A molecular identity card for "Yupin No. 1" laying hen H line, a detection primer, a kit, an identification method and applications thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-22
- Publication Date
- 2026-08-11
AI Technical Summary
目前,还没有针对“豫粉1”蛋鸡H系特有种质鉴定的相关方法
[0011] The seventh objective of this invention is to provide a method for identifying the H strain of the "Yufen No. 1" laying hen.
Smart Images

Figure CN116219034B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a molecular identification method, detection primers, reagent kits, identification methods, and applications for identifying the H strain of "Yufen No. 1" laying hens, belonging to the fields of animal molecular biotechnology and animal genetics and breeding. Background Technology
[0002] The "Yufen No. 1" laying hen breeding line is a special breeding line approved by the China Poultry Genetic Resources Committee in 2015 and is a key breed promoted by the Ministry of Agriculture and Rural Affairs. This breeding line uses the Yu Nong H line of light-colored brown-shelled laying hens as the first paternal line, the Yu Nong N line of light-colored brown-shelled laying hens as the grandparent maternal line, and the Yu Nong D line of blue-shanked dwarf white-shelled laying hens as the terminal paternal line, forming a three-line system. The H line is fast-feathering, characterized by early sexual maturity, high egg production, and carrying sex-linked genes for Columbia feathers and fast feathering. Preserving the genetic uniqueness of the H line, as the grandparent line of this breeding line, is the core content of the breeding work.
[0003] With the continuous development of sequencing technology, whole-genome resequencing has become a powerful tool for high-throughput SNP genotyping. SNP molecular markers, as a new generation of markers, possess advantages such as large numbers and stable inheritance, and have been widely applied in biology, agriculture, medicine, and evolutionary biology. Molecular marker technology can rapidly, accurately, and efficiently identify breeds, which is of great significance for ensuring the accuracy of breeds in poultry production. Among them, the KASP (kompetitive allele specific PCR) technology launched by LGC is suitable for different detection needs. KASP technology is more suitable for the detection of multiple samples and few loci, and features high efficiency, flexibility, accuracy, and component analysis.
[0004] Traditional methods of identifying poultry breeds, relying solely on physical characteristics such as body shape, feather color, shank color, and comb type, are inevitably influenced by environmental and other subjective factors. With the development of new poultry breeds and strains, identifying breeds and developing molecular identification codes for different breeds has become a major challenge. Currently, there are no specific methods for identifying the unique germplasm of the "Yufen 1" laying hen H strain. Therefore, selecting appropriate molecular markers and detection technologies, establishing a simple, economical, accurate, and efficient breed identification system, and constructing specific molecular identification codes for breeds are powerful measures to combat counterfeit and substandard breeds and to rationally protect and utilize local breed resources. Summary of the Invention
[0005] To achieve the above objectives, the first objective of this invention is to provide a molecular identification card for the H strain of the "Yufen No. 1" laying hen. This molecular identification card has obvious species specificity of the "Yufen No. 1" laying hen H strain and can be used to identify the authenticity of the "Yufen No. 1" laying hen H strain, providing a strong scientific basis for the identification and protection of the germplasm resources of the "Yufen No. 1" laying hen H strain.
[0006] The second objective of this invention is to provide the application of molecular identification in identifying the H strain of the "Yufen No. 1" laying hen population.
[0007] The third objective of this invention is to provide a PCR primer set for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens.
[0008] The fourth objective of this invention is to provide a KASP primer set for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens.
[0009] The fifth objective of this invention is to provide a kit for identifying the genotype of the H strain molecular identity card of “Yufen No. 1” laying hens.
[0010] The sixth objective of this invention is to provide the application of PCR primer sets, KASP primer sets, or kits in identifying the H strain population of “Yufen No. 1” laying hens.
[0011] The seventh objective of this invention is to provide a method for identifying the H strain of the "Yufen No. 1" laying hen.
