Ultra-multiplex PCR library building kit and detection method for pathogenic microorganism detection

Abstract

The application discloses a super-multiplex PCR library building kit and a detection method for pathogenic microorganism detection, wherein the complexity of multiplex primers and the extension after the combination of the primers are reduced by limiting the base composition of the 3' end of the primers in the kit, so that the non-specific amplification caused by the excessive number of primers is avoided, and the problems of the easy occurrence of primer dimers or multimers, the interference of multiplex amplification primers, the poor amplification efficiency, the large amplification bias and the low proportion of middle target products in multiplex amplification are effectively solved by limiting the universal sequence structure at the 5' end of the primers; the pathogenic microorganism detection by the kit not only improves the library building quality, but also effectively shortens the detection time, and has important significance for the rapid and instant detection of pathogenic microorganisms.

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology, specifically relating to a multiplex PCR library preparation kit and detection method for pathogen detection. Background Technology

[0002] Multiplex amplification (MPCR) is a technique that builds upon conventional PCR by adding different primer pairs to the same reaction system to specifically amplify different templates or different regions of the same template, thereby obtaining multiple target fragments. Combined with certain detection methods, this allows for the simultaneous diagnosis of multiple targets. Multiplex amplification has been extensively studied due to its high efficiency, high throughput, and low cost. Since the concept of multiplex amplification was first proposed in 1988, it has been applied in many fields, including gene mutation and deletion, genotyping and quantification, genetic testing, and drug-assisted diagnostics. Multiplex amplification covers a wide range of applications, enabling the simultaneous detection of multiple targets, significantly improving detection efficiency while reducing costs.

[0003] With the development of science and technology, multiplex amplification technology has achieved many new breakthroughs in amplification and detection. In terms of amplification, it is no longer limited to amplification in the same reaction tube, but rather different primer pairs and templates are dispersed in relatively independent spaces for amplification; in terms of detection, new ultra-multiplex detection technologies are constantly emerging.

[0004] Currently, the application of multiplex amplification technology for pathogen detection is an important research direction, with the key being the achievement of ultra-multiplex targeted amplification and enrichment technology under low template copy number conditions. Combined with second- or third-generation sequencing methods, multiplex PCR targeted high-throughput sequencing is a potential alternative to or solution for pathogen infection detection, offering advantages such as low cost, short processing time, and high accuracy. However, the technical difficulty lies in the fact that a single multiplex PCR reaction often involves hundreds or even tens of thousands of primers, making it technically very challenging. Furthermore, the extremely low abundance of pathogen sequences in the sample further complicates the targeted enrichment process. Recent reports have also documented the use of multiplex PCR library construction kits for pathogen detection, but most only target a subset of pathogens in a specific type of sample. In addition, existing pathogen multiplex PCR library construction kits often contain hundreds or even thousands of primers in a single reaction tube, and the primer set and reaction system of the entire kit are the result of overall analysis and optimization. Therefore, existing pathogenic microorganism multiplex PCR library preparation kits still have the following common problems: (1) Interference between primers, forming a large number of dimers or multimers, reducing the proportion of target products; (2) Non-specific amplification, producing a large number of non-target amplicon, affecting subsequent sequencing; (3) Poor amplification bias and stability, making accurate quantification impossible; (4) Complex operation, long time, and poor flexibility; (5) Some clinical samples have extremely low pathogenic microorganism loads, and multiplex amplification systems that work under conventional systems show amplification abnormalities under low load conditions. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention has developed a multiplex amplification technology system for the detection of pathogenic microorganisms, which surprisingly solves the problems of primer dimers or multimers, primer interference in multiplex amplification, poor amplification efficiency, large amplification bias and low proportion of target products in existing multiplex amplification technologies.

[0006] To achieve the above objectives, the present invention employs the following technical solution.

[0007] The first aspect of this invention provides a supermultiplex PCR library preparation kit for the detection of pathogenic microorganisms, wherein the primers in the kit have the following structural features:

[0008] The 3' ends of the primers have similar sequences;

[0009] The similarity sequence consists of a single-base-defined region at the very end and a unique two-base-defined region adjacent to the single-base-defined region;

[0010] The single-base-defined region contains only one type of base, and the dual-base-defined region contains only one or two types of bases;

[0011] Neither primer contains a reverse complementary binding region to the similar sequence.

[0012] Preferably, the single-base-defined region is the last base at the end of primer 3', and the two-base-defined region is the second-to-last and third-to-last bases at the end of primer 3'.

