Application of OsNIGT1 in improving phosphorus or nitrogen uptake and breeding for nutrient stress tolerance

Abstract

The present application belongs to the field of plant genetic engineering. Specifically, the present application relates to a rice OsNIGT1 (Nitrate-Inducible, GARP-Type Transcriptional Repressor 1) gene cloned by reverse genetics approach, and the function of the gene is identified by overexpression technology and gene editing technology; and the application of the gene is also involved. The present application discloses the application of the gene OsNIGT1 in improving phosphorus or nitrogen absorption and breeding in nutrient stress tolerance. The expression of OsNIGT1 is induced by phosphorus deficiency and inhibited by nitrogen deficiency.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering. Specifically, this invention relates to a rice OsNIGT1 (Nitrate-Inducible, GARP-Type Transcriptional Repressor 1) gene cloned via a reverse genetics approach, and identifies the function of the gene through overexpression and gene editing technologies; it also relates to the application of this gene. Background Technology

[0002] Phosphorus (P) and nitrogen (N) are the two most essential mineral elements for plant growth and are also the most widely used components in fertilizers that contribute to environmental pollution. The absorption and utilization of nitrogen and phosphorus by plants are generally interdependent, with changes in the nitrogen-to-phosphorus supply ratio significantly affecting the absorption of both (Luo et al., 2016). Plants have evolved similar regulatory networks, known as P and N starvation responses, to adapt to soil environments with varying phosphorus and nitrogen nutrient contents. Potential pathways include inducing gene expression encoding transporters, recycling internal phosphorus and nitrogen pools, altering root structure, and interactions with soil microorganisms (Bouain et al., 2019; Li et al., 2021). Previous studies have primarily focused on individual P and N signaling pathways (Li et al., 2021; Paz-Ares et al., 2022), with limited research on the mutual regulation of the absorption and utilization of these two nutrients and the key genes involved.

[0003] Recent studies have revealed several genes that regulate phosphorus-phosphorus (PN) interactions in plants. In Arabidopsis thaliana, AtNLA (Nitrogen Limitation Adaptation) encodes an E3 ligase that regulates the protein stability of the NRT1 / PTR family of nitrate transporters (NPF2.13, also known as nitrate transporter [NTR1.7]) and phosphate transporter (PHT1), leading to N-dependent phosphorus accumulation in the aboveground parts of the plant (Kant et al., 2011; Lin et al., 2013; Park et al., 2014; Liu et al., 2017). In rice (Oryza sativa), NLA1 mediates the degradation of phosphate transporters PT2 and PT8 to regulate phosphorus uptake (Yang et al., 2017; Yue et al., 2017; Zhong et al., 2017). The rice gene OsNIGT1 is a nitrate-induced GARP-type transcription factor that binds to 5'-GAATC-3' and 5'-GATATC-3' sequences to regulate the expression of downstream genes (Sawaki et al., 2013). However, its biological function remains unexplored. Furthermore, studies have shown that rice NRT1.1B can interact with SPX4 to promote its degradation under high nitrate conditions, thereby alleviating SPX4's inhibition of the entry of the P signaling regulator PHR2 (Phosphate Starvation Response 2) and the N signaling regulator NLP3 (NIN-like protein 4) into the nucleus (Hu et al., 2019).

[0004] References

[0005] Bouain, N., Krouk, G., Lacombe, B., and Rouached, H. (2019). Getting to the Root of Plant Mineral Nutrition: Combinatorial Nutrient Stresses Reveal Emergent Properties. Trends Plant Sci 24, 542-552.

[0006] Hu, B., Jiang, Z., Wang, W., Qiu, Y., Zhang, Z., Liu, Y., Li, A., Gao, X., Liu, L., Qian, Y., Huang, X., Yu, F., Kang, S., Wang, Y., Xie, J., Cao, S., Zhang, L., Wang, Y., Xie, Q., Kopriva, S., and Chu, C. (2019). Nitrate-NRT1.1B-SPX4 cascade integrates nitrogen and phosphorus signalling networks in plants. Nat Plants 5, 401-413.

[0007] Kant, S., Peng, M., and Rothstein, SJ (2011). Genetic regulation by NLA and microRNA827 for maintaining nitrate-dependent phosphate homeostasis in Arabidopsis. PLOS Genet 7, e1002021.

[0008] Kiba, T., Inaba, J., Kudo, T., Ueda, N., Konishi, M., Mitsuda, N., Takiguchi, Y., Kondou, Y., Yoshizumi, T., Ohme-Takagi, M., Matsui, M., Yano, K., Yanagisawa, S., and Sakakibara, H. (2018). Repression of Nitrogen Starvation Responses by Members of the Arabidopsis GARP-Type Transcription Factor NIGT1 / HRS1 Subfamily. PlantCell 30, 925-945.

[0009] Li, L., Liu, KH, and Sheen, J. (2021). Dynamic Nutrient Signaling Networks in Plants. Annu Rev Cell Dev Biol 37, 341-367.

[0010] Lin, WY, Huang, TK, and Chiou, TJ (2013). Nitrogen limitation adaptation, a target of microRNA827, mediates degradation of plasma membrane-localized phosphate transporters to maintain phosphate homeostasis in Arabidopsis. Plant Cell 25, 4061-4074 (NLA is a target of microRNA827, which mediates the degradation of plasma membrane-localized phosphate transporters to maintain phosphate homeostasis in Arabidopsis. Plant Cell 25, 4061-4074);

[0011] Liu, W., Sun, Q., Wang, K., Du, Q., and Li, WX (2017). Nitrogen Limitation Adaptation (NLA) is involved in source-to-sink remobilization of nitrate by mediating the degradation of NRT1.7 in Arabidopsis. New Phytol 214, 734-744.

