Application of PI4KIIa in controlling rice black-streaked dwarf virus transmission by planthoppers

Abstract

This invention discloses the application of the PI4KIIa gene in regulating the transmission of rice black-streaked dwarf virus (RBSDV) by the planthopper. This invention screened a gene associated with RBSDV transmission by the planthopper, downregulated PI4KIIa expression, effectively inhibited planthopper transmission, and reduced rice disease incidence.

Description

Technical Field

[0001] This invention belongs to the field of plant protection, specifically relating to the application of PI4KIIa in controlling the spread of rice black-streaked dwarf virus by planthoppers. Background Technology

[0002] Rice black-streaked dwarf virus (RBSDV) infects rice and causes rice black-streaked dwarf disease. In the early stages of RBSDV infection, the main field symptoms are stunted growth and dark green leaves. Later, waxy droplet-like protrusions appear on the leaves, leaf sheaths, and stems, eventually forming black streaks. This significantly impacts rice yield, and in severely affected fields, it can even lead to no yield. Besides rice, this virus can also infect corn, causing maize rough dwarf disease, and wheat, causing wheat green dwarf disease. Furthermore, it can infect various grassy weeds.

[0003] Plant viruses can be classified into vector-borne and non-vector-borne transmission based on their transmission methods. Plant viruses mainly rely on vector insects for transmission and spread, and the transmission of plant viruses by vector insects is one of the main causes of disease occurrence and epidemic. The rice planthopper (Laodelphax striatellus Fallén, abbreviated as ls) is an important pest on rice and also an important vector for the transmission of plant viruses. RBSDV enters the digestive tract through the planthopper's mouthparts, infects the midgut tissue, and then spreads to the hemolymph and other organs, finally reaching the salivary glands. When the planthopper feeds, it infects healthy plants with its saliva, ultimately causing the occurrence and spread of viral diseases.

[0004] Some viruses primarily replicate by modifying the host's intracellular membrane to create a specific microenvironment and establishing a specific, effective replication complex. Lipids are essential components of this replication complex. Phosphatidylinositol 4-phosphate (PI4P) is a class of lipids that plays a crucial role in viral replication. Related studies have shown that increased PI4P levels on the replication complex create the microenvironment required for viral replication. PI4P can increase membrane curvature, forming a membrane pocket that protects viral RNA and proteins from host attack. Phosphatidylinositol 4-kinase (PI4K) is the first kinase to play a significant role in the phosphatidylinositol signaling pathway and metabolism, phosphorylating the hydroxyl group at the fourth position of phosphatidylinositol (PI) to generate PI4P. For example, PI4KIIa has been identified as a potential target for anti-tumor therapy. Abnormal function of PI4KIIa is closely related to human diseases such as tumor growth and Alzheimer's disease, making it an important potential drug target. However, there are no reports on the potential role of PI4KIIa in the fields of animal viruses or plant viruses.

[0005] This invention reveals that RNA interference technology can reduce the expression level of PIK4IIa in planthoppers, leading to a decrease in the accumulation of RBSDV and a reduction in the virus transmission rate, thus alleviating rice disease incidence. Spraying dsPI4KIIa onto rice leaves reduces PI4KIIa expression in planthoppers after ingestion, further decreasing their virus transmission capacity and reducing rice disease incidence. These findings could serve as an effective means of preventing plant viral diseases and provide a new approach to addressing plant viral diseases. Summary of the Invention

[0006] The purpose of this invention is to provide the application of PI4KIIa in controlling the spread of rice black-streaked dwarf virus by the planthopper. This invention fills the gap in the application of PI4KIIa in controlling the spread of plant virus (RBSDV) by the vector insect planthopper, and provides a new method for solving plant viral diseases.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] A PI4KIIa gene having the nucleotide sequence shown in SEQ ID NO.1.

