reagents
[0166] Table 4 Main Reagents
[0167]
[0168] 2 Experimental Methods
[0169] 2.1 ELISPOT assay for screening adjuvants and immunization pathways
[0170] Thirty-six female C57BL / 6 mice were randomly divided into 12 groups, with three replicates per group. The immunization groups were: 66NC+MONTANIDE ISA 61VG subcutaneous immunization group, 66NC+MONTANIDE ISA 61VG intramuscular immunization group, 66NC+MONTANIDE ISA 206VG subcutaneous immunization group, 66NC+MONTANIDE ISA 206VG intramuscular immunization group, 66NC+MONTANIDE GEL 02PR subcutaneous immunization group, and 66NC+MONTANIDE GEL 02PR intramuscular immunization group. The adjuvant groups were: MONTANIDE ISA 61VG subcutaneous injection group, MONTANIDE ISA 61VG intramuscular injection group, MONTANIDE ISA 206VG subcutaneous injection group, MONTANIDE ISA 206VG intramuscular injection group, MONTANIDE GEL 02PR subcutaneous injection group, and MONTANIDE GEL 02PR intramuscular injection group. Vaccine preparation: Recombinant protein 66NC was mixed with the corresponding adjuvant at a ratio of 1:1.5, emulsified at room temperature (350 rpm / min) for 20 min, and then allowed to stand for 30 min without separation before immunizing mice. Each mouse in the immunization group was injected with 50 μg of protein (100 μL), and each mouse in the adjuvant group was injected with 100 μL of sterile PBS mixed with the corresponding adjuvant as antigen. Two vaccinations were administered, with an interval of 3 weeks. The above animal experiments have been approved by the Animal Ethics Committee of the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (HVRI-IACUC-200723-01).
[0171] 2.2 ELISPOT assay for screening candidate antigens
[0172] Fifteen female C57BL / 6 mice were randomly divided into five groups of three each. The immunization groups were: 66CN+MONTANIDE ISA 61VG, 66NC+MONTANIDE ISA 61VG, 90CN+MONTANIDE ISA 61VG, and 90NC+MONTANIDE ISA 61VG. The adjuvant group received MONTANIDE ISA 61VG. The vaccine preparation method and immunization procedure were the same as described in section 2.1, with multiple subcutaneous injections at the back. All animal experiments were approved by the Animal Ethics Committee of the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (HVRI-IACUC-200723-01).
[0173] 2.3 Preparation of mouse spleen lymphocytes
[0174] (1) Sterilize instruments and supplies such as copper wire mesh, ophthalmic scissors and tweezers under high pressure in advance.
[0175] (2) Place the mice that were euthanized by dislocation in 75% alcohol for a short time.
[0176] (3) After separating the mouse spleen in the biosafety cabinet, the spleen was placed on a suspended copper wire mesh and ground with a syringe plunger. At the same time, about 5 mL of homogenization washing solution was added to rinse the cells and the cell suspension was collected into a 15 mL centrifuge tube.
[0177] (4) Centrifuge at 450g at room temperature for 10 min and discard the supernatant.
[0178] (5) Resuspend the cells in 6 mL PBS (containing 1% penicillin and streptomycin), centrifuge at 450 g at room temperature for 10 min, and discard the supernatant.
[0179] (6) Resuspend the cells in 4 mL of sample dilution buffer.
[0180] (7) Add 5 mL of separation solution to a 15 mL centrifuge tube, and slowly add the cell suspension to the upper layer of the separation solution. Due to the density difference, a clear layering interface will appear. Centrifuge at 450 g at room temperature for 20 min. After centrifugation, the following layers will appear from top to bottom: a dilution layer, a milky white lymphocyte layer, a separation solution layer, and a red blood cell layer.
[0181] (8) Use a 2mL syringe to draw the second layer of milky white lymphocytes into a centrifuge tube, add 5mL of cell washing solution to wash, centrifuge at 400g at room temperature for 5min, and discard the supernatant.
[0182] (9) Resuspend the cells in 5 mL of cell washing solution, centrifuge at 250 g for 5 min at room temperature, and discard the supernatant.
[0183] (10) Resuspend the cells in 5 mL PBS (containing 1% penicillin and streptomycin), centrifuge at 250 g for 5 min at room temperature, and discard the supernatant.
[0184] (11) Resuspend the cells in 2 mL of RPMI 1640 complete culture medium to obtain isolated spleen lymphocytes.
[0185] 2.4 ELISPOT Experiment
[0186] (1) Activation of pre-coated plates: Add 200 μL LPM1-1640 medium to each well, let stand at room temperature for 5-10 minutes, and then discard the plate.
[0187] (2) Add cell suspension: Add the adjusted concentration of cell suspension to each experimental well, 100 μL / well.
[0188] Positive control wells: cell concentration 5 × 10⁻⁶ 5 Cells / well. Negative control wells: cell concentration 5 × 10⁶. 5 Cells / well. Blank control: Add the culture medium used to resuspend the cells. Experimental wells: The cell concentration of the sample is 5 × 10⁶ cells / well. 5 One hole / hole.
[0189] (3) Add irritant: 10 μL / well, as follows:
[0190] Positive control well: Add positive stimulation working solution PMA.