[0012] Luo, X., Mazer, SJ, Guo, H., Zhang, N., Weiner, J., and Hu, S. (2016). Nitrogen: phosphorous supply ratio and allometry in five alpine plant species. Ecol Evol 6, 8881-8892.

[0013] Maeda, Y., Konishi, M., Kiba, T., Sakuraba, Y., Sawaki, N., Kurai, T., Ueda, Y., Sakakibara, H., and Yanagisawa, S. (2018). A NIGT1-centred transcriptional cascade regulates nitrate signalling and incorporates phosphorus starvation signals in Arabidopsis. Nat Commun 9, 1376.

[0014] Medici, A., Marshall-Colon, A., Ronzier, E., Szponarski, W., Wang, R., Gojon, A., Crawford, NM, Ruffel, S., Coruzzi, GM, and Krouk, G. (2015). AtNIGT1 / HRS1 integrates nitrate and phosphate signals at the Arabidopsis root tip. NatCommun 6,6274.

[0015] Nagarajan, VK, Satheesh, V., Polling, MD, Raghothama, KG, and Jain, A. (2016). Arabidopsis MYB-Related HHO2 Exerts a Regulatory Influence on a Subset of Root Traits and Genes Governing Phosphate Homeostasis. Plant Cell Physiol 57, 1142-1152 (The regulatory effect of HHO2 of the Arabidopsis MYB family on root traits and phosphate homeostasis. Acta Physiologica Sinica 37(4):344-344).

[0016] Park,BS,Seo,JS,and Chua,NH(2014).NITROGEN LIMITATION ADAPTATION

[0017] recruits PHOSPHATE2 to target the phosphate transporter PT2 fordegradation during the

[0018] Regulation of Arabidopsis phosphate homeostasis. Plant Cell 26, 454-464 (In the regulation of phosphate homeostasis in Arabidopsis, nitrogen-limited adaptation NLA recruits PHOSPHATE2 to target the phosphate transporter PT2 for degradation. Plant Cell 26, 454-464);

[0019] Paz-Ares, J., Puga, MI, Rojas-Triana, M., Martinez-Hevia, I., Diaz, S., Poza-Carrion, C., Minambres, M., and Leyva, A. (2022). Plant adaptation to low phosphorus availability: Core signaling, crosstalks, and applied implications. Mol Plant 15, 104-124.

[0020] Sawaki, N., Tsujimoto, R., Shigyo, M., Konishi, M., Toki, S., Fujiwara, T., and Yanagisawa, S. (2013). A nitrate-inducible GARP family gene encodes an auto-repressible transcriptional repressor in rice. Plant Cell Physiol 54, 506-517.

[0021] Ueda, Y., Kiba, T., and Yanagisawa, S. (2020a). Nitrate-inducible NIGT1 proteins modulate phosphate uptake and starvation signalling via transcriptional regulation of SPX genes. Plant J 102, 448-466.

[0022] Ueda, Y., Nosaki, S., Sakuraba, Y., Miyakawa, T., Kiba, T., Tanokura, M., and Yanagisawa, S. (2020b). NIGT1 family proteins exhibit dual-mode DNA recognition to regulate nutrient response-associated genes in Arabidopsis. PLOS Genet 16, e1009197.

[0023] Wang, X., Wang, HF, Chen, Y., Sun, MM, Wang, Y., and Chen, YF (2020). The Transcription Factor NIGT1.2 Modulates Both Phosphate Uptake and Nitrate Influx during Phosphate Starvation in Arabidopsis and Maize. Plant Cell 32, 3519-3534.

[0024] Yang, J., Wang, L., Mao, C., and Lin, H. (2017). Characterization of the rice NLA family reveals a key role for OsNLA1 in phosphate homeostasis. Rice (NY) 10, 52.

[0025] Yue, W., Ying, Y., Wang, C., Zhao, Y., Dong, C., Whelan, J., and Shou, H. (2017). OsNLA1, a RING-type ubiquitin ligase, maintains phosphate homeostasis in Oryzasativa via degradation of phosphate transporters. Plant J 90, 1040-1051.

[0026] Zhong, S., Mahmood, K., Bi, YM, Rothstein, SJ, and Ranathunge, K. (2017). Altered Expression of OsNLA1 Modulates Pi Accumulation in Rice (Oryza sativa L.) Plants. Front Plant Sci 8, 928. Summary of the Invention

[0027] The technical problem to be solved by the present invention is to provide the application of OsNIGT1 cloned from rice in breeding to improve phosphorus or nitrogen uptake and nutrient stress tolerance in plants.

[0028] To address the aforementioned technical problems, this invention provides a rice gene OsNIGT1 with transcriptional regulatory activity, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0029] As improvements to the aforementioned genes, they also include mutants, alleles, and derivatives generated by adding, substituting, inserting, and deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 1.

[0030] The present invention also provides a protein encoded by the gene OsNIGT1, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0031] As an improvement to the above-mentioned protein, it also includes derivatives generated by adding, substituting, inserting, and deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2.