[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0013] A molecular identification card for the H strain of "Yufen No. 1" laying hens, wherein the molecular identification card is a specific molecular marker for identifying the H strain of "Yufen No. 1" laying hens; the specific molecular marker includes SNP sites 1-6:
[0014] The SNP site 1 is located at position 45509616 on the chicken Chr2 chromosome, which is the 183rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1.
[0015] The SNP site 2 is located at position 45510792 on the chicken Chr2 chromosome, which is the 212th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 2;
[0016] The SNP site 3 is located at position 13723265 on the chicken Chr9 chromosome, which is the 137th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 3.
[0017] The SNP site 4 is located at position 13745245 on the chicken Chr9 chromosome, which is the 225th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 4.
[0018] The SNP site 5 is located at position 13795646 on the chicken Chr9 chromosome, which is the 110th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 5.
[0019] The SNP site 6 is located at position 13798154 on the chicken Chr9 chromosome, which is the 99th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 6.
[0020] Specifically, the chicken chromosome numbering and SNP marker sites provided by this invention refer to the GRCg6a data in the Ensemble database. In specific applications, if the reference chicken genome is adjusted, it should be aligned with the reference genome data in this invention.
[0021] In the early stages, the inventors screened and verified a large population and finally identified six specific SNP molecular markers for the "Yufen No. 1" laying hen H strain as its molecular identity card. This molecular identity card has the species specificity of the "Yufen No. 1" laying hen H strain and can clearly distinguish the "Yufen No. 1" laying hen H strain from other commercial and local breeds.
[0022] Application of a molecular identification method in identifying the H strain of “Yufen No. 1” laying hens.
[0023] The molecular identification method of the "Yufen No. 1" laying hen H strain of this invention has obvious species specificity and can be used to identify the authenticity of the "Yufen No. 1" laying hen H strain. Applying the molecular identification method of this invention to identify chicken breeds is simple to operate, highly specific, and has good repeatability, providing a strong scientific basis for the identification and protection of the germplasm resources of the "Yufen No. 1" laying hen H strain.
[0024] Preferably, the genotypes of SNP loci 1 to 6 of the sample to be tested are detected. When the genotype of SNP loci 1 is GG, the genotype of SNP loci 2 is AA, the genotype of SNP loci 3 is CC, the genotype of SNP loci 4 is AA, the genotype of SNP loci 5 is AA, and the genotype of SNP loci 6 is AA, the sample to be tested is the "Yufen No. 1" H strain laying hen.
[0025] A PCR primer set for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hen, the PCR primer set including the first primer pair to the sixth primer pair corresponding to the detection of SNP sites 1 to 6; the nucleotide sequences of the first primer pair to the sixth primer pair are shown in SEQ ID NO. 7-18.
[0026] A KASP primer set for detecting the genotype of the H strain molecular identity card of “Yufen No. 1” laying hen as described in claim 1, wherein the KASP primer set includes the seventh to twelfth primer pairs corresponding to the detection of SNP sites 1 to 6; the nucleotide sequences of the seventh to twelfth primer pairs are shown in SEQ ID NO. 19-36.
[0027] A kit for detecting the genotype of the H strain molecular identity card of “Yufen No. 1” laying hen as described in claim 1, the kit comprising a PCR primer set with nucleotide sequences as shown in SEQ ID NO. 7-18 or a KASP primer set with nucleotide sequences as shown in SEQ ID NO. 19-36.
[0028] Preferably, when the kit contains a PCR primer set with nucleotide sequences as shown in SEQ ID NO. 7-18, the kit further includes a PCR reaction buffer, DNA polymerase, and dNTPs; when the kit contains a KASP primer set with nucleotide sequences as shown in SEQ ID NO. 19-36, the kit further includes a KASP reaction buffer, DNA polymerase, and dNTPs.
[0029] The application of the above-mentioned PCR primer set, KASP primer set, or kit in identifying the H strain population of "Yufen No. 1" laying hens.
[0030] The PCR primer set, KASP primer set, or kit provided by this invention have all yielded ideal results in the germplasm identification of the "Yufen No. 1" laying hen H strain, providing good data support for germplasm identification and possessing good social value and practical application value.
