SgRNA targeting g-quadruplex regions of gene promoters and uses thereof

Abstract

The application provides an sgRNA targeting a G-quadruplex region of a gene promoter and a use thereof, and the sgRNA is directed to the G-quadruplex region of the gene promoter. The application utilizes a base editing tool combined with an sgRNA of a corresponding site to perform point mutation on a G-quadruplex region transcription factor binding site of a target gene, destroys the formation of a G-quadruplex structure, hinders the combination of a related transcription factor and the G-quadruplex, and regulates the expression of a related target gene.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and in particular to a combination of sgRNAs targeting the G-quadruplex region of a gene promoter and its application. Background Technology

[0002] G-tetramers (G4) are four-stranded structures formed by guanine (G)-rich nucleic acid sequences. The building blocks are G-tetramers, consisting of four guanine molecules arranged in a ring and stabilized by Hoogsten hydrogen bonds. In Na... + and K + Driven by this process, planar G-tetrad structures stack on top of each other, forming a four-strand helix structure. The topological structure of G-tetrads is highly polymorphic, and can be generated by the intramolecular or intermolecular folding of G-rich DNA strands. Intramolecular folding requires four or more Gs in a single DNA strand, while intermolecular folding can be generated by two or four DNA strands, producing parallel or antiparallel structures depending on the orientation of the DNA strands.

[0003] Stable structure is crucial for the binding of G-tetragonium to its ligands, i.e., transcription factors. Furthermore, the location of G-tetragonium structures in DNA is not random; they are highly co-localized with functional regions of the genome. Increasing evidence demonstrates that G-tetragonium plays multiple important roles in biology, regulating key biological processes, various human genetic diseases, and the occurrence and development of cancer. Studies have shown that approximately 90% of human DNA replication origins contain G4 motifs, with a higher density near promoters. Research indicates that mutating to disrupt promoter G4 stability increases gene expression in several potent oncogenes. Conversely, gene expression can be suppressed by stable G4 ligands. For example, the GGA sequence repeat is present in the promoter region of the proto-oncogene c-myb, which encodes a key transcription factor regulating hematopoietic progenitor cell proliferation, differentiation, and survival. 1 Studies have shown that G4 sequences are present in the 5'-UTR region of designated mRNAs in approximately 3000 human genes and regulate mRNA translation. For ligands interacting with RNA G4 sequences, translational repression effects similar to those observed in DNA can be observed. The stability of G-tetragonal structures in mRNA has been shown to regulate the proteolysis of human estrogen receptor α. Furthermore, the G-rich long RNA transcript TERRA of telomere DNA is also rich in G4 sequences. G-tetragonal structures are also associated with the development of neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS).

[0004] G4 sequences are present in the genomes of many eukaryotic cells. DNA G4 sequences are widely distributed in the promoter regions of many important oncogenes, playing a key role in oncogene regulation and serving as important targets for newly developed anticancer drugs. Researchers have found that more G4 sequences can be detected in cancer cells, suggesting a link between G4 sequences and oncogenes. Furthermore, G4 sequences were discovered for the first time in breast cancer cells, suggesting that G4 sequences could serve as an important potential target for combating breast cancer. The research group of Zhang Na at the Chinese Academy of Sciences discovered that probes specifically recognizing G4 sequences have potential anticancer prospects. Currently, many small molecules that can bind to DNA G4 sequences have become recognized antitumor drugs, known as G4 binders. For example, CX-3543 (NCT00780663), CX-5461 (NCT02719977), and AS1411 (NCT00740441) have entered clinical trials. In summary, studying the sequence, structure, and function of G4 will greatly enhance our understanding of the spatial structure, organization, and regulation of the genome. Researching the relationship between G4 and oncogenes is a hot new field in basic biology, which will provide new ideas and targets for the diagnosis and treatment of diseases such as cancer in the future. Summary of the Invention

[0005] This invention utilizes a base editing tool to bind sgRNA at the corresponding site to perform point mutations on the transcription factor binding sites in the G-tetragonium region, thereby disrupting the formation of the G-tetragonium structure, preventing the binding of related transcription factors to the G-tetragonium, and regulating the expression of related target genes, providing a new method for studying G4 structure.