[0191] Negative control wells (including blank control wells): Add the culture medium used to resuspend the cells.
[0192] Experimental wells: Add antigen (final concentration 10 μg / mL)
[0193] (4) Incubation: After all samples and stimulants have been added, cover the plate. Incubate at 37°C with 5% CO2 for 48 hours. All the above operations must be performed in a clean bench.
[0194] Post-culturing procedures (aseptic technique no longer required)
[0195] (5) Cell lysis: Discard the cells and culture medium in the well, add 200 μL of ice-cold deionized water per well, and place in a 4°C refrigerator for 10 minutes to lyse the cells in a hypotonic manner.
[0196] (6) Washing the plate: Shake out the liquid in the well, add 1×Washingbuffer, 260μL / well, let it stand for 1 minute and then discard the liquid in the well. Repeat six times, and wipe it dry on absorbent paper each time.
[0197] (7) Antibody incubation detection: Add the diluted biotin-labeled antibody working solution to each experimental well, 100 μL / well, and incubate at 37°C for 1 h.
[0198] (8) Wash the plate: Repeat step 2.
[0199] (9) Enzyme-linked avidin incubation: Add the diluted enzyme-labeled avidin working solution to each experimental well, 100 μL / well, and incubate at 37°C for 1 h.
[0200] (10) Washing the plate: Shake out the liquid in the wells, add 1× Washingbuffer, 260μL / well, let stand for 1 minute, then discard the liquid in the wells. Repeat five times, wiping dry on absorbent paper each time. Then remove the plate base, wash the bottom of the membrane and the base with deionized water / tap water, carefully blot dry any remaining water on the base and the bottom of the membrane with absorbent paper, close the base, add 1× Washingbuffer, 260μL / well, let stand for 1 minute, then discard the liquid in the wells and completely wipe dry the liquid in the wells. μ
[0201] (11) Color development: Add freshly prepared AEC color development solution to each experimental well, 100 μL / well, and perform color development in a 37℃ incubator for 30 min. Check every 5-10 minutes.
[0202] (12) Stop color development: Pour out the liquid in the hole, remove the base of the plate, and wash the front and back sides and the base three times with deionized water to stop color development. Place the plate in a cool place at room temperature and let it air dry naturally before closing the base.
[0203] (13) Reading values: After reading the values from the enzyme-linked spot analyzer, organize the data.
[0204] 3 Experimental Results
[0205] 3.1 ELISPOT assay for screening adjuvants and immunization pathways
[0206] To screen for the most effective adjuvants and immunization routes, 66NC recombinant protein was emulsified with three adjuvants: MONTANIDE ISA61 VG, MONTANIDE ISA206 VG, and MONTANIDE GEL 02PR. Mice were then immunized via multiple subcutaneous injections in the back and multiple intramuscular injections in the legs. Three weeks after the second immunization, splenic lymphocytes were isolated for IFN-γ ELISPOT assays. Results showed that compared to other immunization groups, the number of IFN-γ-secreting splenic lymphocytes in the 66NC+MONTANIDE ISA 61VG subcutaneous immunization group was significantly increased, indicating that the 66NC recombinant protein combined with the adjuvant MONTANIDE ISA61 VG can induce a strong cellular immune response through subcutaneous immunization of mice (see...). Figure 10 ).
[0207] 3.2 ELISPOT assay for antigen screening
[0208] To screen for antigens that can induce a strong immune response, recombinant proteins 66CN, 66NC, 90CN, and 90NC were fused with MONTANIDE ISA 61VG adjuvant and then injected subcutaneously into mice at multiple sites on the back. Three weeks after the second immunization, splenic lymphocytes were isolated for IFN-γ and IL-4 ELISPOT experiments. IFN-γ ELISPOT results showed that the 66NC immunization group induced a significantly higher level of IFN-γ secretion from splenic lymphocytes compared to the 61VG, 66CN, 90CN, and 90NC immunization groups. IL-4 ELISPOT results showed that the 66NC immunization group induced a significantly higher level of IL-4 secretion from splenic lymphocytes compared to the 61VG group, but there was no significant difference compared to the 66CN, 90CN, and 90NC groups, indicating that the 66NC recombinant protein can induce a strong immune response (see...). Figure 11 and 12 ).
[0209] Example 366: Immunogenicity and Safety Evaluation of the NC Recombinant Subunit Vaccine
[0210] 1. Experimental Materials
[0211] 1.1 Laboratory Animals
[0212] Thirty-six six-week-old female C57BL / 6 mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd. and raised at the Harbin Veterinary Research Institute.
[0213] 1.2 Main Reagents
[0214] Table 5 Main Reagents
[0215]
[0216] 1.3 Main Solution
[0217] CBS solution: 0.05M sodium carbonate solution, i.e., 1.59g sodium carbonate and 2.93g sodium bicarbonate dissolved in 1L deionized water, pH 9.6, filtered through a 0.45μm filter membrane and stored at 4℃.
[0218] FACS buffer: PBS containing 0.05% sodium azide and 1% BSA.
[0219] PBST solution: PBS containing 0.05% Tween-80, filtered through a 0.45 μm filter membrane and stored at 4°C.