[0031] A method for identifying the H strain of "Yufen No. 1" laying hens involves detecting the genotypes of SNP loci 1 to 6 in the sample to be tested. When the genotype of SNP loci 1 is GG, the genotype of SNP loci 2 is AA, the genotype of SNP loci 3 is CC, the genotype of SNP loci 4 is AA, the genotype of SNP loci 5 is AA, and the genotype of SNP loci 6 is AA, the sample is identified as the H strain of "Yufen No. 1" laying hens.
[0032] The identification method provided by this invention achieves rapid and accurate identification of the test sample by detecting specific SNP sites 1-6 of the "Yufen No. 1" laying hen H strain. This method fills the gap in the technology for identifying the authenticity of the "Yufen No. 1" laying hen H strain population germplasm and can be used for the traceability identification and protection of the "Yufen No. 1" laying hen H strain population germplasm. It is of great significance for promoting the healthy development of the germplasm resources of the "Yufen No. 1" laying hen H strain population.
[0033] Preferably, the genotype detection method is any of the following:
[0034] (1) Using the extracted DNA of the sample to be tested as a template, PCR amplification reaction is performed using the PCR primer set described in claim 4, and the PCR product is subjected to Sanger sequencing. Genotyping is performed based on the sequencing.
[0035] (2) Using the extracted DNA of the sample to be tested as a template, PCR amplification reaction was performed using the KASP primer set described in claim 5, and fluorescence signals were obtained for typing. Attached Figure Description
[0036] Figure 1 In Example 6 of this invention, SNP markers of the H strain of "Yufen No. 1" laying hens were used to detect the resource genotyping maps of the "Yufen No. 1" laying hen H strain, Gushi chicken, Lushi chicken, Hy-Line laying hens, and Hubbard broiler chicken populations at the following loci: chromosome 45509616, chromosome 13723265, chromosome 13745245, chromosome 13795646, and chromosome 13798154. Detailed Implementation
[0037] The objectives, technical solutions, and beneficial effects of the present invention will be further explained below with reference to embodiments. The described embodiments help those skilled in the art to better understand the invention and do not constitute a limitation thereof. Unless otherwise specified, all reagents, instruments, etc., used in the embodiments are commercially available products.
[0038] I. A specific implementation method for identifying the molecular identity of the H strain of "Yufen No. 1" laying hens.
[0039] In the early stages of this invention, through screening and verification of a large population, six specific SNP molecular markers of the "Yufen No. 1" laying hen H strain were ultimately identified as its molecular identity. The specific implementation procedures are as follows:
[0040] Example 1: Identification of the molecular identity of the H strain of "Yufen No. 1" laying hens
[0041] In this embodiment, a specific molecular marker for identifying the H strain of "Yufen No. 1" laying hens is used. The specific molecular marker includes SNP sites 1 to 6:
[0042] SNP site 1 is located at position 45509616 on the chicken Chr2 chromosome, which is the 183rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1;
[0043] SNP site 2 is located at position 45510792 on the chicken Chr2 chromosome, which is the 212th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 2;
[0044] SNP site 3 is located at position 13723265 on the chicken Chr9 chromosome, which is the 137th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 3;
[0045] SNP site 4 is located at position 13745245 on the chicken Chr9 chromosome, which is the 225th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 4;
[0046] SNP site 5 is located at position 13795646 on the chicken Chr9 chromosome, which is the 110th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 5.
[0047] SNP site 6 is located at position 13798154 on the chicken Chr9 chromosome, which is the 99th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 6.
[0048] II. A specific embodiment of a primer set for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hen.
[0049] The PCR primer combination and KASP primer set provided by this invention can specifically amplify fragments at SNP sites. The specific implementation operation is as follows:
[0050] Example 2: A PCR primer set for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens.
[0051] The nucleotide sequence of the PCR primer set used in this embodiment for detecting and identifying the genotype of the "Yufen No. 1" laying hen H strain molecular identity card is shown below:
[0052] SNP site 1:
[0053] SNP-1-F: AGCTATTGCACATTCAAGTTCC (as shown in SEQ ID NO: 7);
[0054] SNP-1-R: CTTACCGTGAACAAGAGCCT (shown in SEQ ID NO: 8).