[0032] This invention also provides the application of the above-mentioned genes in improving phosphorus or nitrogen absorption and in breeding for tolerance to nutrient stress.

[0033] As an improvement to the above application:

[0034] Genetic improvement for crops to enhance nitrogen and phosphorus nutrient absorption and utilization.

[0035] The expression of OsNIIGT1 is induced by phosphorus deficiency and inhibited by nitrogen deficiency.

[0036] Rice was transformed using a plant expression vector containing the aforementioned gene for genetic improvement. Using the nigt1 mutant, the resulting transgenic rice exhibited reduced phosphorus uptake and increased nitrogen uptake, thus enabling the resulting nutrient stress-tolerant breeding material to withstand low-nitrogen environments. Using NIGT1 overexpression material, the resulting transgenic rice exhibited increased phosphorus uptake and reduced nitrogen uptake, thus enabling the resulting nutrient stress-tolerant breeding material to withstand low-phosphorus environments.

[0037] This invention relates to improving phosphorus or nitrogen absorption in rice using this gene product. The specific technical steps to achieve this invention are as follows:

[0038] (1) Gene screening of OsNIIGT1

[0039] RNA was extracted from rice roots under normal culture and nitrogen- or phosphorus-deficient treatments, followed by transcriptome sequencing. Analysis revealed several transcription factors that responded to both nitrogen and phosphorus deficiency. Most genes exhibited similar nitrogen and phosphorus starvation response patterns, with the OsNIGT1 gene being one of two genes showing inconsistent responses. The other gene is not described in this invention.

[0040] (2) OsNIIGT1 is a nitrogen and phosphorus starvation response gene and is located in the cell nucleus.

[0041] The expression level of OsNIIGT1 in roots after phosphorus and nitrogen deficiency treatments was analyzed using RT-qPCR. Wild-type rice HJ2 plants cultured in a nutrient-rich solution for 7 days were transferred to CK, -P, or -N solutions and regrow for 7 days. RNA was extracted from samples, and gene expression was analyzed by RT-qPCR. The results showed that OsNIIGT1 expression was induced by phosphorus deficiency and inhibited by nitrogen deficiency. Furthermore, nigt1 mutants and NIGT1 overexpression materials were constructed through transgenic methods. Root fluorescence observation of the overexpression materials revealed that NIGT-GFP was located in the cell nucleus, indicating that it can function as a transcription factor.

[0042] (3) OsNIIGT1 affects the growth and development of rice.

[0043] HJ2, nigt1 mutants and NIGT1 overexpression (OE) materials cultured in a nutrient-rich solution for 7 days were transferred to CK, LP, or LN conditions and cultured for 21 days. Phenotypic observation and statistical analysis revealed that NIGT1 overexpression inhibited the growth of rice aboveground parts.

[0044] (4) OsNIIGT1 affects nitrogen and phosphorus nutrient homeostasis in rice

[0045] HJ2, nigt1 mutants and NIGT1 overexpression (OE) materials cultured in nutrient-rich solution for 7 days were transferred to CK, LP or LN conditions for 21 days. Nitrogen and phosphorus contents in the roots and shoots of different materials were measured. The results showed that nigt1 mutation inhibited phosphorus absorption while promoting nitrogen absorption, and NIGT1 overexpression increased phosphorus content and decreased nitrogen content in rice. (5) OsNIIGT1 regulates the expression of nitrogen and phosphorus starvation response genes in rice.

[0046] HJ2, nigt1 mutants, and NIGT1 overexpression (OE) materials cultured in nutrient-rich solutions for 7 days were transferred to CK, -P, or -N solutions and cultured for 7 days. Root RNA was extracted for RT-qPCR analysis. The results showed that in the nigt1 mutant, the transcriptional level of NRT2.1 was higher than that of the wild type, while the transcriptional level of PT2 was lower than that of the wild type; conversely, compared with wild-type plants, lower NRT2.1 and higher PT2 transcriptional levels were detected in NIGT1 overexpression plants. Furthermore, compared with wild-type plants, P deficiency-induced SPX1 accumulation was suppressed and N deficiency-induced NLP1 expression was enhanced in the nigt1 mutant; the opposite expression pattern was observed in the NIGT1 overexpression lines.

[0047] The above results indicate that the rice OsNIGT1 gene cloned in this invention has potential application value. This gene can be used to genetically improve crops and enhance their ability to absorb and utilize nitrogen and phosphorus.

[0048] In summary, this invention discovered a novel nitrogen and phosphorus starvation response transcription factor, OsNIGT1, in rice using forward genetics. This gene regulates the absorption and utilization of nitrogen and phosphorus in rice by modulating the expression of downstream nitrogen and phosphorus starvation response genes. Transgenic overexpression of OsNIGT1 significantly increased phosphorus absorption and inhibited nitrogen absorption in rice, while mutants of this gene exhibited inhibition of phosphorus absorption and promotion of nitrogen absorption. Therefore, it has potential application value in the genetic improvement of crops' ability to adapt to different nitrogen and phosphorus nutrient environments. Attached Figure Description

[0049] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0050] Figure 1 Transcriptome analysis showed that the transcriptional level of OsNIGT1 was suppressed by nitrogen deficiency and induced by phosphorus deficiency. *The location of the OsNIGT1 gene is marked.

[0051] Figure 2 To identify OsNIGT1 mutants and transgenic overexpression lines;

[0052] Figure 2 middle:

[0053] A. RT-qPCR validation of changes in NIGT1 expression levels in wild-type HJ2 after 7 days of -N or -P treatment.