[0009] Biological materials for interfering with or inhibiting the PI4KIIa gene. As a preferred embodiment, this biological material is a double-stranded RNA primer or a PI4KIIa inhibitor used for downregulating PI4KIIa gene expression via RNA i interference. More preferably, the double-stranded RNA primer sequence used for downregulating PI4KIIa gene expression via RNA i interference is as follows:

[0010] dsPI4KIIa-F: 5'-TAATACGACTCACTATAGGGGAACCACTCTCCCCCACCCTTC-3'

[0011] dsPI4KIIa-R: 5'-TAATACGACTCACTATAGGGTTATTTACAATAGGGGAAGCACTGG -3';

[0012] The PI4KIIa inhibitor is PAO (phenylarsine oxide).

[0013] Application of the PI4KIIa gene in controlling the spread of rice black-streaked dwarf virus by planthoppers.

[0014] As a preferred technical solution, downregulating the expression of the PI4KIIa gene by interfering with or inhibiting its expression can reduce the ability of the rice planthopper to transmit rice black-streaked dwarf virus. More preferably, downregulating the expression of the PI4KIIa gene by interfering with the PI4KIIa gene using RNA i or by using a PI4KIIa inhibitor to inhibit the downregulation of the PI4KIIa gene expression. Even more preferably, the double-stranded RNA primer sequence used for downregulating the expression of the PI4KIIa gene by RNA i is as follows:

[0015] dsPI4KIIa-F: 5'-TAATACGACTCACTATAGGGGAACCACTCTCCCCCACCCTTC-3'

[0016] dsPI4KIIa-R: 5'-TAATACGACTCACTATAGGGTTATTTACAATAGGGGAAGCACTGG -3';

[0017] The PI4KIIa inhibitor is PAO.

[0018] The application of the aforementioned biological materials in controlling the spread of rice black-streaked dwarf virus by planthoppers.

[0019] A method for controlling the transmission of rice black-streaked dwarf virus by planthoppers involves reducing the ability of planthoppers to transmit rice black-streaked dwarf virus by interfering with or inhibiting the PI4KIIa gene and downregulating its expression. Preferably, this is achieved by interfering with PI4KIIa via RNAi to downregulate its expression or by using a PI4KIIa inhibitor to downregulate its expression.

[0020] Researchers performed transcriptome sequencing on planthoppers infected with RBSDV and discovered differential expression of PI4KIIa. Therefore, they considered whether PI4KIIa was related to the transmission of RBSDV by planthoppers and investigated the PI4KIIa gene as a potential gene associated with the transmission of rice black-streaked dwarf virus by planthoppers. The sequence of the PI4KIIa gene in planthoppers is shown in SEQ ID NO.1.

[0021] The beneficial effects of this invention are as follows: This invention screens a gene associated with the transmission of RBSDV by the planthopper, downregulates PI4KIIa expression, effectively inhibits planthopper transmission of the virus, and reduces rice disease incidence. Attached Figure Description

[0022] Figure 1 Differential expression of PI4KIIa after RBSDV infection of the planthopper.

[0023] In this study, A: qRT-PCR was used to detect the downregulated expression of PI4KIIa in the planthopper after RBSDV infection. B: Western blot analysis was used to analyze the downregulated expression of PI4KIIa in the planthopper after RBSDV infection.

[0024] Figure 2 The effect of PI4KIIa on the accumulation of virus in the planthopper.

[0025] Among them, A: RNAi technology was used to reduce the expression of PI4KIIa in the planthopper, with dsEGFP as the control; B: qRT-PCR analysis showed that the expression of RBSDV shell protein gene S10 and replication-related gene S5-1 was downregulated; C: The expression of PI4KIIa in the planthopper was reduced by using the PI4KIIa inhibitor (PAO) with DMSO as the control; D: qRT-PCR analysis showed that the expression of RBSDV shell protein gene S10 and replication-related gene S5-1 was downregulated.

[0026] Figure 3 The effects of PI4KIIa on the acquisition and transmission of toxins by the planthopper.

