DNA coding method, system, device and storage medium based on waveform feature storage

Abstract

The application relates to a DNA coding method and system based on waveform feature storage, which comprises the following steps: converting image information and audio information into waveform signals; segmenting the waveform signals converted from the audio information; performing Fourier transform on the segmented waveform signals converted from the audio information and the waveform signals converted from the image information to obtain frequency domain information; and converting the obtained frequency domain information into a final base sequence to store DNA information. The application can fundamentally solve the problem of silicon-based storage resource shortage without coding based on a silicon-based system.

Description

Technical Field

[0001] This invention relates to the field of data storage technology, and specifically to a DNA encoding method, system, device, and storage medium based on waveform feature storage. Background Technology

[0002] The development of the Internet has led to an explosive growth in information in human society; however, existing storage media are being exhausted.

[0003] DNA information storage, as a new type of storage medium, emerged to resolve the contradiction between the explosive growth of information and the decreasing availability of silicon-based storage.

[0004] However, most of the methods developed for storing DNA information are based on existing silicon-based computer storage systems, which cannot fundamentally solve the problem of storage resource shortage in practical applications.

[0005] In other words, existing technologies have not broken away from the existing silicon-based storage system, and their approach has not deviated from silicon-based computers, thus failing to fundamentally solve the problem of storage resource shortage. Summary of the Invention

[0006] In view of this, it is necessary to provide a DNA encoding method, system, device and storage medium based on waveform feature storage, which can start from the most original physical form of information transmission, and not use the products of silicon-based computer processing as the information source, thus truly achieving the replacement of silicon-based storage media.

[0007] This invention provides a DNA encoding method based on waveform feature storage, which includes the following steps: a. converting image information and audio information into waveform signals; b. segmenting the waveform signals converted from audio information; c. performing Fourier transform on the segmented waveform signals converted from audio information and the waveform signals converted from image information to obtain frequency domain information; d. converting the obtained frequency domain information into the final base sequence for DNA information storage.

[0008] Specifically, step a includes:

[0009] For image information: Divide the image information to be stored into several equal small regions, and customize the original region size according to the image size; analyze each region to obtain the spectrum, or use instruments to obtain the waveform;

[0010] For audio information: Use a sound wave collector to collect vibration waveforms.

[0011] Specifically, step b includes:

[0012] The acoustic signal is divided into several short segments by sliding window segmentation.

[0013] Specifically, step c includes:

[0014] For audio information:

[0015] Perform an independent Fourier transform on the information within each window, and then record the transformed frequency domain information in the following format: [(f1,r1),(f2,r2),…,(f m ,r m ]], where f is the frequency and r is the amplitude;

[0016] Image information can be categorized into two cases:

[0017] (1) The collected waveform signal is a spectrum. The first m wavelengths with higher signal intensity are selected. Where m is a user-defined value. The larger the value, the closer it is to the original signal, the higher the accuracy, and the more information needs to be stored, and the larger the storage space occupied.

[0018] Then, the selected wavelengths are converted into frequency signals sequentially using Formula 1; finally, each wavelength record (f, r) is obtained.

[0019] By selecting each region to record several sets of wavelength information, the final image information is obtained as a list of all selected wavelength information.

[0020] Formula 1:

[0021] f = v / λ#1

[0022] Where f is the frequency, v is the speed of light, and λ is the wavelength;

[0023] (2) The collected signal is the original waveform signal. The waveform signal is subjected to Fourier transform, which is the same as the processing mode in each window of the audio. The final result is (f,r).

[0024] Several sets of frequency information are selected and recorded in each region, and the final image signal is a list of all selected wavelengths.

[0025] Specifically, step d includes:

[0026] Convert the result obtained in step c into a quaternary number, corresponding to the four bases in DNA: A / T / C / G, to obtain the DNA sequence that stores the information.

[0027] This invention also provides a DNA encoding system based on waveform feature storage. The system includes: a conversion module, a segmentation module, a transformation module, and a storage module. The conversion module converts image information and audio information into waveform signals; the segmentation module segments the waveform signal converted from the audio information; the transformation module performs Fourier transform on the segmented waveform signals converted from the audio information and the waveform signals converted from the image information to obtain frequency domain information; and the storage module converts the obtained frequency domain information into a final base sequence for DNA information storage.