[0054] B. Sequencing results of target sites and mutant sequences in nigt1-1 and nigt1-2 mutants generated using CRISPR / Cas9.

[0055] C, OsNIGT1 expression levels in two OsNIGT1 overexpressing transgenic lines. ACTIN1 was used as a control. Wild-type NIGT1 expression was set to 1 under nutrient-adequate conditions.

[0056] D. GFP fluorescence observation in tobacco leaf cells expressing 35S::NIGT1-GFP (top image) and root epidermal cells of 7-day-old transgenic rice seedlings (bottom image). Error bars represent SD (n=3), and different lowercase letters indicate significant differences between groups (ANOVA followed by Tukey's test, P<0.05).

[0057] Figure 3 OsNIGT1 regulates the aboveground growth of rice;

[0058] Figure 3 middle:

[0059] AC represents the growth phenotypes of HJ2, nigt1 mutants, and NIGT1 overexpression (OE) plants cultured under CK (200 μM NaH2PO4 and 1.4 mM NH4NO3), LP (10 μM NaH2PO4), or LN (70 μM NH4NO3) conditions.

[0060] DF represents the plant height statistics of HJ2, nigt1 mutants and nigt1-OE plants cultured under different nutrient conditions. Error bars represent SD (n=10), and asterisks indicate significant differences from the wild-type control (***P<0.001; Student's ttest).

[0061] Figure 4 To determine the P and N concentrations in rice nigt1 mutants and NIGT1 overexpressing plants grown under different N and P conditions.

[0062] Figure 4 middle:

[0063] A, C, and E represent P concentrations. B, D, and F represent N concentrations. Plants cultured in nutrient-rich solutions for 7 days were transferred to CK, LP, or LN solutions and allowed to grow for 21 days. Error bars represent SD (n=4), and asterisks indicate significant differences from the wild-type control (*P<0.05, **P<0.05, and ***P<0.001; Student's t test).

[0064] Figure 5 The expression levels of PT2(A), SPX1(B), NRT2.1(C), and NLP1(D) in HJ2, nigt1 mutants and NIGT1 overexpressing plants cultured under CK, LP, or LN conditions are shown. ACTIN1 was used as a control.

[0065] Figure 6 This is a schematic diagram of the carrier structure used in this invention.

[0066] Figure 6 middle:

[0067] A. Schematic diagram of the vector used to construct overexpression materials. B. Schematic diagram of the sgRNA vector used to construct mutant materials. C. Schematic diagram of the final vector used to construct mutant materials. Detailed Implementation

[0068] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0069] Example 1: This invention analyzes previous transcriptome data; Venn diagram analysis of differentially expressed genes under phosphorus and nitrogen deficiency treatments reveals genes that respond simultaneously to both. Comparison with a transcription factor database (http: / / planttfdb.gao-lab.org / ) yields 34 transcription factors that respond simultaneously to both phosphorus and nitrogen deficiency. Heatmap analysis shows that NIGT1 transcription levels are downregulated after nitrogen deficiency treatment and upregulated after phosphorus deficiency treatment; for example... Figure 1 .

[0070] Example 2: OsNIGT1 is a nitrogen and phosphorus starvation response gene.

[0071] To clarify that OsNIGT1 is a nitrogen and phosphorus starvation response gene, gene expression analysis was performed under different culture conditions. Seedlings grown for 7 days under normal conditions (200 μM NaH2PO4 and approximately 1.4 mM NH4NO3) were then transferred to normal conditions, phosphorus starvation (-P, no KH2PO4), or nitrogen starvation (-N, no NH4NO3) conditions for 7 days. Culture conditions were 30 / 22℃ (day / night), 60-70% humidity, and 300 μmol / L NH4NO3. –2 s –1Light intensity on the left and right, illumination time 14 / 10h (day / night).

[0072] The culture medium under normal conditions (CK) is as follows:

[0073]

[0074]

[0075] The culture medium for LP is: replace the NaH2PO4 under normal conditions with 10μM, and keep everything else the same;

[0076] -P's culture medium is: without NaH2PO4, all other conditions remain unchanged;

[0077] The culture medium for LN is: replace the NH4NO3 under normal conditions with 70 μM, and keep everything else the same;

[0078] The culture medium for -N is: without NH4NO3, and all other conditions remain unchanged.

[0079] RNA was extracted and then reverse transcribed to obtain cDNA. Quantitative analysis revealed that OsNIGT1 expression in roots was significantly induced by phosphorus deficiency and inhibited by nitrogen deficiency. The specific process is as follows:

[0080] (1) RNA extraction:

[0081] Total RNA was extracted using the MACHEREY-NAGEL NucleoSpin RNA Plant Extraction Kit, following these steps: 1. A mortar and pestle were baked at 180°C for 2 hours to remove RNase; 2. 50-100 mg of rice root was flash-frozen in liquid nitrogen; 3. The sample was thoroughly ground while frozen; 4. Lysis buffer was added to fully lyse the cells; 5. Tissue debris was removed by filtration; 6. RNA was purified from the chromatography column (protein removal, DNA removal, and desalting); 7. RNA was obtained by elution with RNase-free H2O. Refer to the kit's instruction manual for detailed procedures.