[0013] Preferably, a universal sequence with a hairpin structure is added to the 5' end of the primer.

[0014] Specifically, the general sequence has the following characteristics:

[0015] The universal sequence has specific sequences only in the middle of the F and R ends;

[0016] The 5' end of the universal sequence has an inverse complementary sequence that binds to its 3' end;

[0017] The binding temperature for the universal sequence to form a hairpin structure is 55℃~65℃.

[0018] Based on the aforementioned developed multiple primers with specific sequence structures, a second aspect of this invention provides a method for detecting pathogenic microorganisms, comprising the following steps:

[0019] S1. Design specific primers based on the target regions of each pathogenic microorganism;

[0020] S2. Add the universal sequence to the 5' end of the specific primer described in S1;

[0021] S3. Place the nucleic acid sample to be tested and the primers obtained in S2 into the reaction system and amplify them;

[0022] S4. Using the product obtained in S3 as a template, amplification primers are added for amplification, and the amplification uses the universal sequence as the primer binding site. The amplification primers contain a tag sequence, an index sequence, or a barcode sequence.

[0023] S5. After ligating the product obtained in S4 with the sequencing adapter, perform sequencing and analyze the pathogenic microorganism information detected in the nucleic acid sample based on the sequencing data.

[0024] In addition to meeting the conventional primer design requirements, the specific primers designed in step S1 also have the following sequence characteristics:

[0025] The 3' ends of the primers have similar sequences;

[0026] The similarity sequence consists of a single-base-defined region at the very end and a unique two-base-defined region adjacent to the single-base-defined region;

[0027] The single-base-defined region contains only one type of base, and the dual-base-defined region contains only one or two types of bases;

[0028] None of the primers have a reverse complementary binding region that is similar to the primer itself.

[0029] Preferably, the universal sequence described in step S2 has a secondary structure (hairpin structure) and has the following characteristics:

[0030] The universal sequence has specific sequences only in the middle of the F and R ends;

[0031] The 5' end of the universal sequence has an inverse complementary sequence that binds to its 3' end;

[0032] The binding temperature for the universal sequence to form a hairpin structure is 55℃~65℃.

[0033] More preferably, when using universal primers with secondary structures, an endonuclease can be added to the product obtained in S3 for reaction. After the reaction is complete, the product is purified with magnetic beads, and then the purified product is amplified according to S4.

[0034] Preferably, the primer binding sequence of the amplification primer in step S4 has the sequence at the 5' end of the universal sequence that would form a secondary structure removed.

[0035] The beneficial effects of this invention are as follows: By designing multiplex specific primers with specific sequence rules, combined with special secondary structure restrictions of universal sequences, and digesting special amplified fragments, this invention effectively solves the problems of primer dimers or multimers, primer interference in multiplex amplification, poor amplification efficiency, large amplification bias, and low proportion of target products in multiplex amplification. It can achieve amplification of 500-20000 multiplexes in a multiplex amplification system with as low as 2 copies / reaction, and the coverage of the amplified target is >80%. The number of amplification cycles can be controlled within 30 cycles, the total amount of purified amplified product is >50 ng, and the detection of low-copy-valued pathogenic microorganisms can be achieved within only 30 cycles. The proportion of target products in the final sequencing data is >80%. This multi-stage system can be used to specifically amplify and enrich pathogenic microorganisms from clinical samples such as blood, bronchoalveolar lavage fluid, cerebrospinal fluid, and pleural and peritoneal fluid. It can complete the detection of pathogenic microorganisms in 4-6 hours, which is 20% shorter than the 24-hour detection time of conventional mNGS detection technology. It can achieve rapid and real-time detection in the application of pathogenic microorganism detection. Attached Figure Description

[0036] Figure 1 A schematic diagram of the structure of the specific primers provided by this invention;

[0037] Figure 2 Example diagram of the secondary structure of the universal primers and their single-stranded products provided by the present invention;

[0038] Figure 3 A schematic diagram illustrating the digestion of incompletely matched dimers in the amplification products using a nuclease in the detection method provided by this invention;

[0039] Figure 4 This is an example diagram of the secondary structure of the second-round amplification primers in the detection method provided by the present invention;

[0040] Figure 5 Linear graphs of pathogen detection using the detection method provided by this invention under conditions of no human-derived matrix and human-derived matrix;

[0041] Figure 6 Peak plots were constructed from libraries using different universal sequences. Detailed Implementation

[0042] To make the technical problems, technical solutions, and beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0043] This invention develops a set of multiplex specific primer designs with specific sequence rules, combined with special secondary structure restrictions of universal sequences, and digestion of special abnormal amplification fragments, which effectively solves some problems in existing multiplex amplification technologies.