[0220] 2 Experimental Methods
[0221] 2.1 Animal grouping and immunization
[0222] Thirty-six female C57BL / 6 mice were randomly divided into three groups of 12 mice each: an adjuvant group (MONTANIDE ISA61VG), an immunized group (66NC + MONTANIDE ISA61VG), and an immunized group (74F + MPL). Vaccine preparation: The recombinant protein 66NC and adjuvant MONTANIDE ISA61VG were emulsified as described in Example 22.1. The recombinant protein 74F was emulsified with MPL adjuvant at a 1:1 ratio, as reported by Chen et al. Each immunized mouse was injected with 50 μg of protein (100 μL), while each non-immunized mouse was injected with 100 μL of sterile PBS mixed with the corresponding adjuvant as antigen. The administration route was multiple subcutaneous injections on the back, with a total of two immunizations administered, three weeks apart. Figure 13 The above animal experiments have been approved by the Animal Ethics Committee of the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (HVRI-IACUC-200723-01).
[0223] 2.2 Antibody Detection
[0224] (1) Blood was collected from the tail vein of 6 mice in each group at 2W, 4W, 6W, 8W, 10W, 12W, 14W, 16W and 18W after the first vaccination. The blood was incubated at 4℃ for 1h, centrifuged at 3500rpm / min for 10min to collect serum, and stored at -20℃.
[0225] (2) Coating: Dilute proteins 66NC and 74F with CBS buffer to a final concentration of 5 μg / mL as coating antigens, 100 μL per well, and coat overnight at 4°C.
[0226] (3) Washing: Discard the liquid in the plate and wash 3 times with PBST solution, 3-5 min each time.
[0227] (4) Blocking: 5% skim milk for 2 hours, 100 μL / well.
[0228] (5) Repeat step (3).
[0229] (6) Primary antibody: Serum samples were diluted with PBST at 1:3200, 1:6400, 1:12800, 1:25600, 1:25600, 1:51200, 1:102400, 1:204800, 1:409600, 1:819200, 1:1638400, 1:3276800, and 1:6553600 times.
[0230] (7) Repeat step (3).
[0231] (8) Secondary antibody: Dilute HRP-labeled goat anti-mouse IgG and IgM secondary antibody with PBST solution to a dilution of 1:10000, incubate for 1 h, 100 μL / well.
[0232] (9) Repeat step (3).
[0233] (10) Color development: TMB color development solution, 37℃ in the dark for 15 min, 50 μL / well.
[0234] (11) Reading: Terminate the reaction with 2M sulfuric acid solution, 50 μL / well, and use a microplate reader to read the OD value. 450nm Perform the read value.
[0235] 2.3 IgG subtype detection
[0236] (1) Three weeks after the second immunization, blood was collected from the tail vein of 6 mice in each group, incubated at 4°C for 1 hour, centrifuged at 3500 rpm / min for 15 minutes to collect serum, and stored at -20°C.
[0237] (2) Coating: Dilute proteins 66NC and 74F with CBS buffer to a final concentration of 5 μg / mL as coating antigens, 100 μL per well, and coat overnight at 4°C.
[0238] (3) Washing: Discard the liquid in the plate and wash 3 times with PBST solution, 3-5 min each time.
[0239] (4) Blocking: 5% skim milk for 2 hours, 100 μL / well.
[0240] (5) Repeat step (3).
[0241] (6) Primary antibody: Serum samples were diluted with PBST at dilutions of 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800 and 1:25600, respectively, and incubated for 1 hour, 100 μL / well.
[0242] (7) Repeat step (3).
[0243] (8) Secondary antibody: Dilute HRP-labeled goat anti-mouse IgG1 and IgG2a secondary antibodies with PBST solution to a dilution of 1:10000, incubate for 1 h, 100 μL / well.
[0244] (9) Repeat step (3).
[0245] (10) Color development: TMB color development solution, 37℃ in the dark for 15 min, 50 μL / well.
[0246] (11) Reading: Terminate the reaction with 2M sulfuric acid solution, 50 μL / well, and use a microplate reader to read the OD value. 450nm Perform the read value.
[0247] 2.4 ELISPOT Experiment
[0248] The experimental procedure is the same as in Example 22.4.
[0249] 2.5 Serum Cytokine Detection
[0250] Three weeks after the second immunization, blood was collected from the eyes of 6 mice in each group. The collected blood was incubated at 4°C for 1 hour and centrifuged at 3500 rpm for 10 minutes to collect serum.
[0251] (1) Add the diluted coated antibody to Corning Costar 9018 ELISA plate, 100 μL per well, and incubate overnight at 4°C.
[0252] (2) Discard the liquid in the plate and wash three times with washing buffer, 1 minute apart, 250 μL / well.
[0253] (3) Seal with diluent at room temperature for 1 hour, 200 μL / well.
[0254] (4) Repeat step 2.
[0255] (5) The standard was serially diluted twice to form a standard curve with a total of 8 points.
[0256] (6) Add 100 μL of diluent to the blank wells and 100 μL of sample to the remaining wells, and incubate at room temperature for 2 h.
[0257] (7) Repeat step 2.
[0258] (8) Add the diluted detection antibody, 100 μL / well, and incubate at room temperature for 1 h.