[0028] Specifically, the conversion module is used for:

[0029] For image information: Divide the image information to be stored into several equal small regions, and customize the original region size according to the image size; analyze each region to obtain the spectrum, or use instruments to obtain the waveform;

[0030] For audio information: Use a sound wave collector to collect vibration waveforms.

[0031] Specifically, the segmentation module is used for:

[0032] The acoustic signal is divided into several short segments by sliding window segmentation.

[0033] Specifically, the transformation module is used for:

[0034] For audio information:

[0035] Perform an independent Fourier transform on the information within each window, and then record the transformed frequency domain information in the following format: [(f1,r1),(f2,r2),…,(f m ,r m ]], where f is the frequency and r is the amplitude;

[0036] Image information can be categorized into two cases:

[0037] (1) The collected waveform signal is a spectrum. The first m wavelengths with higher signal intensity are selected. Where m is a user-defined value. The larger the value, the closer it is to the original signal, the higher the accuracy, and the more information needs to be stored, and the larger the storage space occupied.

[0038] Then, the selected wavelengths are converted into frequency signals sequentially using Formula 1; finally, each wavelength record (f, r) is obtained.

[0039] By selecting each region to record several sets of wavelength information, the final image information is obtained as a list of all selected wavelength information.

[0040] Formula 1:

[0041] f=v / λ#1

[0042] Where f is the frequency, v is the speed of light, and λ is the wavelength;

[0043] (2) The collected signal is the original waveform signal. The waveform signal is subjected to Fourier transform, which is the same as the processing mode in each window of the audio. The final result is (f,r).

[0044] Several sets of frequency information are selected and recorded in each region, and the final image signal is a list of all selected wavelengths.

[0045] Specifically, the storage module is used for:

[0046] The result obtained from the transformation module is converted into a quaternary number, corresponding to the four bases in DNA: A / T / C / G, to obtain the DNA sequence that stores the information.

[0047] This application starts from the most primitive physical form of information transmission, and does not use the products of silicon-based computer processing as the information source, thus truly achieving a replacement for silicon-based storage media. It eliminates the need for encoding based on silicon-based systems, fundamentally and effectively solving the problem of silicon-based storage resource shortages. Simultaneously, this application can be used for lossy compression, increasing encoding density. Attached Figure Description

[0048] Figure 1 This is a flowchart of the DNA encoding method based on waveform feature storage, as described in an embodiment of this application.

[0049] Figure 2 This is a schematic diagram of the processing procedure of the DNA encoding method based on waveform feature storage in an embodiment of this application;

[0050] Figure 3 This is a schematic diagram of image region division provided in an embodiment of this application;

[0051] Figure 4 This is a schematic diagram illustrating the segmentation of an image using a custom fixed-size graphic, as provided in an embodiment of this application.

[0052] Figure 5 This is a schematic diagram of an audio signal sliding window provided in an embodiment of this application;

[0053] Figure 6 A schematic diagram of the monochromator spectrum provided in the embodiments of this application;

[0054] Figure 7 This is a schematic diagram of the structure of the DNA coding system based on waveform feature storage according to an embodiment of this application;

[0055] Figure 8This is a graphical text illustration provided for an embodiment of this application;

[0056] Figure 9 This is a schematic diagram illustrating a portion of the results of collecting the spectrum of reflected light from each pixel using a monochromator and converting the wavelength into frequency, as provided in an embodiment of this application.

[0057] Figure 10 This is a schematic diagram illustrating the simplification of results to obtain partial results, as provided in an embodiment of this application.

[0058] Figure 11 A schematic diagram illustrating the conversion of numbers to quaternary numbers, provided for an embodiment of this application;

[0059] Figure 12 This is a schematic diagram illustrating how to obtain a quaternary number string by padding numbers according to an embodiment of this application.

[0060] Figure 13 This is a schematic diagram illustrating the selection of a set of mapping relationships to obtain a DNA sequence, as provided in the embodiments of this application.