[0044] First, when designing specific primers based on detection targets, in addition to the conventional requirements for primer secondary structure, GC content, free energy, etc., the specific primers designed in this invention only have good specificity at the 5' end, while having a certain similarity at the 3' end, and there must be no reverse complementary binding regions with the similar sequence in other regions of the primer.

[0045] For details, please refer to [link / reference]. Figure 1 The structure of this specific primer is divided into a specific primer region, a unique two-base-restricted region, and a single-base-restricted region. The single-base-restricted region restricts all primers in the same amplification system to contain only one type of base. The unique two-base-restricted region restricts all primers in the same amplification system to contain only one base and / or another type of base. At the same time, it restricts the specific primer region of any primer to not having a region that can be inversely complementary to the unique two-base-restricted region + the single-base-restricted region of the primer.

[0046] Furthermore, when the single-base region is the last base at the 3' end of the primer, and the two-base region is the second-to-last and third-to-last bases at the ' end of the primer, the specific sequence characteristics are described below:

[0047] ① All primers in the same amplification system have the same last base at the 3' end, specifically one of the modified bases A, T, C, G, U, or similar, such as A;

[0048] ②The second and third positions from the end of the 3' end of all primers in the same amplification system contain only two of the following modified bases: A, T, C, G, U, or similar bases, such as A and T.

[0049] At this point, the 3' ends of all primers in the same amplification system are similar, and there are only four possible forms: AAA, ATA, TAA, and TTA.

[0050] ③ The specific primer region of any primer in the same amplification system (i.e., Figure 1 If the NNNNN……NNN sequence does not contain a region complementary to the 3-base sequence at the 3' end of the primer, such as if the 3' end of a primer is AAA, then the specific primer region of any primer cannot contain the TTT sequence.

[0051] Through the above design, this invention can prevent the three bases at the 3' end of the specific primer from binding to form a secondary structure, thereby reducing the complexity of primers in multiplex systems and reducing non-specific amplification caused by extension reactions after primer end binding.

[0052] Secondly, in the design of the universal primer, this invention adds an inverse complementary sequence to the 5' end of the universal primer that can bind to its 3' end, enabling it to form a dimer with a special hairpin structure. Specifically, the requirements are: ① The F and R ends of the universal sequence have extremely high similarity, with a specific sequence present only in the middle part of the primer; ② The 5' and 3' ends of the universal primer can bind to form a primer dimer, and the binding temperature for dimer formation is between 55°C and 65°C.

[0053] The universal primers designed in this invention ensure that during the first round of specific primer amplification, the additional universal primer sequences preferentially bind to form a closed dimer structure, avoiding interference between the introduced universal sequences and multiplex amplification primers and thus affecting the final amplification effect. At the same time, due to the similarity between the F and R ends of the universal sequence, even if there is non-specific amplification of dimers or small fragments, their single-stranded sequences will form a self-closing inverse complementary secondary structure due to sequence complementarity, preventing further amplification during subsequent amplification.

[0054] A specific example of the universal primers provided by this invention is as follows: Figure 2As shown: In this specific example, the universal sequences F and R have the same sequence in the region where they bind to the secondary structure, but different sequences in the loop region. When the amplification reaction anneals, the universal primer will preferentially bind to the neck-loop structure, closing the universal primer region and preventing this region from affecting the multiple primers. When the universal sequences F and R produce non-specific amplification, their amplification products are also very likely to generate secondary structures, thus preventing further amplification.

[0055] Based on the universal and specific primers designed in this invention, the universal primers are then added to the 5' end of the specific primers for detection of pathogenic microorganisms. The preferred steps of this detection method are as follows:

[0056] (1) Add the universal sequence to the 5' end of the specific primer; it can be understood that the F end of the universal sequence is added to the 5' end of all upstream primers, and the R end of the universal sequence is added to the 5' end of all downstream primers;

[0057] (2) Prepare a reaction system by mixing the primers obtained in step (1) with the nucleic acid sample to be tested and other reagents required for amplification, and carry out the amplification reaction on a PCR instrument;

[0058] (3) Adding a nuclease with an optimized concentration gradient to the multiplex amplification product obtained in step (2) can specifically digest the incompletely matched dimer sequence in the reaction system and further improve the stability of the reaction system.

