Shrna for silencing hs3st5 gene expression, recombinant lentivirus vector thereof and application thereof

Abstract

The application provides shRNA for silencing HS3ST5 gene expression, a recombinant lentivirus vector thereof and application, and belongs to the technical field of gene silencing. Two kinds of shRNA for silencing HS3ST5 gene expression are designed, and a recombinant lentivirus plasmid carrying the shRNA is constructed; a recombinant BHK-21 cell line for knocking down HS3ST5 is established by packaging the recombinant lentivirus; and the result shows that the expression level of the knocked-down HS3ST5 can effectively inhibit the proliferation of viruses. It can be seen that the application provides a new idea for resisting virus infection.

Description

Technical Field

[0001] This invention belongs to the field of gene silencing technology, specifically relating to an shRNA that silences the expression of the HS3ST5 gene, its recombinant lentiviral vector, and its applications. Background Technology

[0002] Short hairpin RNA (shRNA) is a small, non-coding RNA molecule capable of forming hairpin structures. shRNA possesses a unique stem-loop structure and is a commonly used method for gene silencing, providing long-term, stable RNA interference without inducing non-specific reactions. shRNA contains a sense strand, loop sequence, antisense strand, and transcription termination signal. When shRNA is linked to an expression vector, it is converted into double-stranded RNA containing small hairpin structures by RNA polymerase. shRNA-mediated RNA interference technology has become a powerful tool in gene editing, with significant application potential in gene therapy, drug development, animal disease models, and agricultural genetics and breeding.

[0003] Because viral infection is more efficient than transfection in delivering nucleic acids, viral vectors have become a highly efficient method for delivering nucleic acids into cells. Commonly used viral vectors include adenovirus vectors, adeno-associated virus vectors, retroviral vectors, and lentiviral vectors. Lentiviral vectors are a type of viral vector modified from human immunodeficiency virus (HIV). They are pseudoviruses, whose virulence genes have been knocked out and replaced by foreign genes. Lentiviral vectors can stably integrate foreign genes into the cell genome under the action of reverse transcriptase, achieving stable expression of the foreign genes. Lentiviral vectors can also be used as a means of delivering shRNA into cells. After transfecting cells with lentiviral plasmids carrying shRNA, recombinant lentiviruses can be packaged. After infecting cells, the recombinant lentiviruses integrate shRNA into the cell genome. Recombinant cells with stable integration of shRNA can be selected through antibiotic pressure selection or fluorescence-activated cell sorting, thereby enabling long-term transcription of shRNA within the cell and producing a stable silencing effect on target genes.

[0004] Silencing host cell protein genes that are beneficial to viral infection using shRNA can be a novel antiviral strategy.

[0005] Heparan sulfate (HS) is widely expressed on the cell surface and extracellular matrix of most animal tissues, existing in the form of heparan sulfate proteoglycan (HSPG). Many pathogens bind to the cell surface via HS, thereby infecting host cells. The heparan sulfate 3-O-sulfate transferase (HS3ST) family of proteins participates in the final step of sulfation modification during HS synthesis and is a key enzyme in HS biosynthesis. The HS3ST family includes seven isoforms, among which HS3ST5 exhibits the strongest biological activity. HS3ST5 and other HS3ST isoforms can control ligand binding, signal transduction, and pathogen infection in various tissues and at different developmental stages within the same tissue, influencing host cell homeostasis and the infection process of pathogens. In recent years, the unique substrate specificity and specific modification sites of HS3ST5 have made it increasingly important in HS biosynthesis and functional studies. HS was demonstrated in 1996 to act as an alternative receptor for foot-and-mouth disease virus (FMDV) to infect cells; however, the effect of HS3ST5 on FMDV replication remains unclear. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide an shRNA that silences the expression of the HS3ST5 gene, which can effectively silence the expression of the HS3ST5 gene and lay the foundation for inhibiting the proliferation of FMDV.

[0007] This invention provides an shRNA for silencing HS3ST5 gene expression, the nucleotide sequence of which is shown in SEQ ID NO:1 and / or SEQ ID NO:3.

[0008] This invention provides a recombinant lentiviral plasmid containing shRNA, wherein the shRNA is the shRNA described above.

[0009] Preferably, the backbone plasmid of the recombinant lentiviral plasmid is the pLKO.1 vector.