[0061] Figure 14 A schematic diagram illustrating audio segmentation into windows as provided in an embodiment of this application;

[0062] Figure 15 A schematic diagram illustrating the Fourier transform of each window as provided in an embodiment of this application;

[0063] Figure 16 A schematic diagram illustrating the selection of the three strongest signals in each window, provided for an embodiment of this application;

[0064] Figure 17 This is a schematic diagram of the device structure according to an embodiment of this application;

[0065] Figure 18 This is a schematic diagram of the structure of the storage medium according to an embodiment of this application. Detailed Implementation

[0066] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below, but should not be construed as limiting the scope of the present invention.

[0067] It should be understood that, when used in this specification and the appended claims, the term "comprising" indicates the presence of the described features, integrals, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or collections thereof.

[0068] It should also be understood that the term “and / or” as used in this application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0069] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.

[0070] References to "one embodiment" or "some embodiments" in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized. Some specific embodiments of the present invention are described below with reference to the accompanying drawings.

[0071] Example 1

[0072] See Figure 1 , Figure 2 The diagram shown is a flowchart of a preferred embodiment of the DNA encoding method based on waveform feature storage of the present invention.

[0073] Step S1 involves converting the image and audio information into waveform signals. Specifically:

[0074] The information we encounter daily mainly includes three categories: text information, image information, and audio information. Text is a specialized form of image with fixed meaning in human society. Therefore, in essence, text information can be combined with image information, and we only need to store image information and audio information.

[0075] Image information:

[0076] Everything we see in daily life originates from the reflection of light, which belongs to the visible light band of the electromagnetic spectrum, with wavelengths between 400nm and 780nm. Therefore, the image information to be stored is divided into several equal small regions, with the original region size customized according to the image size. This can be done in two ways:

[0077] (1) Divide the image information into several regions of equal length, such as squares, rectangles, triangles, etc. Taking a square region as an example, the original side length is l0, and the side length is gradually reduced by Δl each time until each region reflects only one color of light, such as... Figure 3 As shown;

[0078] (2) Define a minimum region of fixed length similar to a pixel definition, such as Figure 4 As shown.

[0079] Then, instruments such as spectrometers and monochromators are used to analyze each region to obtain the spectrum, or to obtain waveforms (similar to oscilloscopes) using instruments.

[0080] Audio information:

[0081] Sound waves are mechanical waves, generated by the vibration of objects. Sound wave collectors are used to collect the vibration waveforms.

[0082] Step S2 involves segmenting the waveform signal converted from the audio information. Specifically:

[0083] This study focuses on sound wave signals for audio information. Because sound wave signals exhibit significant waveform variations and their periodicity is difficult to observe, a sliding window segmentation method is used to divide the sound wave signal into several short signal segments to reduce the complexity of subsequent calculations and processing. The horizontal axis of the sound wave signal represents time, and the window length is n seconds (the horizontal axis of the sound wave signal represents time, such as...). Figure 5 As shown in the figure, the step size is also n seconds. The short signal within the window reduces the complexity of the signal, thus making it more conducive to periodic observation, and also resulting in higher computational accuracy.

[0084] Step S3 involves performing Fourier transforms on the waveform signals converted from the segmented audio information and the waveform signals converted from the image information to obtain frequency domain information. Specifically:

[0085] Audio information:

[0086] For audio information, the information within each window is independently subjected to a Fourier transform. The transformed frequency domain information is then recorded in the following format: [(f1,r1),(f2,r2),…,(f... m ,r m [), where f is the frequency and r is the amplitude. Within the window, select the signal peak to record based on the actual situation.

[0087] Image information:

[0088] Image information can be divided into two cases:

[0089] (1) The collected waveform signal is a spectrum. For example... Figure 6The image shown is the output image of the monochromator spectrum. The first m wavelengths with the highest signal intensity are selected; where m is a user-defined value, the larger the value, the closer it is to the original signal, the higher the accuracy, but the more information needs to be stored, and the larger the storage space occupied.

[0090] Then, the selected wavelengths are converted into frequency signals sequentially using Formula 1; finally, each wavelength record (f, r) is obtained.

[0091] Based on the actual situation, several sets of wavelength information are recorded in each region, and the final image information is a list of all selected wavelength information.