[0027] Among them, A: RNA i technology was used to reduce the expression of PI4KIIa in planthoppers, with dsEGFP as the control. PI4KIIa had no significant effect on the acquisition of the virus by planthoppers. B: RNA i technology was used to reduce the expression of PI4KIIa in planthoppers, with dsEGFP as the control. PI4KIIa reduced the transmission of the virus by planthoppers. C: The ability to transmit the virus was reduced, and the disease incidence in rice was alleviated. Detailed Implementation

[0028] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0029] Unless otherwise specified, all experimental materials, reagents and instruments used in the embodiments of the present invention are commercially available. Unless otherwise specified, all technical means used in the embodiments are conventional means well known to those skilled in the art.

[0030] Example 1: Differential expression of PI4KIIa before and after RBSDV infection of the planthopper

[0031] 1. Primer design

[0032] Primer design for quantitative analysis of PI4KIIa in the gray planthopper: PI4KIIa quantitative primers were designed based on the sequence obtained from sequencing the gray planthopper. The primer regions should avoid double-stranded primer regions. The primer sequences are as follows:

[0033] PI4KIIa-F:5'-CAATCGTGAAAGCCAACCG-3'

[0034] PI4KIIa-R:5'-ATCCACTTGGTCCATTTCG-3'

[0035] 2. Planthoppers acquire toxins

[0036] Non-toxic planthoppers were placed on rice seedlings infected with RBSDV and fed for 3 days. After feeding, they were placed on healthy rice seedlings and raised for 7 days before the planthoppers were collected. Planthoppers that were kept on healthy rice seedlings were used as a control.

[0037] 3. Total RNA extraction:

[0038] 1) Place a planthopper in a 1.5 mL centrifuge tube, add 200 μL of Trizol reagent and grind thoroughly. Let stand at room temperature for 5 min.

[0039] 2) Add 50 μL of chloroform, mix well, and let stand for 3 min;

[0040] 3) Centrifuge at 12000 g for 10 min at 4℃;

[0041] 4) Transfer the upper aqueous phase to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix well, and let stand for 5 min.

[0042] 5) Centrifuge at 4℃, 12000 g for 10 min, and discard the supernatant;

[0043] 6) Add 1 mL of 70% ethanol to wash the precipitate, centrifuge at 12000 g for 5 min at 4℃, and discard the supernatant;

[0044] 7) Dry the RNA precipitate, add 20 μL of RNase-free water to dissolve the precipitate, and determine the concentration and mass of RNA using a NanoDrop 2000C spectrophotometer. Store at -80℃.

[0045] 4. Reverse transcription reaction:

[0046] The first step is the removal of genomic DNA:

[0047] sample volume 10×gDNA Remover Mix 1 μL RNA Template 10 pg-1 μg RNase-Free Water Up to 10μL

[0048] Shake to mix, briefly centrifuge, and incubate at 42°C for 2 min.

[0049] The second step is the reverse transcription reaction:

[0050] sample volume Step 1 reaction solution 10 μL 5×HiFiScript RTMaster Mix 4 μL RNase-Free Water 6 μL

[0051] Mix well, centrifuge briefly, incubate at 37°C for 15 min, and then incubate at 85°C for 5 s.

[0052] 5. Real-time quantitative PCR (qRT-PCR):

[0053] The reaction system for PI4KIIa real-time quantitative PCR is as follows:

[0054] sample volume cDNA 2 μL 2×ChamQ SYBR qPCR Master Mix 10 μL PI4KIIa-F (10 μM) 0.4 μL PI4KIIa-R (10 μM) 0.4 μL <![CDATA[ddH2O]]> 7.2 μL Total volume 20 μL

[0055] PRL5 real-time quantitative PCR, the reaction system is as follows:

[0056] sample volume cDNA 2 μL 2×ChamQ SYBR qPCR Master Mix 10 μL PRL5-F (10 μM) 0.4 μL PRL5-R (10 μM) 0.4 μL <![CDATA[ddH2O]]> 7.2 μL Total volume 20 μL

[0057] The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 5 s, 55-60℃ annealing for 10 s, 72℃ extension for 20 s, for 40 cycles. The dissolution curve was determined according to different models.