[0006] The present invention first provides an sgRNA that targets the G-tetragonium region of a gene promoter, wherein the sgRNA is obtained by annealing forward and reverse DNA oligonucleotide sequences targeting the G-tetragonium region of the gene promoter.

[0007] In one embodiment of the present invention, the gene promoter G-tetragonium region is selected from the gene promoter G-tetragonium region targeting the VEGF gene, c-kit gene, or c-myc gene.

[0008] In one embodiment of the invention, the forward and reverse DNA oligonucleotide sequence pairs are selected from SEQ ID NO:1 and SEQ ID NO:2; SEQ ID NO:4 and SEQ ID NO:5; SEQ ID NO:7 and SEQ ID NO:8; SEQ ID NO:10 and SEQ ID NO:11.

[0009] In one embodiment of the present invention, the sgRNA sequences are SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9 and SEQ ID NO:12, respectively.

[0010] The present invention also provides a recombinant vector containing the above-mentioned sgRNA.

[0011] The present invention further provides a base editing system for targeting gene G-quadruplexes, comprising the above-described sgRNA or the recombinant vector of claim 5, Cas9 protein or a mutant thereof, and cytosine deaminase.

[0012] In one embodiment of the invention, the cytosine deaminase is APOBEC or AID.

[0013] In one embodiment of the invention, the cytosine deaminase is linked to the uracil glycosylation enzyme inhibitor UGI to form APOBEC-UGI or AID-UGI;

[0014] Preferably, the cytosine deaminase APOBEC or AID, the uracil glycosylation enzyme inhibitor UGI, and the thermostable domain GB1 that prevents polymerization are linked to form an APOBEC-UGI-GB1 or AID-UGI-GB1 carrier.

[0015] Preferably, the cytosine deaminase APOBEC or AID, the uracil glycosylation enzyme inhibitor UGI, and the thermostable domain GB1 that prevents polymerization are linked to the single-chain antibody scFv to form a scFv-APOBEC-UGI-GB1 or scFv-AID-UGI-GB1 vector.

[0016] The present invention also provides the application of the above-described sgRNA, the recombinant vector of claim 5, or the above-described base editing system in causing point mutations in the G-quadruplex region of the promoter of a target gene; preferably, the target gene is selected from any one of the VEGF gene, c-kit gene, and c-myc gene.

[0017] The present invention further provides a method for constructing recombinant cells, comprising:

[0018] The sgRNA described above, the recombinant vector or base editing system of claim 5 are introduced into the nucleus of the target cells to obtain recombinant cells.

[0019] The beneficial effects of the above-described technical solution of the present invention are as follows:

[0020] The method for studying G-tetramers through base editing provided by this invention can be used for in situ site-directed mutation of G-tetramer sequences to regulate the expression of target genes. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the base editing tool.

[0022] Figure 2 The results show the successful editing of G4 DNA sequences at the promoter sites of the c-myc, VEGF, and c-kit genes, respectively.

[0023] Figure 3 After successfully editing the G4 DNA sequence at the promoter sites of the c-myc, VEGF, and c-kit genes, respectively, the mutant sequence was synthesized in vitro and the G4 structure was detected using circular dichroism spectroscopy.

[0024] Figure 4 To perform deep sequencing on the editing results of the VEGF gene promoter site, the top 14 mutant sequences were synthesized in vitro, and the G4 structure was detected using circular dichroism spectroscopy.

[0025] Figure 5 The graph shows the detection of VEGFA mRNA and protein expression levels after successful editing of the G4 DNA sequence at the VEGF gene promoter site. In the graph, A represents the expression level of VEGFA mRNA by qPCR, and B and C represent the expression level of VEGFA protein by Western blotting and quantitative analysis. Detailed Implementation

[0026] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0027] This method utilizes a base editing tool combined with sgRNA in HEK293T cells to achieve (…). Figure 1 ).