[0059] (4) Using the product obtained in step (3) as a template, perform a second round of amplification reaction with added barcode or index;

[0060] (5) After ligating the product obtained from S4 with the sequencing adapter, sequencing is performed, and the information of pathogenic microorganisms detected in the nucleic acid sample to be tested is analyzed based on the sequencing data.

[0061] In the above detection method, the endonuclease in step (3) can be an endonuclease that recognizes and cuts incompletely paired DNA, cross-shaped DNA, Holiday structures or DNA bifurcation points, or heterologous DNA, such as T4 or T7 endonuclease. The digestion form of the endonuclease is described in [link to digestion method]. Figure 3 Nucleotide endonucleases can specifically digest unbound single-stranded regions.

[0062] Given the universal sequence with special secondary structure restrictions provided by the present invention, the primers used in the amplification reaction of step (4) should meet the following requirements: the primer design will specifically remove the nucleotide sequence at the 5' end that can bind to form a dimer, so that the primer itself will not form a secondary structure when performing the second round of barcode or index amplification. At the same time, since the binding region of the primer also includes the specific region of the universal primer (i.e. the specific sequence in the universal sequence F and R), its annealing binding temperature will be higher than the temperature at which the universal primer forms a dimer, and it will preferentially bind to the primer for amplification during amplification.

[0063] Figure 4 This is an example diagram of the secondary structure formed by the primers in the second round of amplification. The binding region of the universal primer is similar to that of the universal primer in the first round of amplification. The difference is that a base substitution has been made at the 5' end of the primer, so that the primer will not form a secondary structure, while retaining the function of binding with the universal primer to continue amplification.

[0064] Based on the design methods for specific primers, universal primers, and primers used in the second round of amplification provided by the present invention, the present invention further provides the following implementation examples for pathogen detection. In the following examples, unless otherwise specified, all methods are conventional; the reagents and materials mentioned are commercially available unless otherwise specified.

[0065] Example 1

[0066] This example demonstrates the construction of a multiplex detection system for pathogenic microorganisms, which includes the following processes:

[0067] (1) Design of specific targeting primers for detecting bacteria, fungi and viruses.

[0068] ① The selected target region is species-specific, and amplification can only be performed when the target region is present;

[0069] ② Design specific primers based on the selected target region. The last position of the 3' end of the primer is restricted to a T base, and the second and third positions from the end are restricted to an A or T base. That is, the last three positions can be AAT, ATT, TAT, or TTT.

[0070] ③ Other regions of the primer do not contain sequences that are reverse complementary to the terminal 3 bases, that is, there are no ATT, AAT, ATA, AAA base sequences.

[0071] ④ The designed primers can only amplify the target and meet the conventional primer design requirements in terms of GC content, secondary structure and other characteristics. Specifically, the primer length is 18-25 bp, the GC content is 40%-60%, and the annealing temperature is 55-62℃, preferably 60℃.

[0072] Based on the above conditions, this example designed 80 pairs of specific primers for 59 targets. It is understandable that in specific experiments, one or more combinations can be selected for multiplex amplification depending on the experimental objective.

[0073] (2) Design of universal primer sequences.

[0074] This embodiment is based on the second-generation MGI platform and uses a universal sequencing sequence to design a universal sequence that can form specific secondary structures. The specific universal sequence designed is as follows:

[0075] F end: GTCGGCTTGGCCTCCGACTT;

[0076] R-end: GTCGGCTACGATCCGACTT.

[0077] The F-terminal sequence and the R-terminal sequence are identical at the 5' and 3' ends of the primer, and there is a specific sequence in the middle region of the primer.

[0078] (3) The universal sequence from step (2) is added to the 5' end of the specific primers obtained in step (1) (the sequences of the 80 primer pairs are listed in the sequence listing, and the primers can be synthesized by a primer synthesis company) to form primers that can be used for specific target enrichment. That is, the primers consist of two parts: one is the universal sequence at the 5' end, which is introduced because the universal sequence is used as the primer binding site during the second round of amplification, which can avoid amplification bias caused by excessive amplification cycle number; the other is the specific primer at the 3' end, which specifically binds to the target region of the pathogenic microorganism and can specifically enrich this part of the target region to be sequenced.

[0079] (4) The primers obtained in step (3) are used to carry out the first round of amplification reaction. The general preparation system for this reaction is shown in Table 1.