[0092] Formula 1:

[0093] f=v / λ#1

[0094] Where f is the frequency, v is the speed of light, and λ is the wavelength.

[0095] (2) The collected signal is the original waveform signal. The waveform signal is subjected to Fourier transform, which is the same as the processing mode in each window of the audio, and will not be repeated here. The final result is (f,r).

[0096] Based on the actual situation, select and record several sets of frequency information in each area to finally obtain a list of all selected wavelength information for the entire image signal.

[0097] Step S4 involves converting the obtained frequency domain information into a final base sequence for DNA information storage. Specifically:

[0098] The result obtained in step S3 is converted into a quaternary number, corresponding to the four bases in DNA: A / T / C / G, to obtain the DNA sequence that stores the information.

[0099] For example, assuming the list obtained in step S3 is [(13,45),(22,11)], the quaternary result is [(31,231),(112,11)]. To simplify the decoding process from DNA to raw information, using the number of digits of the largest number in the quaternary list as the base length j, padding all numbers with insufficient digits with zeros and merging them into a single sequence, the list is converted to [031231112023]. Then, a fixed encoding table is selected from Table 1, such as {0:A,1:C,2:G,3:T}, and the final DNA sequence is ATCGTCCCGAGT.

[0100] Table 1

[0101]

[0102] Example 2

[0103] See Figure 7 The diagram shown is a hardware architecture diagram of the DNA coding system 10 based on waveform feature storage according to the present invention. The system includes: a conversion module 101, a segmentation module 102, a transformation module 103, and a storage module 104. Wherein:

[0104] The conversion module 101 is used to convert image information and audio information into waveform signals.

[0105] Specifically:

[0106] The information we encounter daily mainly includes three categories: text information, image information, and audio information. Text is a specialized form of image with fixed meaning in human society. Therefore, in essence, text information can be combined with image information, and we only need to store image information and audio information.

[0107] Image information:

[0108] Everything we see in daily life originates from the reflection of light, which belongs to the visible light band of the electromagnetic spectrum, with wavelengths between 400nm and 780nm. Therefore, the conversion module 101 divides the image information to be stored into several equal small regions, customizing the original region size according to the image size, including two methods:

[0109] (1) Divide the image information into several regions of equal length, such as squares, rectangles, triangles, etc. Taking a square region as an example, the original side length is l0, and the side length is gradually reduced by Δl each time until each region reflects only one color of light, such as... Figure 3 As shown;

[0110] (2) Define a minimum region of fixed length similar to a pixel definition, such as Figure 4 As shown.

[0111] Then, instruments such as spectrometers and monochromators are used to analyze each region to obtain the spectrum, or instruments are used to obtain waveforms (similar to oscilloscopes).

[0112] Audio information:

[0113] Sound waves are mechanical waves generated by the vibration of objects. The conversion module 101 uses a sound wave collector to collect the vibration waveform.

[0114] The segmentation module 102 is used to segment the waveform signal converted from audio information. Specifically:

[0115] This study focuses on sound wave signals for audio information. Because sound wave signals exhibit significant waveform variations and their periodicity is difficult to observe, a sliding window segmentation method is used to divide the sound wave signal into several short signal segments to reduce the complexity of subsequent calculations and processing. The horizontal axis of the sound wave signal represents time, and the window length is n seconds (the horizontal axis of the sound wave signal represents time, such as...). Figure 5 As shown in the figure, the step size is also n seconds. The short signal within the window reduces the complexity of the signal, thus making it more conducive to periodic observation, and also resulting in higher computational accuracy.

[0116] The transformation module 103 is used to perform Fourier transform on the waveform signals converted from segmented audio information and image information to obtain frequency domain information. Specifically:

[0117] Audio information:

[0118] For audio information, the information within each window is independently subjected to a Fourier transform. The transformed frequency domain information is then recorded in the following format: [(f1,r1),(f2,r2),…,(f... m ,r m [), where f is the frequency and r is the amplitude. Within the window, select the signal peak to record based on the actual situation.

[0119] Image information:

[0120] Image information can be divided into two cases:

[0121] (1) The collected waveform signal is a spectrum. For example... Figure 6 The image shown is the output image of the monochromator spectrum. The first m wavelengths with the highest signal intensity are selected; where m is a user-defined value, the larger the value, the closer it is to the original signal, the higher the accuracy, but the more information needs to be stored, and the larger the storage space occupied.