[0028] Example 1 Plasmid Construction

[0029] 1. Construction of sgRNA at the G-tetragonal sequence in the gene promoter region

[0030] Twenty complementary forward and reverse sequences containing G-quadruplex structures were selected in the gene promoter region to synthesize DNA oligonucleotides in vitro.

[0031] VEGF G-rich sgRNA-1:

[0032] The forward DNA oligonucleotide sequence is: 5'-ACCGaccccgcccccggcccgccc-3' (SEQ ID NO. 1)

[0033] The reverse DNA oligonucleotide sequence is: 5'-AAACgggcgggccgggggcggggt-3' (SEQ ID NO. 2)

[0034] The VEGF G-rich sgRNA-1 sequence obtained after annealing is: accccgcccccggcccgccc cgg (SEQ ID NO. 3)

[0035] c-kit sgRNA-1:

[0036] The forward DNA oligonucleotide sequence is: 5'-ACCGtcccctccctcgcgcccgcc-3' (SEQ ID NO. 4)

[0037] The reverse DNA oligonucleotide sequence is: 5'-AAACggcgggcgcgagggagggga-3' (SEQ ID NO. 5)

[0038] The c-kit sgRNA-2 sequence obtained after annealing is: tcccctccctcgcgcccgcc cgg (SEQ ID NO. 6)

[0039] c-kit sgRNA-2:

[0040] The forward DNA oligonucleotide sequence is: 5'-ACCGagcgccctccctctgcgcgc-3' (SEQ ID NO. 7)

[0041] The reverse DNA oligonucleotide sequence is: 5'-AAACgcgcgcagagggagggcgct-3' (SEQ ID NO. 8)

[0042] After annealing, the c-kit sgRNA-2 sequence was obtained as: agcgccctccctctgcgcgc cgg (SEQ ID NO. 9)

[0043] c-myc Pu27 sgRNA:

[0044] The forward DNA oligonucleotide sequence is: 5'-ACCG ctccccataagcgcccctcc-3' (SEQ ID NO.10)

[0045] The reverse DNA oligonucleotide sequence is: 5'-AAAC ggaggggcgcttatggggag-3' (SEQ ID NO.11)

[0046] The c-myc Pu27 sgRNA sequence obtained after annealing is: ctccccataagcgcccctcc cgg (SEQ ID NO. 12).

[0047]

[0048] Forward and reverse DNA oligonucleotide sequences were annealed and ligated into a pGL3-U6 sgRNA vector (addgene: 51133) linearized with BsaI endonuclease (NEB: R0539L).

[0049]

[0050] The ligated vector was transformed, bacteria were picked, and identified. The upstream sequence of the primers was identified as 5'-cgattagtgaacggatctcgacg-3' (SEQ ID NO.13), and the downstream sequence was the reverse oligonucleotide sequence of the corresponding sgRNA. Plasmids (Axygene: AP-MN-P-250G) were extracted from positive clones by shaking and their concentration was determined for later use. The obtained mutant plasmid was named U6-VEGF / c-kit1 / c-kit2 / c-myc-sgRNA.

[0051] Example 2: Cell Culture and Transfection

[0052] (1) Taking HEK293T cells (purchased from ATCC) as an example, the present invention performs the culture and transfection of eukaryotic cells: HEK293T cells are seeded and cultured in DMEM high glucose culture medium (HyClone, SH30022.01B) with 10% FBS added, which contains penicillin (100U / ml) and streptomycin (100μg / ml).

[0053] (2) Two hours before transfection, the medium was changed to antibiotic-free medium. Transfection was performed using Lipofectamin 2000 transfection reagent (Invitrogen 11668-019) according to the instructions. Cell counts yielded 1*102 cells. 5 The base editing system (nCas9 protein: GCN4-D10A and cytosine deaminase scFv-AID-UGI-GB1) was mixed with sgRNA at a mass ratio of 1 μg and 0.3 μg. Eight hours after transfection, the medium was replaced with fresh medium containing antibiotics, and 24 hours after transfection, purimicin was added to a final concentration of 2 ng / ml. Drug selection was performed for 2 days.

[0054] (3) Two days after drug screening, cells were collected and cell DNA was extracted using the phenol-chloroform method for PCR and sequencing.