[0080] Table 1

[0081] Nucleic acid extraction (50 pg ~ 100 ng) 15μl Multiplex amplification mixture (5X) 4μl Specific primer set with universal sequence (100 nM) 1μl Total volume 20μl

[0082] After mixing the prepared reaction mixture thoroughly, centrifuge briefly and then perform the amplification reaction on a PCR instrument:

[0083]

[0084] The first round of amplification takes approximately 60 minutes.

[0085] (5) Use endonuclease to digest and remove the dimers or multimers generated in the first round of multiplex amplification. The specific reaction system is prepared as shown in Table 2.

[0086] Table 2

[0087] Multiplex amplification products 19μl Nucleotide endonuclease buffer (5X) 5μl Nucleotide endonuclease 1μl Total volume 25μl

[0088] After mixing the prepared reaction mixture, centrifuge briefly and incubate at 37°C for 5 minutes on a PCR instrument. Purify immediately using magnetic beads after the reaction is complete.

[0089] (6) Second round of PCR amplification reaction with tagged sequence.

[0090] The primer binding sequence of the second-round amplification primers is the same as the universal sequence at the 3' end, but the primer region at the 5' end that forms a secondary structure is specifically removed. The primers used in this embodiment are as follows:

[0091] F-terminal primer: GGTGCTGXXXXXXTCCACCATGGCTTGGCCTCCGACTT;

[0092] R-terminal primer: GGTGCTGXXXXXXTCCACCATCGGCTACGATCCGACTT;

[0093] The XXXXXX part is a label sequence, index sequence, or barcode sequence.

[0094] The reaction system for the second round of tagged sequence amplification is prepared as shown in Table 3.

[0095] Table 3

[0096] Digestion products 23μl Rapid amplification enzyme mixture (2X) 15μl Primer pair with tagged sequence (10 μM) 2μl Total volume 40μl

[0097] After mixing the prepared reaction mixture thoroughly, centrifuge briefly and then perform the amplification reaction on a PCR instrument:

[0098]

[0099] The second round of amplification takes approximately 30 minutes.

[0100] (7) Connect the sequencing adapter.

[0101] The second-round amplification products were purified using standard magnetic beads for 1X purification. Refer to the instruction manual for the purification beads for specific procedures; Novizan or Yisheng purification beads are recommended. After purification, the Qubit concentration was determined. Equal volumes of samples to be sequenced in the same batch were mixed, with a total volume of 50–500 ng for subsequent ligation reactions. The ligation system preparation is shown in Table 4.

[0102] Table 4

[0103] Samples to be sequenced (50–500 ng) 18μl Rapid ligation enzyme mixture (2X) 20μl sequencing adapters 2μl Total volume 40μl

[0104] After mixing the prepared reaction mixture, briefly centrifuge and ligate at 20°C for 10 minutes. After the reaction, ligate the sequencing adapter. The ligation product is then processed using the Nanopore official sequencing protocol. The ligation and sequencing process takes approximately 0.5 hours.

[0105] (8) Sequencing and data analysis.

[0106] The sequencing data is analyzed simultaneously on the Mingde Pathogenic Microorganism Analysis Software. The main pathogenic microorganisms can be detected when the sequencing time reaches 1 to 2 hours.

[0107] Example 2

[0108] This example demonstrates the detection of clinical blood infection samples. First, nucleic acid extraction was performed using the magnetic bead method on the Mingde automated extraction instrument. The extraction method followed the kit instructions and instrument user manual. Then, library construction, sequencing, and analysis were performed according to the primers and detection method designed in Example 1. Specific detection performance is shown in Table 5.

[0109] Table 5

[0110] Primer work 616 91％ Target detection 54 93％ Limit of detection (copies / reaction) 2～10 /

[0111] Without removing human genomic DNA, 616-fold amplification can be achieved in a multiplex amplification system with as low as 2 copies / reaction, with a primer working rate of 91% and a target detection rate of 93%. The number of amplification cycles can be controlled within 30 cycles, and the total amount of purified amplified product is >50ng. Pathogenic microorganisms can be detected under low copy conditions within only 30 cycles. The proportion of target products in the final sequencing data is >80%.

[0112] Example 3

[0113] For multiplex amplification, existing reagents or methods cannot perform relative quantification, and due to amplification bias and primer interference, the number of pathogen sequences obtained from sequencing cannot reflect the content of pathogenic microorganisms in clinical samples.