[0259] (9) Repeat step 2.
[0260] (10) Add diluted streptavidin HRP, 100 μL / well, and incubate at room temperature for 30 minutes.
[0261] (11) Repeat step 2.
[0262] (12) 1×TMB, develop color at room temperature in the dark for 15 min, 100μL / well.
[0263] (13) Add 100 μL of stop solution to each well and immediately apply to the OD. 450nm Read value.
[0264] 2.6 Intracellular cytokine detection
[0265] (1) Stimulation and culture of spleen lymphocytes: Add 3 mL of 5×10⁶ cells to a 6-well plate. 5 Splenic lymphocytes were collected at a concentration of 10 μg / mL. Different stimulants were added according to the experimental design, specifically as follows: For the immunized group (66NC+MONTANIDE ISA61 VG and 74F+MPL), 66NC protein and 74F protein were added to a final concentration of 10 μg / mL, respectively; for the non-immunized group (MONTANIDE ISA61 VG), the same volume of sterile PBS was added. The cells were incubated at 37°C in a 5% CO2 incubator for 12 h. Then, 2 μL of BD GolgiStop and 3 μL of BD GolgiPlug were added to each well, and the mixture was thoroughly mixed to block the cell growth for 4 h. After the block, the cell suspension from each well was transferred to a 15 mL centrifuge tube, centrifuged at 1000g for 5 min, and the supernatant was discarded. After washing twice with 1 mL of LFACS, the cell concentration in CD4-labeled and CD8-labeled tubes was adjusted to 1 × 10⁻⁶ cells / mL. 6 The sample size was measured at 1 / mL, and isotype control groups of IFN-γ, TNF-α, and IL-17A were set up.
[0266] (2) Lymphocyte surface and intracellular labeling: Resuspend cells in 50 μL FACS solution in CD4 and CD8 labeled tubes, add 1 μL of the corresponding labeled antibody, mix well, and incubate at 4°C in the dark for 30 min. Add 1 mL of FACS solution, centrifuge at 1000g for 5 min, discard the supernatant, and wash twice. Fixation: Add 250 μL FIXation solution to each tube, mix well, and incubate at 4°C for 20 min. Centrifuge at 1000g for 5 min, discard the supernatant, and wash cells twice with 1 mL of 1×Perm Buffer in each tube. Permeabilization and intracellular staining: Resuspend cells in 50 μL Perm Buffer, add 1 μL of Anti-Interferon gamma, anti-Mouse TNF-α, and anti-Mouse IL-17A antibodies to each tube, mix well, and incubate at 4°C in the dark for 30 min. Centrifuge at 1000g for 5 min and discard the supernatant. After washing the cells twice with 1 mL of 1×Perm Buffer, each tube was resuspended in 300 μL of PBS and stored at 4°C for later testing.
[0267] 2.7 Pathological and Histopathological Analysis
[0268] The liver and intestines of mice 3 weeks after the second immunization were isolated, and macroscopic lesions of the organs were observed and photographed. The caudate lobe of the liver and the ileum segment of the small intestine were removed and fixed in 4% formaldehyde (diluted with PBS). After 48 hours of fixation, they were sent to the pathology laboratory of Harbin Veterinary Research Institute to prepare pathological sections. Histopathological changes were observed using a fully automated slide scanning system, and a pathological diagnosis was made to evaluate the safety of the vaccine.
[0269] 3 Experimental Results
[0270] 3.1 Antibody test results
[0271] To evaluate the changes in antibody levels following 66NC subunit vaccine immunization in mice, changes in IgG and IgM antibody titers (positive OD at a specific dilution) were monitored starting 2 weeks after the first immunization. 450nm / Negative OD 450nm A value greater than or equal to 2.0 indicates the antibody titer at this dilution. Results showed that the IgG and IgM antibody titers produced in the 66NC immunization group were higher than those in the 74F group throughout the monitoring process, indicating that the 66NC immunization group could stimulate a better humoral immune response (see...). Figure 14 ).
[0272] 3.2 Subtype Detection Results
[0273] Three weeks after the second immunization, blood was collected from the tail vein to collect serum. ELISA was used to detect the antibody titers of IgG1 and IgG2a in the serum of mice in each group, and the IgG2a / IgG1 ratio was calculated. Results showed that no significant specific antibody subtypes were produced in the 61VG treatment group. The IgG1 and IgG2a antibody titers produced by the 66NC immunization group were higher than those in the 74F immunization group, but the IgG2a / IgG1 ratio in the 66NC immunization group was lower than that in the 74F immunization group. The 66NC immunization group indicates that, compared with the 74F immunization group, it can stimulate a better humoral immune response (see...). Figure 15 ).
[0274] 3.3 ELISPOT Experiment Results
[0275] To compare the immune levels of recombinant protein 66NC and 74F subunit vaccines, splenic lymphocytes were isolated from six mice in each of the 66NC, 74F, and 61VG treatment groups for IFN-γ and IL-4 ELISPOT assays. The results showed that three weeks after the second immunization, the number of splenic lymphocytes in the 66NC immunization group that secreted IFN-γ and IL-4 was significantly higher than that in the 74F and 61VG treatment groups, indicating that the 66NC immunization group could induce a stronger immune response (see...). Figure 16 and 17 ).