[0055] PCR primers were designed and synthesized for each of the four gene target sites, 100 bp upstream and downstream, and diluted to 10 μM with water. The PCR primer sequences are shown below.

[0056] VEGFA Grich sg1 upstream primer: gtcactccaggattccaatagatctg (SEQ ID: 14)

[0057] VEGFA Grich sg1 downstream primer: cttctctctggagctcttgctac (SEQ ID: 15)

[0058] c-kit sgRNA-1 / 2 upstream primer: ggcattaacacgtcgaaaga (SEQ ID: 16)

[0059] c-kit sgRNA-1 / 2 downstream primer: tcggatcccatcgcagctac (SEQ ID: 17)

[0060] c-myc Pu27 sgRNA upstream primer: cagctgttccgcctgcgatg (SEQ ID: 18)

[0061] c-myc Pu27 sgRNA downstream primer: cttctcagaggcttggcgggaa (SEQ ID: 19)

[0062] Genomic target site fragments were amplified by PCR using the Novizan High Fidelity Enzyme Kit (Vazyme, p501-d2). The PCR reaction system and PCR program are shown below:

[0063]

[0064]

[0065] PCR product samples were sent for Sanger sequencing. Sequencing results were statistically analyzed as follows: Figure 2 As shown, the sg RNA targets the G-tetragonal region of the promoter of the target gene, where guanine G is converted at different ratios by the base editing system, i.e., from guanine G to adenine A.

[0066] Example 3: Circular Dichroism Spectroscopy

[0067] The synthesized mutant DNA oligonucleotide chain was diluted to 100 mM in ddH2O. A total of 20 μl of DNA was mixed with 180 μl of TE buffer (10 mM Tris HCl, 0.1 mM EDTA, pH 7.5), heated to 95 °C for 10 min, annealed, and then kept at 80 °C. KCl was immediately added to a final concentration of 100 mM, and the solution was then slowly cooled to room temperature. CD spectroscopy experiments were performed using Chirascan-Plus (Applied Photophysics) in the wavelength range of 200–320 nm. Results are as follows: Figure 3As shown, the positive and negative CD peaks at 260 nm and 240 nm represent the corresponding G4 structures. Under the action of the base editing system, the mutant genotypes of the G4 structure in the promoter region of the c-MYC, c-kit, and VEGFA genes show a downward decay (MUT) of the positive peak (WT) at 260 nm and a rightward shift (MUT) of the negative peak (WT) at 240 nm. Figure 4 As shown, the G4 structure of the VEGFA mutant sequence (MUT) is disrupted, and the change in peak is positively correlated with the number of bases converted. The VEGFA mutant sequence is shown below.

[0068] WT: cggggcgggccgggggcggggt (SEQ ID: 20)

[0069] MUT1:cggggcgggccAAgggcggggt (SEQ ID: 21)

[0070] MUT2:cggggcgggccAAAggcggggt (SEQ ID: 22)

[0071] MUT3:cggggcgggccAAAAgcggggt (SEQ ID: 23)

[0072] MUT4:cggggcggAccAAAAAcAAAAt (SEQ ID: 24)

[0073] Example 4 qPCR

[0074] 1. Total RNA was extracted from cells in each group using Trizol, with the following specific steps:

[0075] (1) Collect the transformed cells, add 500ul Trizol reagent, repeatedly pipette to fully lyse the cells, transfer to a clean 1.5ml centrifuge tube, and let stand at room temperature for minutes.

[0076] (2) Add 100 μl of chloroform, shake vigorously for 15 to 20 seconds, and then centrifuge in a refrigerated high-speed centrifuge at 4°C and 12,000 rpm for 15 minutes.

[0077] (3) Carefully aspirate the upper aqueous phase into a new 1.5ml EP tube using a pipette. Generally, aspirate about 200μl. Do not aspirate the middle layer to prevent protein contamination.

[0078] (4) Add 200 μl of isopropanol (equal volume), invert several times to allow the RNA to precipitate initially, let stand at room temperature for 10 minutes, and centrifuge at 4°C and 12,000 rpm for 10 minutes in a refrigerated high-speed centrifuge.