[0114] Based on the primers and detection method designed in Example 1, this example demonstrates a linearity test for the number of sequences detected by sequencing. The test samples used in this example were pathogen gradient samples ranging from 2 to 100 copies / mL, and the detection results are as follows: Figure 5 As shown, under detection conditions of 2–100 copies / mL, the method of this invention exhibits good linearity regardless of the presence of human matrix. R 2 All values ​​were above 0.9, indicating that the multiple detection method based on the present invention can achieve relative quantification.

[0115] Example 4

[0116] This example compares the performance of the experimental procedure of this invention with the general sequences in the PacBio and Nanopore procedures.

[0117] When adding barcodes and indices for two-step PCR amplification, both PacBio and Nanopore recommend using universal sequences applicable to their respective systems. All their reagents are developed based on these universal sequences, which, in principle, do not form secondary structures. The universal sequence used by Nanopore is as follows:

[0118] F end:TTTCTGTTGGTGCTGATATTGC,

[0119] R end: ACTTGCCTGTCGCTCTATCTTC.

[0120] The official PacBio recommended universal sequence is:

[0121] F-terminal: GCAGTCGAACATGTAGCTGACTCAGGTCAC,

[0122] R end: TGGATCACTTGTGCAAGCATCACATCGTAG.

[0123] Under the same experimental conditions, the multiplex amplification performance of PacBio, Nanopore, and a universal sequence designed according to the present invention that can form a secondary structure was compared. It was found that the universal sequences of PacBio and Nanopore both had dimer or multimer residues during amplification, while the method of the present invention can completely avoid the interference of dimers.

[0124] Figure 5 By constructing libraries for different universal sequences, it can be clearly seen that libraries constructed with Nanopore universal sequences (left) and PacBio universal sequences (middle) showed obvious dimer peaks during detection, while the library constructed by this invention showed no interference from dimer peaks at all.

[0125] In summary, the multiplex amplification technology system for pathogen detection developed in this invention remarkably solves the problem of primer dimer and primer interference in multiplex amplification. Without removing human genomic DNA, it can achieve ultra-multiplex amplification in a multiplex amplification system with a minimum of 2 copies / reaction, and the target coverage is >80%. The number of amplification cycles can be controlled to within 30 cycles, the total amount of purified amplified product is >50 ng, and low-copy-value pathogens can be detected within only 30 cycles. The proportion of target products in the final sequencing data is >80%. Furthermore, relative quantification can be performed based on the sequencing data obtained by this method.

[0126] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. A multi-multiplex PCR library preparation kit for the detection of pathogenic microorganisms, characterized in that, The kit includes primers having the following structural features: The 3' ends of the primers have similar sequences; The similarity sequence consists of a single-base-defined region at the very end and a unique two-base-defined region adjacent to the single-base-defined region. The single-base-defined region is the last base at the end of primer 3', and the unique two-base-defined region is the second and third bases from the end of primer 3'. The single-base-defined region contains only one type of base, and the dual-base-defined region contains only one or two types of bases; The primer has a universal sequence added to its 5' end, and the universal sequence has a hairpin structure; the universal sequence has a specific sequence only in the middle of the F and R ends, and the 5' end of the universal sequence has an inverse complementary sequence that binds to its 3' end; Neither primer contains a reverse complementary binding region to the similar sequence.

2. The ultra-multiplex PCR library preparation kit according to claim 1, characterized in that, The bonding temperature for the hairpin structure formed by the general sequence is 55℃~65℃.

3. A method for detecting pathogenic microorganisms not intended for disease diagnosis, characterized in that, Includes the following steps: S1. Design specific primers based on the target regions of each pathogenic microorganism, wherein the specific primers have the structural features of the primers described in claim 1; S2. Add the universal sequence to the 5' end of the specific primer described in S1; S3. Place the nucleic acid sample to be tested and the primers obtained in S2 into the reaction system and amplify them; S4. Add an endonuclease to the product obtained in S3 to remove incompletely matched dimer sequences in the product. Then, using the purified product as a template, add amplification primers for amplification. The amplification uses the universal sequence as the primer binding site. The amplification primers contain a tag sequence, index sequence, or barcode sequence. The primer binding sequence of the amplification primers has the sequence at the 5' end of the universal sequence that would form a secondary structure removed. S5. After ligating the product obtained in S4 with the sequencing adapter, perform sequencing and analyze the pathogenic microorganism information detected in the nucleic acid sample based on the sequencing data.

4. The method for detecting pathogenic microorganisms according to claim 3, characterized in that, The endonuclease is either a T4 endonuclease or a T7 endonuclease.

Images