[0082] (2) Reverse transcription:

[0083] cDNA synthesis was performed using the Promega Reverse Transcription System (A3500). The total RNA volume in the reverse transcription system was 1 μg. Real-time PCR was performed using SYBR Green I chimeric fluorescence assay reagents (purchased from Roche) and a Roche quantitative PCR instrument. 480. Follow the kit instructions for specific procedures.

[0084] (3) RT-qPCR:

[0085] 1) Calculate the amount of Master, template, primer and water required according to the experimental needs, and perform 3 technical replicates for each sample.

[0086] The PCR system was set as follows:

[0087]

[0088]

[0089] The PCR amplification procedure is as follows

[0090]

[0091] Melting curve: 95℃ for 5 seconds

[0092] 65℃ for 1 minute

[0093] Temperature drop: 40℃ in 30 seconds

[0094] The primer information for quantitative expression analysis is as follows:

[0095] ACTIN1-qRTF: CAACACCCCTGCTATGTACG

[0096] ACTIN1-qRTR: CATCACCAGAGTCCAACACAA

[0097] NIGT1-qRTF:AAGATCCAGGTGTTTCCAGCGGGA

[0098] NIGT1-qRTR:ATCTGGCTCCTCATCCCCTCGAT

[0099] 2) Add the mixture of 2×Master and cDNA template to the walls of the quantitative PCR wells. Centrifuge the quantitative PCR plate to allow the sample to settle to the bottom of the wells.

[0100] 3) Add the water, primer and probe mixture to the wall of the quantitative PCR well and centrifuge under the same conditions as above.

[0101] 4) Open the LightCycle480 software, insert the quantitative PCR plate and run the program.

[0102] 5) After the PCR program finishes, enter the "Analysis" interface and click "Abs Quant / 2nd Derivative Max" to analyze sample C. T Value; if it is SYBR GreenⅠ, click "Tm Calling" to analyze the sample melting curve.

[0103] 6) Remove the quantitative PCR plate, save the data, exit the program, turn off the computer, and then turn off the quantitative PCR instrument.

[0104] The obtained PCR results are as follows:

[0105] Normal CT values: ACTIN: 19.91 19.91 19.95, NIGT1: 31.66 31.88 31.86;

[0106] Phosphorus starvation CT values: ACTIN: 19.70 19.72 19.72, NIGT1: 29.43 29.62 29.51;

[0107] Nitrogen starvation CT values: ACTIN: 19.83, 19.84, 20.08; NIGT1: 32.54, 32.52, 32.89.

[0108] Therefore, it can be concluded that OsNIGT1 expression in roots is significantly induced by phosphorus deficiency and inhibited by nitrogen deficiency. Figure 2 A.

[0109] Example 3: Construction of OsNIGT1 overexpression vector

[0110] To clarify the function of OsNIGT1 in regulating nitrogen and phosphorus uptake and utilization, an OsNIGT1 overexpression vector was constructed. Using wild-type HJ2 cDNA as a template, the full-length coding sequence (with stop codons removed) was amplified using OsNIGT1-specific primers, with a target fragment size of 1236 bp (SEQ ID NO: 3). The amplified target fragment was ligated into the modified pCAMBIA (35S-1300-GFP) vector, which had been digested with SmaI and XbaI. After sequencing verification, the prepared plasmid (35S::NIGT1-GFP) was stored at -20℃ and used for transgenic experiments to construct NIGT1-GFP overexpression lines. Primer information is as follows:

[0111] Upstream primer: AGCTCGGTACCCGGGGATCCATGGAGGTGGACCACGCG

[0112] Downstream primer: CTCACCATGTCGACTCTAGAAGCGGAGGTGGTCTGCG

[0113] Example 4: Construction of Osnigt1 mutant vector

[0114] To clarify the function of OsNIGT1 in regulating nitrogen and phosphorus uptake and utilization, an Osnigt1 mutant vector was constructed using the CRISPR / Cas9 system. The specific methods are as follows:

[0115] (1) Target selection:

[0116] In the target region, sequences with an A or G 20th base upstream of NGG (A and G are the transcription initiation bases of the U3 and U6 promoters, respectively) are preferentially selected as target sequences. If not, they can be manually changed to A or G. To improve mutation efficiency, two target sites were designed. Following this method, the target site for OsNIGT1 was selected as the first exon region, with sequences: 5'-GCAAGATCCAGGTGTTCCAG-3' and 5'-GTGACGAGGTCGAAGCAGAG-3'.

[0117] (2) Synthesize the adapter primers:

[0118] Adapter primers were synthesized according to the pYL-U3-gRNA and pYL-U6a-gRNA vectors. The primers are as follows:

[0119] N1GT1 U3 F: GGCAGCAAGATCCAGGTGTTCCAG

[0120] N1GT1 U3 R: AAACCTGGAACACCTGGATCTTGC

[0121] N1GT1 U6a F:GCCGGTGACGAGGTCGAAGCAGAG

[0122] N1GT1 U6a R: AAACCTCTGCTTCGACCTCGTCAC

[0123] The synthesized adapter primers were dissolved to prepare a 100 μM stock solution. 1 μl of each of U3 F / R primers was added to 98 μl of water and diluted to 1 μM. Similarly, 1 μl of each of U6a F / R primers was added to 98 μl of water and diluted to 1 μM. After denaturation at 90 °C for 1 min, the mixture was cooled and annealed at room temperature to obtain two annealed products.