[0079] (5) Carefully discard the supernatant, add 1 ml of 75% ethanol prepared with deionized water, gently invert 10 times to suspend and wash the RNA, and centrifuge at 4°C, 12000 rpm for 5 minutes in a low-temperature refrigerated centrifuge.

[0080] (6) Carefully aspirate the supernatant, place in a fume hood for 10 minutes (air dry for no more than 5 minutes), add 30 μl of deionized water, and blow and aspirate several times to dissolve it.

[0081] (7) Concentration determination: The concentration of RNA samples was determined using a Nandrop instrument.

[0082] 2. Reverse transcription

[0083] The extracted RNA was reverse transcribed using the Hiscript II Q RT SuperMix kit (Vazyme, R223-01). The specific steps are as follows:

[0084] (1) Remove genomic DNA, the system is as follows:

[0085]

[0086] Gently mix with a pipette and incubate at 42°C for 2 minutes.

[0087] (2) Configure the reverse transcription system

[0088] Add 5×HiScript II qRT SuperMix II directly to the reaction tube in step 1, where:

[0089] 5×HiScript II qRT SuperMix II 4μl

[0090] 16 μl of reaction solution from step 1

[0091] Gently mix by pipetting.

[0092] (3) Perform reverse transcription reaction

[0093] PCR procedure:

[0094] 50 ℃ for 15 min

[0095] 85 ℃ 5s

[0096] The reverse transcription product cDNA was diluted to 100 μl for qPCR reaction.

[0097] 3. Quantitative PCR

[0098] qPCR was performed using ChamQ™ SYBER qPCR Master Mix (Vazyme, Q331-02). The primer sequences used for qPCR are shown below.

[0099] Primer Name Primer Sequence

[0100] VEGFA-qPCR-FOR TTGCCTTGCTGCTCTACCTCCA (SEQ ID: 25)

[0101] VEGFA-qPCR-REV GATGGCAGTAGCTGCGCTGATA (SEQ ID: 26)

[0102] GAPDH-qPCR-FOR CATCAATGGAAATCCCATCA (SEQ ID: 27)

[0103] GAPDH-qPCR-REV TTCTCCATGGTGGTGAAGAC (SEQ ID: 28)

[0104] The amplification system and reaction conditions are shown in the figure:

[0105]

[0106]

[0107] Human GAPDH was used as an internal control gene to normalize the mRNA expression of the target gene. Results were as follows: Figure 5 As shown in Figure A, the expression level of the target gene VEGFA mRNA was significantly reduced under the action of the base editing system.

[0108] Example 5: Western Blot

[0109] Cell samples were lysed using RIPA lysis buffer containing protease inhibitors, boiled at 95°C for 20 minutes, and separated by 10% SDS-PAGE in appropriate buffer. Samples were then transferred to a PVDF membrane. The membrane was blocked with TBST containing 5% skim milk for 1 hour, followed by overnight incubation with an antibody at 4°C. After washing three times with TBST, the membrane was incubated with HRP-conjugated secondary antibody at room temperature for 1 hour. The antibodies used were anti-VEGFA, anti-GAPDH, anti-mouse, and anti-rabbit. After secondary antibody incubation, the membrane was washed three times with TBST and analyzed using an Amersham Imager 600. Western blot results are shown below. Figure 5 As shown in B and C, the protein expression level of VEGFA was significantly reduced.

[0110] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

Claims

1. Application of sgRNA targeting the G-tetragonium region of gene promoters for non-diagnostic and therapeutic purposes in inducing point mutations in the G-tetragonium region of target gene promoters; The sgRNA sequence is SEQ ID NO:12; The gene promoter G-tetragonal region is selected from the gene promoter G-tetragonal region targeting the c-myc gene; The sgRNA is obtained by annealing forward and reverse DNA oligonucleotide sequences targeting the G-quadruplex region of the gene promoter.

2. The application according to claim 1, characterized in that, The forward and reverse DNA oligonucleotide sequences are SEQ ID NO:10 and SEQ ID NO:11.

Images