[0058] 6. Western blot

[0059] 1) Place the planthopper in a 1.5 mL centrifuge tube, add 200 μL of lysis buffer (add PMSF to a final concentration of 1% (v / v), and grind thoroughly on ice;

[0060] 2) Centrifuge at 12000 g for 15 min at 4℃;

[0061] 3) Transfer the upper aqueous phase to a new 1.5 mL centrifuge tube, add 5× Protein loading according to the ratio, mix well, and incubate in a 100℃ water bath for 10 min;

[0062] 4) Use 10% PAGE protein gel electrophoresis, run at 60V for 30 min, then change to 120V for 60 min;

[0063] 5) After electrophoresis, transfer the membrane;

[0064] 6) Seal the membrane in 5% (g / 100ml) skim milk powder for 1 hour;

[0065] 7) Add RBSDV capsid protein P10 antibody, PI4KIIa antibody and α-tublin antibody (primary antibody) respectively, dilute to 1:5000, shake at room temperature for 1 h, then wash 3 times with 1×PSB for 5 min each time;

[0066] 8) Inoculate with secondary antibody (goat anti-mouse secondary antibody) at a dilution ratio of 1:5000, shake at room temperature for 40 min, then wash 3 times with 1×PSB for 5 min each time;

[0067] 9) Remove the supernatant, add 1 mL of HRP colorimetric solution, and take a picture with an imaging device.

[0068] Experimental results: , such as Figure 1 The results of qRT-PCR and Western blot analysis showed that PI4KIIa expression was downregulated in the planthopper after RBSDV infection.

[0069] Example 2: Effect of PI4KIIa on the content of RBSDV in the planthopper

[0070] 1. Design of PI4KIIa double-stranded RNA primers:

[0071] Double-stranded RNA was designed based on RNA interference technology. Primers for PI4KIIa double-stranded RNA were designed based on the PI4KIIa sequence obtained from sequencing of the planthopper. The primer sequences are as follows:

[0072] dsPI4KIIa-F: 5'-TAATACGACTCACTATAGGGGAACCACTCTCCCCCACCCTTC-3'

[0073] dsPI4KIIa-R:5'-TAATACGACTCACTATAGGGTTATTTACAATAGGGGAAGCACTGG-3'

[0074] Using cDNA from the planthopper as a template, double-stranded RNA primers were used for amplification. The amplified target band was recovered, and then dsPI4KIIa was synthesized using the recovered fragment as a template according to a double-stranded RNA synthesis kit.

[0075] 2. RNA interference with PI4KIIa and the downregulation of PI4KIIa expression by the PI4KIIa inhibitor (PAO)

[0076] 1) The effect of RNAi interference on PI4KIIa downregulation of PI4KIIa expression on the accumulation of RBSDV in the planthopper.

[0077] Non-toxic planthoppers were placed on infected rice seedlings with RBSDV and fed for 3 days. PI4KIIa expression was downregulated using RNAi technology, with dsEGFP as a control. Subsequently, the planthoppers were placed on healthy rice seedlings and fed for 7 days. qRT-PCR was used to detect PI4KIIa expression levels and RBSDV S10 and S5-1 transcription levels to analyze the effect of PI4KIIa on RBSDV accumulation in planthoppers.

[0078] 2) Effect of PI4KIIa inhibitor (PAO) downregulation of PI4KIIa expression on RBSDV accumulation in planthoppers

[0079] Non-toxic planthoppers were placed on infected rice seedlings with RBSDV and fed for 3 days. PI4KIIa inhibitors were applied to the planthoppers via spotting. DMSO served as a control. The planthoppers were then placed on healthy rice seedlings and fed for 7 days. The expression level of PI4KIIa and the transcription levels of RBSDV S10 and S5-1 were detected by qRT-PCR to analyze the effect of PI4KIIa on the accumulation of RBSDV in planthoppers.

[0080] 3. Total RNA extraction:

[0081] 1) Place a planthopper in a 1.5 mL centrifuge tube, add 200 μL of Trizol reagent and grind thoroughly. Let stand at room temperature for 5 min.