[0124] (3) gRNA expression cassette ligation:

[0125] Take 1 μl of the two annealing products obtained in step (2) and ligate them with the BbsI-digested pYL-U3-gRNA and pYL-U6a-gRNA vectors at room temperature for 1 h. This will yield two ligation products.

[0126] (4) gRNA expression cassette amplification:

[0127] First round of amplification: Take 1 μl of the ligation product obtained in step (3) as a template, and use the UF adapter reverse primer and the adapter forward primer gRNA-R to amplify the first round of product by KOD high-fidelity enzyme PCR (95℃ 10s, 60℃ 15s, 68℃ 20s. 28 cycles). Second round of amplification: Take 1 μl of the first round of PCR reaction product diluted 10 times with water, and use the specific position gRNA expression cassette primers B1' and BL for PCR amplification (95℃ 10s, 58℃ 15s, 68℃ 20s. 25 cycles). Primers are as follows:

[0128] UF:CTCCGTTTTACCTGTGGAATCG

[0129] gRNA-R:CGGAGGAAAATTCCATCCAC

[0130] B1':TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG

[0131] BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC

[0132] The amplification system is as follows:

[0133]

[0134] (5) Final carrier connection:

[0135] The product fragments obtained in step (4) above were separately excised and recovered. Approximately 20-70 ng of each of the two recovered products were mixed in equal amounts. Approximately 60-80 ng of undigested pYLCRISPR / Cas9-MH(B) plasmid was added. The mixture was reacted in 15 μl (1.5 μl of 10x BsaI-endonuclease buffer, 1 μl each of the two fragments and the vector, with enzyme and water added to bring the total to 15 μl). After digestion with 10 U BsaI at 37°C for 10 min, ATP and 35 U T4 DNA ligase were added to a final concentration of 0.5-1.0 mM. The ligation was performed using variable-temperature cycling for approximately 10-15 cycles: 37°C for 2 min; 10°C for 3 min; 20°C for 5 min; and finally 37°C for 2 min.

[0136] (6) Transformation and screening:

[0137] The ligation product was transformed into *E. coli* DH5α using a heat shock method. After plating, the cells were incubated at 37°C for 12 hours. Single clones were picked and cultured in kanamycin medium for approximately 3 hours for PCR identification. The primers used were the M13 sequencing primer (TGTAAAACGACGGCCAGT) and a synthetic adapter primer (U3 R / U6a R). Plasmid DNA was extracted from positive clones and sequenced. The obtained sequence was [logic missing]. After successful sequencing, the prepared plasmid (Osnigt1 mutant vector) was stored at -20°C and used for transgenic experiments to construct the Osnigt1 mutant line.

[0138] Example 5: Transgenic Rice

[0139] The specific process of the Agrobacterium (EHA105)-mediated rice genetic transformation system is as follows:

[0140] (1) Preparation of mature rice embryo callus tissue:

[0141] After the mature rice (HJ2) seeds are dehulled, select plump, smooth, and sterile seeds and place them in a beaker. Sterilize them with 70% alcohol for 2 minutes.

[0142] Discard the alcohol and add 25% (v / v) NaClO solution for disinfection for 30 minutes;

[0143] Pour off the NaClO solution, rinse 5 times with sterile water, and soak in sterile water for 30 minutes for the last rinse.

[0144] Pour off the sterile water, place the seeds on sterile filter paper to absorb the dryness, and place the seeds flat in the mature embryo induction medium of japonica rice. Incubate at 28°C in the dark for 10 days.

[0145] Open the culture dish on the clean bench, remove the buds and endosperm with tweezers, leaving embryogenic callus (pale yellow, dense and irregular), transfer it into the subculture medium of japonica rice, and culture it in the dark at 28°C for 5-10 days.

[0146] (2) Culture of Agrobacterium:

[0147] After transforming Agrobacterium with plasmids 35S::NIGT1-GFP and Osnigt1 obtained in Examples 3 and 4, 100 μl of Agrobacterium single clone culture was picked and placed in 5 ml of YEP (containing 50 mg / L Kan and 50 mg / L Str) culture medium and cultured at 28°C and 250 rpm for 12-36 h until the bacterial culture OD600 was saturated.

[0148] Take 500 μl of the above saturated bacterial culture and add it to 30 ml of YEP culture medium containing 50 mg / L Kan and 50 mg / L Str. Incubate at 28°C with shaking at 250 rpm for 12-16 h until the bacterial OD600 = 0.8-1.5.

[0149] (3) Co-culture and screening of resistant callus:

[0150] Take 15ml of the cultured bacterial solution into a 50ml centrifuge tube, centrifuge at 4℃ and 4000rpm for 10min, and discard the supernatant.

[0151] A suspension was prepared using 30 ml of AAM bacterial culture containing 200 μmol / L As, so that the final concentration of the bacterial culture OD600 was 0.4-0.7.

[0152] Rice callus tissue that has grown to a certain size was picked out, cut into granules, placed in Agrobacterium suspension, and cultured by shaking for 30 minutes.

[0153] Remove the callus tissue and place it on sterile filter paper to drain for 30 minutes;

[0154] The callus tissue was then placed on a co-culture medium containing a layer of filter paper.

[0155] After culturing in the dark at 25°C for 2.5 days, the callus tissue is removed and washed with sterile water 5-6 times, with constant shaking during the process.

[0156] Rinse 1-2 times with sterile water containing 250 mg / L carbenicillin sodium;

[0157] Finally, place it on sterile filter paper and let it drain for 2 hours.