[0122] Then, the selected wavelengths are converted into frequency signals sequentially using Formula 1; finally, each wavelength record (f, r) is obtained.

[0123] Based on the actual situation, several sets of wavelength information are recorded in each region, and the final image information is a list of all selected wavelength information.

[0124] Formula 1:

[0125] f=v / λ#1

[0126] Where f is the frequency, v is the speed of light, and λ is the wavelength.

[0127] (2) The collected signal is the original waveform signal. The waveform signal is subjected to Fourier transform, which is the same as the processing mode in each window of the audio, and will not be repeated here. The final result is (f,r).

[0128] Based on the actual situation, select and record several sets of frequency information in each area to finally obtain a list of all selected wavelength information for the entire image signal.

[0129] The storage module 104 is used to convert the obtained frequency domain information into a final base sequence for DNA information storage. Specifically:

[0130] The storage module 104 converts the result obtained by the transformation module 103 into a quaternary number, corresponding to the four bases in DNA: A / T / C / G, to obtain a DNA sequence that stores information.

[0131] For example, assuming the list obtained in transformation module 103 is [(13,45),(22,11)], the quaternary result is [(31,231),(112,11)]. To simplify the decoding process from DNA to raw information, using the number of digits of the largest number in the quaternary list as the base length j, zeros are padded to all numbers with insufficient digits and merged into a single sequence, thus converting the list to [031231112023]. Subsequently, a fixed encoding table is selected from Table 1, such as {0:A,1:C,2:G,3:T}, and the final DNA sequence is ATCGTCCCGAGT.

[0132] Table 1

[0133]

[0134]

[0135] Example 3

[0136] (1) This embodiment uses Figure 8 Taking the image information as an example, since there are many generated results, only a portion are shown:

[0137] Divide the text in the image below into 1-pixel regions, ensuring that each region has a unique color.

[0138] Next, the spectrum of reflected light from each pixel is collected using a monochromator, and the wavelength is converted into frequency using Equation 1, yielding a result similar to... Figure 9 As shown, the result is partial. Each pixel has two elements: the first value represents the amplitude, and the second value represents the frequency.

[0139] In this embodiment, the number of bits is relatively close, so the result can be simplified by dividing the amplitude portion by 5*10.-10 Frequency part divided by 10 14 Partial results were obtained, such as Figure 10 As shown.

[0140] Convert numbers to quaternion, such as Figure 11 As shown.

[0141] Then, the numbers are padded to ensure that each number has the same number of digits, resulting in a quaternary number string, such as... Figure 12 As shown.

[0142] Select a mapping relationship from Table 1, such as {0:A,1:C,2:G,3:T}, to obtain the DNA sequence, as shown below. Figure 13 As shown.

[0143] (2) This embodiment takes audio information as an example:

[0144] An audio segment was divided into three windows, and the signal of each window was as follows: Figure 14 As shown;

[0145] Perform a Fourier transform on each window to convert it to the frequency domain; the image is as follows. Figure 15 As shown;

[0146] Based on the results, the three strongest signals in each window (excluding 0Hz) were selected, and the results are as follows: Figure 16 As shown;

[0147] The magnitude was increased by a factor of 100 and converted to a positive integer to facilitate subsequent steps. The resulting list is as follows:

[0148] [(120,100),(50,68),(176,4),(30,100),(180,100),(50,71),(120,200),(50,100),(164,4)]

[0149] Converting to quaternion, we get the following list:

[0150] [1320,1210,302,1010,2303,10,132,1210,2310,1210,302,1013,1320,3020,302,1210,2210,10]

[0151] Using the number with the longest median as the baseline, pad with zeros and merge into a quaternary string: 132012100302101023030010013212102310121003021013132030200302121022100010

[0153] Selecting the base mapping relationship {0:A,1:C,2:G,3:T}, we obtain the base sequence:

[0154] CTGACGCAATAGCACAGTATAACAACTGCGCAGTCACGCAATAGCACTCTGATAGAATAGCGCAGGCAAACA

[0155] Please see Figure 17 This is a schematic diagram of the device structure according to an embodiment of this application. The device 50 includes a processor 51 and a memory 52 coupled to the processor 51.