[0082] 2) Add 50 μL of chloroform, mix well, and let stand for 3 min;

[0083] 3) Centrifuge at 12000 g for 10 min at 4℃;

[0084] 4) Transfer the upper aqueous phase to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix well, and let stand for 5 min.

[0085] 5) Centrifuge at 4℃, 12000 g for 10 min, and discard the supernatant;

[0086] 6) Add 1 mL of 70% ethanol to wash the precipitate, centrifuge at 12000 g for 5 min at 4℃, and discard the supernatant;

[0087] 7) Dry the RNA precipitate, add 20 μL of RNase-free water to dissolve the precipitate, and determine the concentration and mass of RNA using a NanoDrop 2000C spectrophotometer. Store at -80℃.

[0088] 4. Reverse transcription reaction:

[0089] The first step is the removal of genomic DNA:

[0090] sample volume 10×gDNA Remover Mix 1 μL RNA Template 10 pg-1 μg RNase-Free Water Up to 10μL

[0091] Shake to mix, briefly centrifuge, and incubate at 42°C for 2 min.

[0092] The second step is the reverse transcription reaction:

[0093] sample volume Step 1 reaction solution 10 μL 5×HiFiScript RTMaster Mix 4 μL RNase-Free Water 6 μL

[0094] Mix well, centrifuge briefly, incubate at 37°C for 15 min, and then incubate at 85°C for 5 s.

[0095] 5. Real-time quantitative PCR (qRT-PCR):

[0096] The reaction system for PI4KIIa real-time quantitative PCR is as follows:

[0097] sample volume cDNA 2 μL 2×ChamQ SYBR qPCR Master Mix 10 μL PI4KIIa-F (10 μM) 0.4 μL PI4KIIa-R (10 μM) 0.4 μL <![CDATA[ddH2O]]> 7.2 μL Total volume 20 μL

[0098] PRL5 real-time quantitative PCR, the reaction system is as follows:

[0099] sample volume cDNA 2 μL 2×ChamQ SYBR qPCR Master Mix 10 μL PRL5-F (10 μM) 0.4 μL PRL5-R (10 μM) 0.4 μL <![CDATA[ddH2O]]> 7.2 μL Total volume 20 μL

[0100] S10 real-time quantitative PCR, the reaction system is as follows:

[0101] sample volume cDNA 2 μL 2×ChamQ SYBR qPCR Master Mix 10 μL RBSDV S10-F (10 μM) 0.4 μL RBSDV S10-R (10 μM) 0.4 μL <![CDATA[ddH2O]]> 7.2 μL Total volume 20 μL

[0102] The reaction system for S5-1 real-time quantitative PCR is as follows:

[0103] sample volume cDNA 2 μL 2×ChamQ SYBR qPCR Master Mix 10 μL RBSDV S5-1-F (10 μM) 0.4 μL RBSDV S5-1-R (10 μM) 0.4 μL <![CDATA[ddH2O]]> 7.2 μL Total volume 20 μL

[0104] The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 5 s, 55-60℃ annealing for 10 s, 72℃ extension for 20 s, for 40 cycles. The dissolution curve was determined according to different models.

[0105] Primer PRL5-F: 5'-CCGAAGTGACAGGCGAGGAG-3'

[0106] Primer PRL5-R: 5'-CACGCTGTGCGGGATGTT-3'

[0107] Primer RBSDV S10-F: 5'- GCCCCACGTTGCATCTTC -3'

[0108] Primer RBSDV S10-R: 5'-TGTTGGGCAAAGTGCTAGTTTC-3'

[0109] Primer RBSDV S5-1-F: 5'- GTTTACGGTGGTGCAATTTTCA -3'

[0110] Primer RBSDV S5-1-R: 5'-AGGCTTTCCTTCACTAACTTCTGACT-3'

[0111] Experimental results: such as Figure 2 As shown, interference with or inhibition of PI4KIIa, leading to downregulation of PI4KIIa expression, resulted in a decrease in the accumulation of RBSDV in the planthopper.