[0276] 3.4 Serum cytokine detection results
[0277] To compare the secretion of cytokines in serum, the secretion of IFN-γ, TNF-α, and IL-17A in the serum of mice 3 weeks after secondary immunization was detected by ELISA. The results showed that the secretion levels of IFN-γ, TNF-α, and IL-17A in the 66NC immunization group were significantly higher than those in the 61VG treatment group and the 74F immunization group, indicating that the 66NC immunization group could effectively stimulate the release of IFN-γ, TNF-α, and IL-17A in mouse serum (see...). Figure 18 )
[0278] 3.5 Results of intracellular cytokine detection
[0279] To evaluate the strength of the immune response induced by the 66NC subunit vaccine, ICS was used to assess CD4 levels. + T and CD8 + The levels of IFN-γ, TNF-α, and IL-17A secreted by T cells were measured. The results showed that the CD4 levels in the 66NC immunized group were significantly lower. + T and CD8 + The levels of IFN-γ, TNF-α, and IL-17A secreted by T cells were significantly higher than those in the 61VG treatment group and the 74F immunization group. Figure 19 A and B) indicate that the 66NC recombinant protein can induce CD4 +T and CD8 + T cells secrete high levels of IFN-γ, TNF-α, and IL-17A.
[0280] 3.6 Pathological and histopathological analysis results
[0281] To evaluate the safety of the 66NC subunit vaccine, mice were dissected 3 weeks after the second immunization, and the liver and small intestine were analyzed pathologically and histopathologically. Results showed no pathological damage in the 66NC immunization group, the 74F immunization group, and the 61VG treatment group (see...). Figure 20 A and B) indicate that the 66NC recombinant subunit vaccine does not cause pathological damage to mice after immunization, and has good safety.
[0282] Example 4: Evaluation of the protective effect of the 66NC recombinant subunit vaccine
[0283] 1. Experimental Materials
[0284] 1.1 Laboratory Animals
[0285] Fifty-four 6-week-old female C57BL / 6 mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd. and housed at the Harbin Veterinary Research Institute. The MAP K-10 strain was preserved by this laboratory.
[0286] 1.2 Main Reagents
[0287] Table 6 Main Reagents
[0288]
[0289] 2 Experimental Methods
[0290] 2.1 Animal grouping and infection
[0291] Fifty-four female C57BL / 6 mice were randomly divided into three groups of 24 mice each: an adjuvant group (MONTANIDE ISA61VG), an immunization group (66NC+MONTANIDE ISA61VG), and a 74F+MPL group. Mice were immunized twice with a 3-week interval after the second immunization, following the method described in 4.2.1. Mice were then infected with MAPK-10 strain intraperitoneally (1×10⁻⁶) 3 weeks after the second immunization. 9 CFU / mL) 100 μL / animal. The above animal experiments have been approved by the Animal Ethics Committee of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (HVRI-IACUC-200723-01).
[0292] 2.2 Weight monitoring
[0293] Before intraperitoneal inoculation, six mice from each group were ear-tagged and weighed, and their weights were recorded at 2 weeks, 4 weeks, 8 weeks, and 12 weeks after infection.
[0294] 2.3 Cytokine Detection
[0295] Two weeks after intraperitoneal injection infection, six mice in each group were gavage to collect blood, then euthanized by cervical dislocation, and spleen lymphocytes were isolated. The collected blood was incubated at 4°C for 1 hour and centrifuged at 3500 rpm for 10 minutes to collect serum.
[0296] (1) The detection methods for IFN-γ and TNF-α in serum are the same as in Example 32.5.
[0297] (2) The ELISPOT test method for detecting IFN-γ and IL-4 is the same as in Example 22.4.
[0298] (3) The method for detecting intracellular cytokines by staining is the same as in Example 32.6.
[0299] 2.4 Colony colonization
[0300] Mice were euthanized by cervical dislocation after infection with MAPK-10 at 2 weeks and 4 weeks. The liver and small intestine were isolated from the mice. Four-part dishes were prepared and 2 mL of complete mycobacterial culture medium was added. The isolated mouse organs were placed in the four-part dishes and ground using a 300-mesh copper mesh and a 5 mL syringe stopper. 100 μL of the stock solution was added dropwise to 7H10 solid medium containing antibiotics such as 50 μg / mL nalidixic acid, 50 μg / mL amphotericin B, and 50 μg / mL vancomycin, with 3-6 replicates per group. The cultures were incubated at 37°C for at least 4 weeks, and colony growth was observed and colony counts were performed. The caudate lobe of the liver from the 2-week-old infected mice was fixed in 4% formaldehyde (diluted with PBS) and sent to the pathology laboratory of the Harbin Veterinary Research Institute for tissue section preparation and acid-fast staining.
[0301] Preparation of acid-fast working solution: Mix 10 mL of acid-fast staining solution A with 90 mL of acid-fast staining solution B until homogeneous. Preparation of acid-fast differentiation solution: Dilute 10 mL of concentrated hydrochloric acid to 1000 mL with anhydrous ethanol. The steps are as follows:
[0302] (1) Dewaxing paraffin sections to water: Place the sections in xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% ethanol for 5 min, then wash with water.