[0156] The memory 52 stores program instructions for implementing the above-described Internet of Things intrusion detection method.

[0157] The processor 51 is used to execute program instructions stored in the memory 52 to control IoT intrusion detection.

[0158] The processor 51 can also be referred to as a CPU (Central Processing Unit). The processor 51 may be an integrated circuit chip with signal processing capabilities. The processor 51 can also be a general-purpose processor, a digital signal processor (DSP), an application-specific integrated circuit (ASIC), an off-the-shelf programmable gate array (FPGA), or other programmable logic devices, discrete gate or transistor logic devices, or discrete hardware components. A general-purpose processor can be a microprocessor or any conventional processor.

[0159] Please see Figure 18 This is a schematic diagram of the structure of the storage medium according to an embodiment of this application. The storage medium of this embodiment stores a program file 61 capable of implementing all the above methods. This program file 61 can be stored in the storage medium in the form of a software product, including several instructions to cause a computer device (which may be a personal computer, server, or network device, etc.) or processor to execute all or part of the steps of the methods of various embodiments of the present invention. The aforementioned storage medium includes various media capable of storing program code, such as USB flash drives, portable hard drives, read-only memory (ROM), random access memory (RAM), magnetic disks, or optical disks, or devices such as computers, servers, mobile phones, and tablets.

[0160] It is worth noting that the embodiments of this application convert image information into waveform signals, wherein the waveform can be obtained from the spectrum or obtained from photoelectric conversion via electrical signals.

[0161] The relationship between the quaternary numbers and corresponding bases in the embodiments of this application is not fixed.

[0162] In addition, the functional units in the various embodiments of this application can be integrated into one processing unit, or each unit can exist physically separately, or two or more units can be integrated into one unit.

[0163] In the above embodiments, all or part of the implementation can be achieved through software, hardware, firmware, or any combination thereof. When computer program instructions are loaded and executed on a computer, all or part of the steps and methods described in the embodiments of the present invention are generated.

[0164] It is understood that the systems, apparatuses, and methods described in this application can also be implemented in other ways. For example, the apparatus embodiments described above are merely illustrative. For instance, the division of functional units can be re-divided according to actual needs without affecting its ability to satisfy or complete the functions and steps described above. For example, multiple units or components can be combined or integrated into another system, or some features can be ignored or not executed. The units of the above apparatus can be merged or re-divided according to the storage and decoding method, and additional functional units can be added according to actual needs to meet the requirements of the above steps and methods.

[0165] It should be noted that this application introduces Fourier transform to convert the dimensions of the information to be stored, aiming to use fewer bases to represent the original information content, thereby increasing the coding density. In some cases, the information in the dimension after the Fourier transform will increase compared to the original information, and this application can be used for lossy compression. In the transformed dimension, the part with high signal strength is selected for encoding, while the part with low signal strength is discarded. Generally speaking, the discarded part is mostly noise or has little impact on the quality of the original signal; therefore, the result of lossy compression will not result in the loss of information to be stored.

[0166] Although the present invention has been described with reference to the present preferred embodiments, those skilled in the art should understand that the above preferred embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A DNA encoding method based on waveform feature storage, characterized in that, The method includes the following steps: a. Converting image and audio information into waveform signals; b. Segment the waveform signal converted from audio information; c. Perform Fourier transform on the waveform signals converted from the segmented audio information and the waveform signals converted from the image information to obtain frequency domain information; d. The obtained frequency domain information is converted into the final base sequence for DNA information storage; wherein: Step a specifically includes: For image information: Divide the image information to be stored into several equal small regions, and customize the original region size according to the image size; use a spectrum analyzer or monochromator to analyze each region to obtain the spectrum, or use an oscilloscope to obtain the waveform; For audio information: Use a sound wave collector to collect vibration waveforms.

2. The DNA encoding method based on waveform feature storage as described in claim 1, characterized in that, Step b specifically includes: The acoustic signal is divided into several short segments by sliding window segmentation.