[0055] SNP site 2:
[0056] SNP-2-F: TGGTTAATAACTCCACGCATC (shown in SEQ ID NO: 9);
[0057] SNP-2-R: TTTTCAGCCTAAAGCTTCG (as shown in SEQ ID NO: 10).
[0058] SNP site 3:
[0059] SNP-3-F: CTTTGTACCTAAGCTACTGCC (shown in SEQ ID NO: 11);
[0060] SNP-3-R: TAGAAACCTGAGTTGCCACC (as shown in SEQ ID NO: 12).
[0061] SNP site 4:
[0062] SNP-4-F: TTCATCACCTGAACGCCCAA (as shown in SEQ ID NO: 13);
[0063] SNP-4-R: TAGTTTGTGCCTGTACCTGT (as shown in SEQ ID NO: 14).
[0064] SNP site 5:
[0065] SNP-5-F: TATAAATGAGGTGCTTTACCC (as shown in SEQ ID NO: 15);
[0066] SNP-5-R: CTTTTAAACTACTAATGGCCTT (shown in SEQ ID NO: 16).
[0067] SNP site 6:
[0068] SNP-6-F: GCACCCAAAATCCTGAACCAC (as shown in SEQ ID NO: 17);
[0069] SNP-6-R: CAAGCTGCAAAAGCATCTCC (as shown in SEQ ID NO: 18).
[0070] Example 3: A KASP primer set for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens.
[0071] The nucleotide sequence of the KASP primer set used in this embodiment for detecting and identifying the genotype of the "Yufen No. 1" laying hen H strain molecular identity card is shown below:
[0072] SNP site 1:
[0073] SNP-1-SF: CCCACCCAGAAAGGTCTGTGTA (as shown in SEQ ID NO: 19);
[0074] SNP-1-SR: CCACCCAGAAAGGTCTGTGTG (as shown in SEQ ID NO: 20);
[0075] SNP-1-SC: TCTCTCTTTAGCACTCATCATACAGAAA (as shown in SEQ ID NO: 21).
[0076] SNP locus 2:
[0077] SNP-2-S-F: GACCTTACACTTTAGTTGTGTTCAGG (shown in SEQ ID NO: 22);
[0078] SNP-2-S-R: GACCTTACACTTTAGTTGTGTTCAGA (shown in SEQ ID NO: 23);
[0079] SNP-2-S-C: GACACCTCGGAAACCATTGTTAGAATTAT (shown in SEQ ID NO: 24).
[0080] SNP locus 3:
[0081] SNP-3-S-F: GTCAGATATAACAAATAGAGATGAATTATAGAT (shown in SEQ ID NO: 25);<**********><**********>SNP-2-S-R: CAGATATAACAAATAGAGATGAATTATAGAC (shown in SEQ ID NO: 26);
[0083] SNP-3-S-C:: AATATACGGCAGATTTTACTTCTTGTGGAA (shown in SEQ ID NO: 27).
[0084] SNP locus 4:
[0085] SNP-4-S-F: AGCTGTGCTCCAGCTGATGTTG (shown in SEQ ID NO: 28);
[0086] SNP-4-S-R: GAGCTGTGCTCCAGCTGATGTTA (shown in SEQ ID NO: 29);
[0087] SNP-4-S-C: CACAAATCCAAATATCATCAGGTGCCTTA (shown in SEQ ID NO: 30). [[ID=**********]]<**********>[[ID=**********]]<**********> SNP locus 5:
[0089] SNP-5-S-F: AAGGAAATTCTTGCAGGCTGAGC (shown in SEQ ID NO: 31);
[0090] SNP-5-S-R: CAAGGAAATTCTTGCAGGCTGAGT (shown in SEQ ID NO: 32);
[0091] SNP-5-SC: GGCATCAAGAGTTGCATGAGGAGTT (SEQ ID NO: 33).