[0158] The dried callus was transferred to a selective medium containing 250 mg / L carbenicillin sodium and 50 mg / L hygromycin for the first round of selection, and cultured in the dark at 28°C for 14 days.

[0159] The grown initial callus was transferred to a selective medium containing 250 mg / L carbenicillin sodium and 50 mg / L hygromycin for a second round of selection. The medium was then cultured in the dark at 28°C for 14 days, at which point resistant callus tissue emerged.

[0160] (4) Differentiation and seedling formation of resistant callus:

[0161] Select 2-3 resistant calluses from the same source and place them on differentiation medium. Incubate at 25°C under light (16h / 8h photocycle, light intensity 2000lx).

[0162] After about 30 days of differentiation culture, the callus tissue will differentiate into seedlings. When the seedlings grow to about 3-5cm, they are transferred to rooting medium and cultured at 25℃ under light (16h / 8h photoperiod, light intensity of 2000lx).

[0163] (5) Hardening-up and transplanting of transgenic seedlings:

[0164] Fourteen days after rooting, select the test tubes with good growth of transgenic seedlings, open the sealing film, add an appropriate amount of distilled water or sterile water, and culture in the culture room for 2-3 days; wash off the agar, transfer to rice nutrient solution for 2 weeks, and after identification, transplant the obtained transgenic positive seedlings into the field or pots.

[0165] (6) Identification of T0 generation transgenic seedlings

[0166] After T0 generation transgenic seedlings were cultured in solution for one week under normal conditions (temperature: 30℃ during the day, 22℃ at night; humidity >60%; light intensity 30000 lx, 16h / 8h photoperiod), genomic DNA was extracted from 1 cm long leaves. Transgenic seedlings were identified using resistance selection marker genes and variations in the genomic sequence to screen for successfully transformed lines. Primer information is as follows:

[0167] HYG-F: CGAGTACTTCTACACAGCCATC

[0168] HYG-R: TAGCGAGAGCCTGACCTATT

[0169] Specifically as follows:

[0170] ① Extraction of genomic DNA (TPS method):

[0171] 1. Place a 2cm leaf in a 2ml centrifuge tube, add 200μl of TPS extraction buffer (100mM Tris-HCl (pH 8.0), 10mM EDTA (pH 8.0), 1M KCl), add a steel ball, tighten the centrifuge tube cap, and shake for 1.5min in a TissueLyser II (QIAGEN, USA) homogenizer.

[0172] 2. Transfer the homogenized tissue to a new 1.5ml centrifuge tube and incubate at 70℃ for 30 minutes.

[0173] 3. Centrifuge at 12000 rpm for 10 min, and transfer the supernatant to another new 1.5 ml centrifuge tube.

[0174] 4. Add an equal volume of isopropanol, mix by inverting the container, centrifuge at 12000 rpm for 10 min, and discard the supernatant.

[0175] 5. Wash the precipitate with 600 μl of 70% ethanol and centrifuge at 12000 rpm for 5 min.

[0176] 6. Discard the ethanol, air dry the DNA, and then dissolve it in 30 μl ddH2O.

[0177] ② Screening of mutant-positive transgenic seedlings

[0178] Wild-type and transgenic seedlings were amplified by PCR using gene-specific primers and then sequenced. Sequence alignment was performed on the sequencing results; sequences not identical to SEQ ID NO:1 of the wild-type seedling were identified as mutant materials. The gene-specific primer information is as follows:

[0179] NIGT1-crispr-F:CGTTCGATTCGACGACACCTTC

[0180] NIGT1-crispr-R: GACGAATGCCTCTCCGACGTCT;