[0010] This invention provides a recombinant lentivirus, which is rescued from the recombinant lentivirus plasmid and helper plasmid.

[0011] Preferably, the helper plasmids include psPAX2 helper plasmid and pMD2.G helper plasmid;

[0012] The rescue method involves co-transfecting the recombinant lentiviral plasmid, psPAX2 helper plasmid, and pMD2.G helper plasmid with a transfection reagent.

[0013] The mass ratio of the recombinant lentiviral plasmid, psPAX2 helper plasmid, and pMD2.G helper plasmid is 4:3:1.

[0014] This invention provides the application of the shRNA, the recombinant lentiviral plasmid, or the recombinant lentivirus in reducing HS3ST5 gene expression in cells.

[0015] This invention provides an application of a reagent for knocking down the HS3ST5 gene in cells in the preparation of cells that reduce viral proliferation or in the preparation of drugs for antiviral infection.

[0016] Preferably, the reagent includes one or more of the following: the shRNA, the recombinant lentiviral plasmid, or the recombinant lentivirus;

[0017] The viruses include those that use HS receptors to invade cells.

[0018] The present invention provides an antiviral drug, wherein the shRNA, the recombinant lentiviral vector or the recombinant lentivirus is the active ingredient, and further comprises pharmaceutically acceptable excipients.

[0019] This invention provides a recombinant BHK-21 cell line based on the stable knockdown of the HS3ST5 gene mediated by the aforementioned shRNA. 。

[0020] This invention provides the application of the recombinant BHK-21 cell line in materials resistant to viral infection.

[0021] This invention provides an shRNA for silencing HS3ST5 gene expression, with nucleotide sequences shown in SEQ ID NO:1 and / or SEQ ID NO:3. The shRNA designed in this invention has a good effect on targeting and silencing HS3ST5 gene expression in cells. Experiments show that when the shRNA is packaged into a recombinant lentiviral vector and infected with cells, a recombinant BHK-21 cell line with HS3ST5 gene knockout was successfully established. Compared with the blank control group and the empty vector group, the expression level of HS3ST5 gene or protein in the recombinant BHK-21 cell line was significantly reduced. Using the shRNA protected by this invention to knock out cells, significantly reduced recombinant BHK-21 cell lines (BHK-shHS3ST5-807-2-KD and / or BHK-shHS3ST5-954-47-KD) were obtained. Therefore, the shRNA provided by this invention has a strong function in silencing HS3ST5 gene expression.

[0022] This invention provides an application of a reagent for knocking down the HS3ST5 gene in cells for preparing cells that reduce viral proliferation. The invention uses a virus to knock down HS3ST5 in cells, and assesses progeny virus formation by detecting the number of viral plaques in the cells. The results show that, compared with control cells, the number of plaques in the BHK-21 recombinant cell line with shRNA-807 knockdown of HS3ST5 was reduced by 40%, and the number of plaques in the BHK-21 recombinant cell line with shRNA-954 knockdown of HS3ST5 was reduced by 38%. This invention demonstrates for the first time that BHK-21 recombinant cells with HS3ST5 knockdown significantly inhibit viral infection, providing an effective target for antiviral drugs and offering a new approach to antiviral treatment. Attached Figure Description

[0023] Figure 1 The expression level of HS3ST5 gene in the recombinant BHK-21 cell line with HS3ST5 knockdown was measured. (a) shows the expression level of HS3ST5 protein in the recombinant BHK-21 cell line with HS3ST5 knockdown; (b) shows the expression level of HS3ST5 mRNA in the recombinant BHK-21 cell line with HS3ST5 knockdown. * indicates that the expression level of HS3ST5 gene in the treated group was significantly reduced compared with the NC group (P<0.05).

[0024] Figure 2 To knock down the HS3ST5 gene expression level in monoclonal recombinant BHK-21 cells, (a) the HS3ST5 protein expression level in monoclonal recombinant BHK-21 cells with knocked-down HS3ST5; where * or ** indicates that the HS3ST5 gene expression level in the treatment group cells was significantly reduced compared with the NC group, *P<0.05, **<0.01.