[0092] SNP site 6:
[0093] SNP-6-SF: GCTCATGGAGACTGTTCCC (SEQ ID NO: 34);
[0094] SNP-6-SR: CCTGCTCATGGAGACTGTTCCT (shown in SEQ ID NO: 35);
[0095] SNP-6-SC: CCAGCTCCAACCATTAAAATTCATGACAT (shown in SEQ ID NO: 36).
[0096] III. Specific Implementation Examples of a Kit for Detecting and Identifying the Genotype of the H Line Molecular Identity Card of "Yufen No. 1" Laying Hens
[0097] Example 4: A PCR kit for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens.
[0098] This embodiment describes a PCR kit for detecting and identifying the genotype of the "Yufen No. 1" laying hen H molecular identity card. The kit includes the PCR primer set shown in Example 2, as well as dNTPs, PCR reaction buffer, and DNA polymerase.
[0099] Example 5: A KASP kit for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens.
[0100] This embodiment describes a KASP kit for detecting and identifying the genotype of the H strain molecular identity card of "Yufen No. 1" laying hens. The kit includes the KASP primer set shown in Example 3, as well as KASP reaction buffer, DNA polymerase, and dNTPs.
[0101] IV. Specific Examples of the Application of Molecular Identification in Identifying the H Line Population of "Yufen No. 1" Laying Hens
[0102] The application of the molecular identification method of this invention in identifying the H strain of "Yufen No. 1" laying hens involves detecting the genotypes of SNP loci 1-6 in the sample to be tested. When the genotype of SNP loci 1 is GG, the genotype of SNP loci 2 is AA, the genotype of SNP loci 3 is CC, the genotype of SNP loci 4 is AA, the genotype of SNP loci 5 is AA, and the genotype of SNP loci 6 is AA, the sample is identified as a "Yufen No. 1" H strain laying hen. The specific implementation is as follows:
[0103] Example 6 PCR detection
[0104] In this embodiment, the chickens to be tested were identified using PCR, utilizing the SNP molecular markers from Example 1 and the PCR primer set from Example 2. The specific implementation steps are as follows:
[0105] 1. Extraction of genomic DNA from different chicken breeds
[0106] Sample materials were selected from five breeds: "Yufen No. 1" laying hens (H strain), Gushi chickens, Lushi chickens, Hy-Line laying hens, and Hubbard broilers, with 30 samples from each breed. Blood samples were collected and stored directly at -20°C. DNA was extracted from the samples using the Tiangen DNA extraction kit. DNA integrity was assessed using 1.0% agarose gel electrophoresis, and DNA concentration, nucleotide OD260 / 280, and OD260 / 230 mass values were measured using a NanoDrop spectrophotometer. Equal volumes of DNA from chickens of the same breed were mixed.
[0107] 2. PCR amplification
[0108] Using the DNA mixed in step 1 as a template and the PCR primer set in Example 2 as amplification primers, a PCR amplification reaction was performed. The PCR reaction system is shown in Table 1.
[0109] Table 1 PCR reaction system
[0110]
[0111] The PCR reaction conditions are as follows:
[0112] (1)SNP1: 95℃ for 5 min; 95℃ for 10 s, 55℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0113] (2) SNP2: 95℃ for 5 min; 95℃ for 10 s, 54.4℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0114] (3) SNP3: 95℃ for 5 min; 95℃ for 10 s, 62℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0115] (4) SNP4: 95℃ for 5 min; 95℃ for 10 s, 61℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0116] (5) SNP5: 95℃ for 5 min; 95℃ for 10 s, 61℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0117] (6)SNP6: 95℃ for 5 min; 95℃ for 10 s, 60.6℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0118] PCR amplification reactions were performed on a Thermo Fisher Scientific ProFlex™ Base instrument.
[0119] 3. Sequencing peak diagram and genotyping
[0120] The PCR products were subjected to Sanger sequencing, and genotyping was performed on six sequencing loci for five breeds based on the sequencing peak diagram. When the genotype at chromosome 45509616 was GG; chromosome 45510792 was AA; chromosome 13723265 was CC; chromosome 13745245 was AA; chromosome 13795646 was AA; and chromosome 13798154 was AA, the sample was identified as a "Yufen No. 1" laying hen H strain. The Sanger sequencing alignment diagram is shown below. Figure 1 As shown.