[0112] Example 3: The effects of PI4KIIa planthopper on virus acquisition and transmission

[0113] 1) Effects of PI4KIIa on the acquisition of toxins by the planthopper

[0114] PI4KIIa expression was downregulated using RNAi technology, with dsEGFP as a control. Planthoppers then fed on RBSDV-infected rice seedlings for 3 days, followed by feeding on healthy rice seedlings for 7 days. Total RNA was extracted and reverse transcribed. Single-head RT-PCR was used to detect the virus-carrying status of the planthoppers. Statistical results were presented as follows: Figure 3 As shown, regulating PI4KIIa expression has no effect on the acquisition of toxins by the planthopper.

[0115] 2) The impact of PI4KIIa planthopper RBSDV on virus transmission

[0116] The planthopper fed on RBSDV-infected rice seedlings for 3 days. PI4KIIa expression was downregulated using RNAi technology, with dsEGFP as a control. Subsequently, the planthoppers were placed on healthy rice seedlings and fed for 7 days. Single-planthopper, single-seedling inoculation was performed, and the inoculated seedlings were removed 3 days later. The rice seedlings were then transplanted to field greenhouses, and disease incidence was monitored. The impact of PI4KIIa on RBSDV transmission by the planthopper was analyzed. Figure 3 As shown, downregulation of PI4KIIa expression reduces the virus-transmitting ability of planthoppers and alleviates rice disease.

[0117] SEQ ID NO.1

[0118] The PI4KIIa gene of the gray planthopper (Laodelphax striatellus Fallén)

[0119]

Claims

1. Application of interfering with or inhibiting the PI4KIIa gene with nucleotide sequences as shown in SEQ ID NO.1 in controlling the spread of rice black-streaked dwarf virus by planthoppers.

2. Use according to claim 1, characterized in that, Downregulating the expression of the PI4KIIa gene by interfering with or inhibiting it can reduce the ability of the rice planthopper to transmit rice black-streaked dwarf virus.

3. Use according to claim 2, characterized in that, The expression of the PI4KIIa gene can be downregulated by interfering with the PI4KIIa gene using RNAi or by using a PI4KIIa inhibitor to inhibit the PI4KIIa gene and downregulate its expression.

4. The application according to claim 3, characterized in that, The double-stranded RNA primer sequences used to downregulate PI4KIIa gene expression via RNA i interference are as follows: dsPI4KIIa-F: 5'-TAATACGACTCACTATAGGGGAACCACTCTCCCCCACCCTTC-3' dsPI4KIIa-R: 5'-TAATACGACTCACTATAGGGTTATTTACAATAGGGGAAGCACTGG -3'; The PI4KIIa inhibitor is PAO.

5. Application of biological materials used to interfere with or inhibit the PI4KIIa gene with nucleotide sequences as shown in SEQ ID NO.1 in controlling the spread of rice black-streaked dwarf virus by planthoppers.

6. The application according to claim 5, characterized in that, The biological material is a double-stranded RNA primer or a PI4KIIa inhibitor used to downregulate PI4KIIa gene expression by interfering with the PI4KIIa gene via RNAi.

7. The application according to claim 6, characterized in that, The double-stranded RNA primer sequences used to downregulate PI4KIIa gene expression via RNA i interference are as follows: dsPI4KIIa-F: 5'-TAATACGACTCACTATAGGGGAACCACTCTCCCCCACCCTTC-3' dsPI4KIIa-R: 5'-TAATACGACTCACTATAGGGTTATTTACAATAGGGGAAGCACTGG -3'; The PI4KIIa inhibitor is PAO.

8. A method for controlling the spread of rice black-streaked dwarf virus by planthoppers, characterized in that, Downregulating the expression of the PI4KIIa gene by interfering with or inhibiting the PI4KIIa gene with the nucleotide sequence shown in SEQ ID NO.1 can reduce the ability of the planthopper to transmit rice black-streaked dwarf virus.

Images