3. The DNA encoding method based on waveform feature storage as described in claim 2, characterized in that, Step c specifically includes: For audio information: Perform an independent Fourier transform on the information within each window, and then record the transformed frequency domain information in the following recording pattern: [( f 1, r 1), ( f 2, r 2), … , ( f m , r m )],in, f For frequency, r For amplitude; Image information can be categorized into two cases: (1) The collected waveform signal is a spectrum. The first m wavelengths with higher signal intensity are selected. Where m is a user-defined value. The larger the value, the closer it is to the original signal, the higher the accuracy, and the more information needs to be stored, and the larger the storage space occupied. Then, using Formula 1, the selected wavelengths are sequentially converted into frequency signals; finally, the records for each wavelength are obtained. f, r ); By selecting each region to record several sets of wavelength information, the final image information is obtained as a list of all selected wavelength information. Formula 1: in, f For frequency, v For the speed of light, λ Wavelength; (2) The collected signal is the original waveform signal. The waveform signal is subjected to Fourier transform, and the processing mode is the same as that in each window of the audio. The final result is ( f, r ); Several sets of frequency information are selected and recorded in each region, and the final image signal is a list of all selected wavelengths.

4. The DNA encoding method based on waveform feature storage as described in claim 3, characterized in that, Step d specifically includes: Convert the result obtained in step c into a quaternary number, corresponding to the four bases in DNA: A / T / C / G, to obtain the DNA sequence that stores the information.

5. A DNA coding system based on waveform feature storage, characterized in that, The system includes: a conversion module, a segmentation module, a transformation module, and a storage module, wherein: The conversion module is used to convert image information and audio information into waveform signals; The segmentation module is used to segment the waveform signal converted from audio information; The transformation module is used to perform Fourier transform on the waveform signals converted from segmented audio information and image information to obtain frequency domain information. The storage module is used to convert the obtained frequency domain information into a final base sequence for DNA information storage; wherein: The conversion module is specifically used for: For image information: Divide the image information to be stored into several equal small regions, and customize the original region size according to the image size; analyze each region to obtain the spectrum, or use instruments to obtain the waveform; For audio information: Use a sound wave collector to collect vibration waveforms.

6. The DNA encoding system based on waveform feature storage as described in claim 5, characterized in that, The segmentation module is specifically used for: The acoustic signal is divided into several short segments by sliding window segmentation.

7. The DNA coding system based on waveform feature storage as described in claim 6, characterized in that, The transformation module is specifically used for: For audio information: Perform an independent Fourier transform on the information within each window, and then record the transformed frequency domain information in the following recording pattern: [( f 1, r 1), ( f 2, r 2), … , ( f m , r m )],in, f For frequency, r For amplitude; Image information can be categorized into two cases: (1) The collected waveform signal is a spectrum. The first m wavelengths with higher signal intensity are selected. Where m is a user-defined value. The larger the value, the closer it is to the original signal, the higher the accuracy, and the more information needs to be stored, and the larger the storage space occupied. Then, using Formula 1, the selected wavelengths are sequentially converted into frequency signals; finally, the records for each wavelength are obtained. f, r ); By selecting each region to record several sets of wavelength information, the final image information is obtained as a list of all selected wavelength information. Formula 1: in, f For frequency, v For the speed of light, λ Wavelength; (2) The collected signal is the original waveform signal. The waveform signal is subjected to Fourier transform, and the processing mode is the same as that in each window of the audio. The final result is ( f, r ); Several sets of frequency information are selected and recorded in each region, and the final image signal is a list of all selected wavelengths.

8. The DNA coding system based on waveform feature storage as described in claim 7, characterized in that, The storage module is specifically used for: The result obtained from the transformation module is converted into a quaternary number, corresponding to the four bases in DNA: A / T / C / G, to obtain the DNA sequence that stores the information.

9. A device, characterized in that, The device includes a processor and a memory coupled to the processor, wherein, The memory stores program instructions for implementing the DNA encoding method based on waveform feature storage as described in any one of claims 1-4; The processor is used to execute the program instructions stored in the memory to control IoT intrusion detection.

10. A storage medium, characterized in that, The device stores processor-executable program instructions for performing the DNA encoding method based on waveform feature storage as described in any one of claims 1 to 4.

Images