[0121] Example 7 KASP Detection
[0122] In this embodiment, the chickens to be tested were identified using the KASP method, utilizing the SNP molecular markers from Example 1 and the KASP primer set from Example 3. The specific implementation steps are as follows:
[0123] 1. Extraction of genomic DNA from different chicken breeds
[0124] The sample materials consisted of 87 H-strain "Yufen No. 1" laying hens and 6 other breeds. The sample size for each breed is shown in Table 1. Blood samples were collected and stored directly at -20°C. DNA was extracted using the Tiangen DNA extraction kit. DNA integrity was assessed using 1.0% agarose gel electrophoresis, and DNA concentration, nucleotide OD260 / 280, and OD260 / 230 values were measured using a NanoDrop spectrophotometer.
[0125] 2. PCR amplification
[0126] Using the DNA from step 1 as a template and the KASP primer set from Example 3 as amplification primers, a PCR amplification reaction was performed. The PCR reaction system is shown in Table 2.
[0127] Table 2 PCR reaction system
[0128]
[0129] The PCR reaction conditions are as follows:
[0130] First round: 94℃ for 15 minutes; 94℃ for 20 seconds, 61-55℃ for 60 seconds, 10 Touch Down cycles (each cycle decreases by 0.6℃); 94℃ for 20 seconds, 55℃ for 60 seconds, 26 cycles.
[0131] 3. Fluorescence signal and genotyping
[0132] PCR amplification products were detected using a fluorescence microplate reader on a platform capable of detecting FAM and VIC fluorescence wavelengths. The detection data were then read using SNP viewer 2.0 software developed by LGC, and SNP genotyping was performed based on the fluorescence signal ratio. The detection results are shown in Table 1. Table 3 shows that when the genotypes of SNP loci 1–6 in the sample were tested, if the genotype of SNP loci 1 was GG, the genotype of SNP loci 2 was AA, the genotype of SNP loci 3 was CC, the genotype of SNP loci 4 was AA, the genotype of SNP loci 5 was AA, and the genotype of SNP loci 6 was AA, the sample was identified as a “Yufen No. 1” H-strain laying hen.
[0133] Table 3 shows the genotyping of 254 samples from 7 chicken breeds using KASP primer sets.
[0134]
[0135] As shown above, both the PCR primer set and the KASP primer set can be used for SNP genotyping, thus enabling accurate identification of the "Yufen No. 1" laying hen H strain germplasm resources. The main difference between the two primer sets lies in the different detection principles and methods. In practical implementation, the appropriate primer set can be selected based on the experimental environment, cost, and other factors.
[0136] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any modifications or substitutions made within the scope of the claims of the present invention shall be considered equivalent to the embodiments and shall fall within the protection scope of the technical solution of the present invention.
Claims
1. A combination of SNP molecular markers for identifying the H strain of "Yufen No. 1" laying hens, characterized in that: The SNP molecular marker combination consists of SNP molecular markers 1 to 6. composition: The SNP molecular marker 1 is located at position 45509616 on the chicken Chr2 chromosome, as shown in the nucleotide sequence of SEQ ID NO: 1, starting from the 183rd base from the 5' end, and the genotype is A or G. The SNP molecular marker 2 is located at position 45510792 on the chicken Chr2 chromosome, as shown in the nucleotide sequence of SEQ ID NO: 2, starting from the 212th base from the 5' end, and the genotype is A or G. The SNP molecular marker 3 is located at position 13723265 on the chicken Chr9 chromosome, as shown in the nucleotide sequence of SEQ ID NO: 3, starting from the 137th base from the 5' end, and the genotype is C or T. The SNP molecular marker 4 is located at position 13745245 on the chicken Chr9 chromosome, as shown in the nucleotide sequence of SEQ ID NO: 4, starting from the 225th base from the 5' end, and the genotype is A or G. The SNP molecular marker 5 is located at position 13795646 on the chicken Chr9 chromosome, as shown in the nucleotide sequence of SEQ ID NO: 5, starting from the 110th base from the 5' end, and the genotype is A or G. The SNP molecular marker 6 is located at position 13798154 on the chicken Chr9 chromosome, as shown in SEQ ID NO: 6, at the 99th base from the 5' end of the nucleotide sequence, and the genotype is A or G.