[0303] (2) Acid-fast staining: Immerse the sections in the acid-fast working solution for 30 min and rinse with running water;
[0304] (3) Background differentiation: The acid-fast differentiation solution is used to rapidly differentiate for 2 seconds. The differentiation is terminated by washing with water. This process can be repeated until the acid-fast bacteria are purple-red and the background is basically colorless during microscopic examination.
[0305] (4) Sulfuric acid differentiation: If the background of the section is dark and hydrochloric acid cannot be removed, immerse the section in acid-fast staining solution C for 1 second for rapid differentiation, then wash quickly with tap water (rinse repeatedly until there is no sulfuric acid residue on the section), repeat the operation until the positive bacteria turn purple-red and the background is colorless.
[0306] (5) Staining with acid-fast D solution: Stain the sections with acid-fast D solution for 30 seconds, rinse with tap water, differentiate with differentiation solution for 2 seconds, rinse with tap water, and then rinse with blue solution for 3-5 seconds. Rinse with running water.
[0307] (6) Dehydration and mounting: The sections were placed in anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, xylene I for 5 min, xylene II for 5 min, and then cleared and mounted with neutral resin.
[0308] (7) Microscopic examination, image acquisition and analysis
[0309] 2.5 Correlation analysis between cytokines and colony colonization
[0310] Using the ggplot2 and ggpubr packages in R, Pearson correlation coefficient (R) was used to analyze the correlation between cytokines and liver colony colonization in mice 2 weeks after MAPK-10 infection.
[0311] 2.6 Pathological and Histopathological Observations
[0312] The liver and small intestine of mice infected with MAP K-10 2 weeks prior were isolated, and macroscopic lesions of the organs were photographed and scored pathologically. The caudate lobe of the liver and the ileum segment of the small intestine were removed and fixed in 4% formaldehyde (diluted with PBS). After 48 hours of fixation, the tissues were sent to the pathology laboratory of the Harbin Veterinary Research Institute for preparation of pathological sections. Histopathological changes were observed using a fully automated slide scanning system, and histopathological scoring was performed. The pathological scoring followed the following principles: the percentage of nodule area on the liver surface was scored as follows: 0 = none; 1 = 0–1%; 2 = 1%–3%; 3 = 3%–5%; the number of nodules on the small intestine surface was scored as follows: 0 = none; 1 = 1. The percentage of granuloma area was used to score the histopathological findings of the liver and small intestine: 0 = none; 1 < 10%; 2 = 10%–15%; 3 = 15%–20%; 4 = 20%–30%.
[0313] 3 Results
[0314] 3.1 Weight monitoring results
[0315] To observe the differences in body weight gain among mice in the 61VG treatment group, 66NC immunization group, and 74F immunization group after infection, the initial body weight of the mice was recorded before MAP K-10 vaccination. Results showed that 2 weeks after infection, the weight gain in the 66NC immunization group was significantly higher than that in the 61VG treatment group, and also higher than that in the 74F immunization group, but the difference was not statistically significant (see [link to relevant documentation]). Figure 21 The above results indicate that immunization of mice with recombinant protein 66NC can resist the weight loss in mice caused by MAP infection.
[0316] 3.2 Cytokine Detection Results
[0317] To compare the differences in cytokine secretion among the 61VG treatment group, 66NC immunization group, and 74F immunization group 2 weeks after infection, ELISA, ELISPOT, and intracellular cytokine staining were used for analysis. The results showed that the serum IFN-γ and TNF-α secretion levels in the 66NC immunization group were significantly higher than those in the 61VG treatment group and the 74F immunization group (see...). Figure 22 The levels of IFN-γ and IL-4 secreted by splenic lymphocytes in the 66NC immunization group were significantly higher than those in the 61VG treatment group and the 74F immunization group (see [link to relevant documentation]). Figure 23 and 24 ), 66NC immune group CD4 + The levels of IFN-γ, TNF-α, and IL-17A secreted by T cells were significantly higher than those in the 61VG treatment group and the 74F immunization group. Figure 25 A), but each group of CD8 + There was no significant difference in the levels of IFN-γ, TNF-α, and IL-17A secreted by T cells. Figure 25 B). In summary, the 66NC recombinant subunit vaccine can induce strong Th1 and Th2 immune responses.
[0318] 3.3 Colony colony results
[0319] To evaluate the protective effect of the 66NC recombinant subunit vaccine during infection, liver and small intestine samples were harvested from mice in the 66NC immunization group, 61VG treatment group, and 74F immunization group at 2 and 4 weeks post-infection for colony counting and acid-fast staining of the liver. Results showed that at 2 weeks post-infection, the number of bacteria-bearing cells in the liver and intestine of the 66NC immunization group was significantly lower than that in the 61VG treatment group and the 74F immunization group. Figure 26 A, 26B and Figure 27 Four weeks after infection, the number of bacteria-bearing organisms in the liver of the 66NC immunized group was significantly lower than that in the 61VG treatment group and the 74F immunized group. The number of bacteria-bearing organisms in the intestine of the 66NC immunized group was significantly lower than that in the 61VG treatment group and lower than that in the 74F immunized group, but the difference was not statistically significant. Figure 26 (A and 26B). The above results indicate that the 66NC recombinant subunit vaccine can significantly reduce the bacterial load in the liver and small intestine of mice after MAP infection, and has a protective effect against MAP infection.