[0181] The obtained results are

[0182] TTTCTTTGTTGTATAAGACGACGACTAGTGGTAACAAAAAGATTCGCTCCCTACGCGAC

[0183] GCCCCGACCCCGATTCCCTTCGCTTCCTACTCCTTCCTCTTCCTTGTTCCTTCCTTCCTTC

[0184] CTCACCCCACGAACGCGCACACCAACCTTTCCCATCCCTAGCTGCTGCCCTTCCATCGG

[0185] ATCCACGGATCGAGACCTGGCACGGCGGCGGAGGACGGGCCGGCGGAGATGGAGGTG

[0186] GACCACGCGGACCGCGACGGCGCGCGGCGCCGGTGCCGCGAGTACCTGCTCGCGCTCG

[0187] AGGAGGAGCTCCCTCTCTTGCTTCGACCTCGTCACCCAGAGTACGCGCGCGCCTCGCTC

[0188] GCCACGCATTCTTCGCTCGATCGCTGCGCGTTCGTGCGCGTGAGTGCTAATTGTGATTG

[0189] TGGTGCAGCTATCGAGGGGATGAGGAGCCAGATGGACGCCGCCGGCAGCGAGGAGAC

[0190] GGTCAGCGACCAGGGCCCGCCGCCGGTGCTCGAGGAGTTCATCCCGCTCAAGCCCAGC

[0191] CTCTCGCTGTCCTCCTCCGAGGAGGAGAGCACCCACGCCGACGCCGCCAAGTCAGGCAAGAAGGAGGAGGCCGAGACGTCGGAGAGCCATTCGTCA and

[0192] TTTTTTCCTTTGTTGTATTAGAAGACGACTAGTGGTAACAAAAAGATTCGCTCCCTACG

[0193] CGACGCCCCGACCCCGATTCCCTTCGCTTCCTACTCCTTCCTCTTCCTTGTTCCTTCCTTC

[0194] CTTCCTCACCCCACGAACGCGCACACCAACCTTTCCCATCCCTAGCTGCTGCCCTTCCA

[0195] TCGGATCCACGGATCGAGACCTGGCACGGCGGCGGAGGACGGGCCGGCGGAGATGGA

[0196] GGTGGACCACGCGGACCGCGACGGCGCGCGGCGCCGGTGCCGCGAGTACCTGCTCGCG

[0197] CTCGAGGAGGAGCGCCGCAAGATCCAGGTGCAGCGGGAGCTCCCTCTCTTGCTTCGAC

[0198] CTCGTCACCCAGAGTACGCGCGCGCCTCGCTCGCCACGCATTCTTCGCTCGATCGCTGC

[0199] GCGTTCGTGCGCGTGAGTGCTAATTGTGATTGTGGTGCAGCTATCGAGGGGATGAGGA

[0200] GCCAGATGGACGCCGCCGGCAGCGAGGAGACGGTCAGCGACCAGGGCCCGCCGCCGG

[0201] TGCTCGAGGAGTTCATCCCGCTCAAGCCCAGCCTCTCGCTGTCCTCCTCCGAGGAGGAG

[0202] AGCACCCACGCCGACGCCGCCAAGTCAGGCAAGAAGGAGGAGGCCGAGACGTCGGAGAGCATTTTGTCAT.

[0203] Select 2 Osnigt1 mutant lines that satisfy the sequence, for example Figure 2 B, and carry out the following step (7).

[0204] ③ RT-qPCR identification of overexpression positive transgenic seedlings:

[0205] RNA was extracted from the overexpression transgenic lines, reverse transcribed, and the relative expression level of OsNIGT1 was detected using RT-qPCR. The specific procedure is described in Example 2.

[0206] Select two OsNIGT1 overexpression sites with expression levels higher than wild-type, such as... Figure 2 C. Perform the following steps (7).

[0207] (7) Phenotypic observation and elemental content determination:

[0208] Wild-type rice seedlings (7 days old), two OsNIGT1 overexpressing lines, and two Osnigt1 mutant lines were cultured for 21 days under CK (200 μM NaH2PO4 and 1.4 mM NH4NO3), LP (10 μM NaH2PO4), or LN (70 μM NH4NO3) conditions (nutrient solution changed weekly, other culture conditions the same as in Example 2). The rice seedlings were photographed and their plant height was recorded. The results are as follows: Figure 3 Fresh root and leaf tissue samples were then weighed and dried in a 65℃ oven for 3 days. Approximately 0.1g of the dried tissue sample was then digested at 300℃ with 98% H₂SO₄ (v / v) and 30% H₂O₂ (v / v) until the color became clear. The volume was then adjusted to 50ml. The nitrogen and phosphorus content was determined using a flow analyzer. The results are as follows: Figure 4 .

[0209] (8) Expression analysis of nitrogen and phosphorus starvation response genes:

[0210] Wild-type rice seedlings aged 7 days, two OsNIGT1 overexpressing lines, and two Osnigt1 mutant lines were cultured for 7 days in CK, -P, or -N solutions, respectively. RNA was extracted from rice roots and identified by RT-qPCR. See Figure 2 for detailed steps. The identification results are shown below. Figure 5 The primers used are as follows:

[0211]

[0212]

[0213] (9) Root fluorescence observation:

[0214] Approximately 1 cm of the root tip from 7-day-old NIGT1-GFP seedlings was placed on a glass slide and observed for fluorescence using a laser confocal microscope. A 25x water-immersed objective lens was used for confocal imaging. The fluorescent protein was excited at 488 nm using an argon-ion laser. Fluorescence was detected in the range of 493–542 nm. Results are as follows: Figure 2 D.

[0215] Based on the above results, it can be concluded that this invention discovered a novel nitrogen and phosphorus starvation response transcription factor, OsNIGT1, in rice using forward genetics. This gene regulates the absorption and utilization of nitrogen and phosphorus in rice by modulating the expression of downstream nitrogen and phosphorus starvation response genes. Transgenic overexpression of OsNIGT1 significantly enhances phosphorus absorption and inhibits nitrogen absorption in rice, while mutants of this gene exhibit inhibition of phosphorus absorption and promotion of nitrogen absorption.

[0216] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. The application of OsNIGT1, a rice gene with transcriptional regulatory activity, characterized by: Transgenic overexpression of OsNIGT1 can enhance phosphorus uptake and inhibit nitrogen uptake in rice, thereby making rice tolerant to low phosphorus environments. Knocking out or mutating the OsNIGT1 gene can reduce phosphorus uptake and promote nitrogen uptake in rice, thereby making rice more tolerant to low-nitrogen environments. The nucleotide sequence is shown in SEQ ID NO: 1; The gene OsNIGT1 can be applied to nutrient stress tolerance breeding of rice.

2. The application according to claim 1, characterized in that: Genetic improvement for enhancing nitrogen and phosphorus nutrient absorption and utilization in rice.

3. The application according to claim 2, characterized in that: OsNIIGT1 The expression of is induced by phosphorus deficiency and inhibited by nitrogen deficiency.

4. The application according to claim 3, characterized in that: Rice was transformed using a plant expression vector containing the gene described above for the genetic improvement of rice.

Images