2. The application of the SNP molecular marker combination as described in claim 1 in identifying the H strain population of "Yufen No. 1" laying hens.
3. The application of the SNP molecular marker combination according to claim 2 in identifying the "Yufen No. 1" laying hen H strain population, characterized in that: The genotypes of SNP molecular markers 1-6 in the sample to be tested were detected. When the genotype of SNP molecular marker 1 was GG, the genotype of SNP molecular marker 2 was AA, the genotype of SNP molecular marker 3 was CC, the genotype of SNP molecular marker 4 was AA, the genotype of SNP molecular marker 5 was AA, and the genotype of SNP molecular marker 6 was AA, the sample to be tested was the "Yufen No. 1" H strain laying hen.
4. A PCR primer set for detecting the genotype of the H-strain SNP molecular marker combination of "Yufen No. 1" laying hens as described in claim 1, characterized in that: The PCR primer set includes the first primer pair to the sixth primer pair corresponding to the detection of the SNP molecular markers 1 to 6; the nucleotide sequences of the first primer pair to the sixth primer pair are shown in SEQ ID NO. 7-18.
5. A KASP primer set for detecting the genotype of the H-strain SNP molecular marker combination of "Yufen No. 1" laying hens as described in claim 1, characterized in that: The KASP primer set includes the seventh to twelfth primer pairs corresponding to the detection of SNP molecular markers 1 to 6; the nucleotide sequences of the seventh to twelfth primer pairs are shown in SEQ ID NO. 19-36.
6. A kit for detecting the genotype of the H-strain SNP molecular marker combination of "Yufen No. 1" laying hens as described in claim 1, characterized in that: The kit contains either a PCR primer set with nucleotide sequences as shown in SEQ ID NO. 7-18 or a KASP primer set with nucleotide sequences as shown in SEQ ID NO. 19-36.
7. The kit for identifying the genotype of the H-strain SNP molecular marker combination of "Yufen No. 1" laying hens according to claim 6, characterized in that: When the kit contains a PCR primer set with nucleotide sequences as shown in SEQ ID NO. 7-18, the kit also includes a PCR reaction buffer, DNA polymerase, and dNTPs; when the kit contains a KASP primer set with nucleotide sequences as shown in SEQ ID NO. 19-36, the kit also includes a KASP reaction buffer, DNA polymerase, and dNTPs.
8. The application of a PCR primer set as described in claim 4, or a KASP primer set as described in claim 5, or a kit as described in any one of claims 6-7 in identifying the H strain population of "Yufen No. 1" laying hens.
9. A method for identifying the H strain of "Yufen No. 1" laying hens, characterized in that: The genotype of the SNP molecular marker combination described in claim 1 is detected in the test sample. When the genotype of SNP molecular marker 1 is GG, the genotype of SNP molecular marker 2 is AA, the genotype of SNP molecular marker 3 is CC, the genotype of SNP molecular marker 4 is AA, the genotype of SNP molecular marker 5 is AA, and the genotype of SNP molecular marker 6 is AA, the test sample is "Yufen No. 1" H strain laying hen.
10. The method for identifying the H strain of "Yufen No. 1" laying hens according to claim 9, characterized in that: The genotype detection method is any of the following: (1) Using the extracted DNA of the sample to be tested as a template, PCR amplification reaction is performed using the PCR primer set described in claim 4, and the PCR product is subjected to Sanger sequencing. Genotyping is performed based on the sequencing. (2) Using the extracted DNA of the sample to be tested as a template, PCR amplification reaction is performed using the KASP primer set described in claim 5, and fluorescence signals are obtained for typing.