[0320] 3.4 Correlation analysis results of cytokines and colony colonization
[0321] To study CD4 in spleen lymphocytes+ T and CD8 + The correlation between the levels of IFN-γ, TNF-α, and IL-17A secreted by T cells, and the serum levels of IFN-γ and TNF-α secreted, and the MAP bacterial load in the liver was analyzed using Pearson correlation coefficient (R). Results showed that CD4... + T and CD8 + The levels of IFN-γ, TNF-α, and IL-17A secreted by T cells were significantly negatively correlated with the number of bacteria-bearing cells in the liver, and CD4+ secreted by T cells were also significantly negatively correlated with the number of bacteria-bearing cells in the liver. + The secretion levels of T cell IFN-γ (R = -0.8), TNF-α (R = -0.69), and IL-17A (R = -0.59) were more correlated with the bacterial load in the liver than with CD8. + The correlation between T cell secretion of IFN-γ (R = -0.56), TNF-α (R = -0.68), and IL-17A (R = -0.41) and bacterial load in the liver (see [link to relevant data]). Figure 28 Serum IFN-γ and TNF-α secretion levels showed a significant negative correlation with the number of bacteria-bearing organisms in the liver, and the correlation between serum TNF-α levels (R = -0.77) and the number of bacteria-bearing organisms in the liver was higher than that between IFN-γ levels (R = -0.63) and the number of bacteria-bearing organisms in the liver (see...). Figure 29 The above results indicate that the IFN-γ, TNF-α, and IL-17A cytokines produced after immunization of mice with the 66NC recombinant subunit vaccine can clear MAP colonization in mouse livers.
[0322] 3.5 Pathological and Histopathological Observations
[0323] To evaluate the immunoprotective effect of the 66NC recombinant subunit vaccine in mice, mice were morcellated 2 weeks after MAP infection, and the liver and small intestine were analyzed pathologically and histopathologically. Pathological results showed that the liver pathological changes in the 66NC immunization group were significantly reduced compared to the 61VG treatment group and the 74F immunization group. Nodules were present on the surface of the small intestine in the 61VG treatment group and the 74F immunization group, while nodules were present on the surface of the small intestine in the 66NC immunization group. Figure 30 A) The liver pathology score of the 66NC immunization group was significantly lower than that of the 61VG treatment group and lower than that of the 74F immunization group, but the difference was not statistically significant. Figure 30 C), the intestinal pathology score of the 66NC immunization group was lower than that of the 61VG treatment group and the 74F immunization group, but the difference was not significant. Figure 30 E). Histopathological results showed that the area of liver granulomas in the 66NC immunization group was significantly smaller than that in the 61VG treatment group and the 74F immunization group. Figure 30 A) A giant granuloma was observed on the surface of the small intestinal serosa in mice treated with 61VG and immunized with 74F, while no obvious lesions were found in the small intestine of mice immunized with 66NC. Figure 30 B), the pathological scores of liver and intestinal tissues in the 66NC immunization group were significantly lower than those in the 61VG treatment group and lower than those in the 74F immunization group, but the differences were not statistically significant. Figure 30 (D and 30F). The above results indicate that the 66NC recombinant subunit vaccine can resist the pathological damage caused by MAP infection in mice.
Claims
1. A paratuberculosis subunit vaccine composition, characterized in that, The vaccine composition contains Mycobacterium paratuberculosis (Mycobacterium paratuberculosis) Mycobacterium avium subsp paratuberculosis The recombinant protein (MAP) is named 66NC, and its amino acid sequence is shown in SEQ ID NO.
1.
2. The paratuberculosis subunit vaccine composition as described in claim 1, characterized in that, The vaccine composition also contains an adjuvant.
3. The paratuberculosis subunit vaccine composition as described in claim 2, characterized in that, The adjuvant is MONTANIDE ISA 61 VG.
4. The paratuberculosis subunit vaccine composition as described in claim 1, characterized in that, The recombinant protein 66NC was prepared by the following method: (1) Construction of recombinant plasmids 1) Construction of recombinant plasmids pET-28a-3527C-3527N and pET-28a-3527N-3527C Using genomic DNA from the MAP K-10 reference strain as a template, PCR amplification was performed with primers 3527NN-F / R and 3527CC-F / R to obtain fragments map3527N and map3527C, respectively. ; 2) pET-28a vector via Nde Ⅰ and Eco After double digestion with RI, the plasmid was ligated to map3527N to obtain pET-28a-3527N. This plasmid was then subjected to... Hin dⅢ and Xho After double digestion with enzyme I, the plasmid was ligated with map3527C to obtain pET-28a-3527N-3527C plasmid. 3) Amplification of the Hsp70NC gene Using genomic DNA from the MAP K-10 reference strain as a template, PCR amplification was performed with primers Hsp70NC-F / R to obtain the Hsp70NC fragment. 4) Construction of the recombinant plasmid pET-28a-3527N-Hsp70-3527C pET-28a-3527N-3527C recombinant plasmid was used Eco R Ⅰ and Hin d III double digestion and with Hsp70NC Fragment concatenation yields pET-28a-3527N-Hsp70-3527C; (2) Inducible expression of 66NC protein The correctly identified bacterial culture was centrifuged, the supernatant was discarded, and the bacterial cell pellet was used to extract the recombinant plasmid. The correctly sequenced recombinant plasmid pET-28a-3527N-Hsp70-3527C was then transformed into [a specific culture medium]. E. coli BL21 competent cells were revived at 37 °C and 180 rpm / min for 1 h, centrifuged at 8000 rpm / min for 10 min, the supernatant was discarded, and the cell pellet was evenly spread on LB solid medium containing 50 ug / mL kanamycin and cultured at 37 °C for more than 12 h. Single colonies were picked from LB solid medium and inoculated into LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37 °C and 180 rpm / min for at least 12 h; 100 μL of the bacterial culture was then transferred to LB liquid medium containing 50 μg / mL kanamycin and cultured at 37 °C and 180 rpm / min until OD500. 600nm When the concentration was 0.8-1.0, IPTG was added to a final concentration of 1 mM to induce expression for 4 h. After centrifugation at 8000 rpm / min for 15 min, the bacterial cell pellet was collected. The bacterial cell pellet was resuspended in 1 mL buffer A and then sonicated for 4 min using an ultrasonic cell disruptor with an amplitude of 37%, sonication for 3 s, and pause for 3 s. The sonicated bacterial solution was centrifuged at 8000 rpm / min at 4 °C for 15 min, and the supernatant and pellet were collected. The expression of four recombinant proteins was analyzed by SDS-PAGE gel electrophoresis, and the obtained protein was named 66NC protein. The buffer A contained 150 mM NaCl, 20 mM Tris-HCl, and 10% v / v glycerol, pH 8.
0. (3) Purification of 66NC protein 1) Pick a single colony for overnight culture. After culture, transfer the bacterial culture to 1 L of LB liquid medium containing 50 ug / mL kanamycin and culture until OD500. 600nm When the concentration is 0.8-1.0, add IPTG at a final concentration of 1mM to induce expression; 2) Centrifuge at 8000 rpm / min, 4 °C for 10 min, discard the supernatant, resuspend the bacterial pellet in 50 mL buffer A, and sonicate for 45 min; 3) Centrifuge 3000 g of the broken bacterial solution at 4 °C for 10 min to remove incompletely broken cells and cell debris; 4) Resuspend the precipitate in 50 mL of buffer B and stir at room temperature for at least 4 h. After the solution becomes clear, centrifuge at 10,000 rpm / min for 40 min, discard the precipitate and keep the supernatant; the buffer B contains 150 mM NaCl, 0.5% SKL, 20 mM Tis-HCl and 10% v / v glycerol, pH 8.0; 5) Transfer the obtained supernatant to a pre-boiled dialysis bag and place it in 1 L of refolding solution for refolding. After 24 h, transfer it to a refolding solution without glutathione and refold for another 24 h. The refolding solution contains 0.54 g of reduced glutathione, 0.06 g of oxidized glutathione, 150 mM NaCl, 20 mM Tris-HCl, 10% v / v glycerol, and pH 8.
0. 6) After refolding, centrifuge the protein at 15000 rpm / min, 4 °C for 40 min. Discard the precipitate and retain the supernatant; 7) After equilibration with buffer A, pass the supernatant through the Ni-NAT chromatography column 6 times, then pass it through the Ni-NAT chromatography column with 40 mL buffer C, 40 mL buffer D, 40 mL buffer E, 40 mL buffer F, 40 mL buffer G, and 40 mL buffer H respectively to remove impurities. Buffer C contains 500 mM NaCl, 3% v / v glycerol, 20 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer D contains 500 mM NaCl, 3% v / v glycerol, 40 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer E contains 500 mM NaCl, 3% v / v glycerol, 60 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer F contains 500 mM NaCl, 3% v / v glycerol, 80 mM imidazole, 20 mM Tris-HCl, and pH 8.0; Buffer G contains 500 mM NaCl, 3% v / v glycerol, and pH 8.0; Buffer H contains 20 mM Tris-HCl, 1 M NaCl, 3% v / v glycerol, 20 mM Tris-HCl, and pH 8.
0. 8) Elute the target protein with 5 mL of buffer I and 5 mL of buffer J respectively to obtain the final product; Buffer I contains 150 mM NaCl, 200 mM imidazole, 5% v / v glycerol, 20 mM Tris HCl, and pH 8.0; Buffer J contains 150 mM NaCl, 500 mM imidazole, 5% v / v glycerol, 20 mM Tis-HCl, and pH 8.
0.
5. The use of the paratuberculosis subunit vaccine composition according to any one of claims 1-4 in the preparation of a paratuberculosis subunit vaccine.
6. The application as described in claim 5, characterized in that, The paratuberculosis subunit vaccine is obtained by emulsifying recombinant protein 66NC with adjuvant MONTANIDE ISA 61 VG at a volume ratio of 1:1.5.
Citation Information
Patent Citations
Therapeutic vaccine comprising mycobacterial heat shock protein 70
US20100047272A1
Vaccine composition
WO2016086980A1