[0025] (b) Knockdown of HS3ST5 mRNA expression in monoclonal recombinant BHK-21 cells;

[0026] Figure 3 The effect of knocking down HS3ST5 with two shRNAs on the generation of FMDV progeny viruses. Detailed Implementation

[0027] This invention provides an shRNA for silencing HS3ST5 gene expression, the nucleotide sequence of which is shown in SEQ ID NO:1 (CCGGGCTCGTGGAGAAGTTCTTAAACTCGAGTTTAAGAACTTCTCCACGAGCTTTTTGC) and / or SEQ ID NO:3 (CCGGGGAGAAGTTCTTAAACCTTCCCTCGAGGGAAGGTTTAAGAACTTCTCCTTTTTG).

[0028] In this invention, the shRNA is designed using the HS3ST5 gene in BHK-21 cells as a template and has a strong function of targeting and silencing the HS3ST5 gene.

[0029] This invention provides a recombinant lentiviral plasmid containing shRNA, wherein the shRNA is the shRNA described in the above-mentioned scheme.

[0030] This invention does not impose any special restrictions on the backbone plasmid of the recombinant lentiviral plasmid; any backbone plasmid well-known in the art can be used. In this embodiment, the backbone plasmid of the recombinant lentiviral plasmid is the pLKO.1 vector.

[0031] In this invention, the preferred method for constructing the recombinant lentiviral plasmid is to anneal the forward and reverse interference sequences of shRNA to form double-stranded sticky-terminal DNA.

[0032] The double-stranded sticky-terminated DNA and pLKO.1 vector were digested with AgeI and EcoRI, and the target fragment was recovered by electrophoresis to obtain the digested DNA fragment and the linearized pLKO.1 vector.

[0033] The enzyme-digested DNA fragments were ligated with the linearized pLKO.1 vector to obtain recombinant lentiviral plasmids.

[0034] In this invention, the forward and reverse interference sequences of shRNA807 are shown in SEQ ID NO:1 and SEQ ID NO:2, and the forward and reverse interference sequences of shRNA954 are shown in SEQ ID NO:3 and SEQ ID NO:4. The annealing conditions are preferably 100°C for 4 minutes followed by natural cooling.

[0035] This invention does not impose any particular limitation on the enzyme digestion and ligation methods; any enzyme digestion and ligation method well-known in the art can be used. After ligation, it is preferable to identify the ligation. The identification method preferably includes enzyme digestion identification and sequencing of enzyme-positive plasmids. The enzyme digestion identification preferably uses AgeI and EcoRI digestion; obtaining a fragment of the target size indicates that the plasmid is enzyme-positive. The sequencing preferably uses sequencing primers; if the sequencing result is consistent with the target sequence, it indicates that the recombinant lentiviral plasmid has been successfully obtained. The nucleotide sequences of the sequencing primers for shRNA807 and shRNA-954 are shown in SEQ ID NO:5.

[0036] This invention provides a recombinant lentivirus, which is rescued from the recombinant lentivirus plasmid and helper plasmid.

[0037] In this invention, the helper plasmids preferably include psPAX2 helper plasmid and pMD2.G helper plasmid. The rescue method involves co-transfecting the recombinant lentiviral plasmid, psPAX2 helper plasmid, and pMD2.G helper plasmid with a transfection reagent. The preferred mass ratio of the recombinant lentiviral plasmid, psPAX2 helper plasmid, and pMD2.G helper plasmid is 4:3:1. This invention does not impose any special restrictions on the type of transfection reagent; any transfection reagent well-known in the art can be used. In this embodiment, Lipofectamine 2000 is used as the transfection reagent. During rescue, the co-transfected cells are preferably HEK-293T cells. After co-transfection, preferably after 6 hours, DMEM complete medium is added, and the cells are incubated at 37°C for another 48 hours. The cell supernatant is then collected, and the viral titer is determined.

[0038] This invention provides a recombinant BHK-21 cell line based on the stable knockdown of the HS3ST5 gene mediated by the aforementioned shRNA. 。

[0039] In this invention, the method for constructing the recombinant BHK-21 cell line preferably involves infecting BHK-21 cells with the recombinant lentivirus, screening with puromycin for one week, and identifying the recombinant BHK-21 cell line. The identification method preferably utilizes Western blotting and RT-qPCR to identify the cell line.

[0040] This invention provides the application of the shRNA, the recombinant lentiviral plasmid, or the recombinant lentivirus in reducing HS3ST5 gene expression in cells.

[0041] In this invention, the method for reducing HS3ST5 gene expression in cells preferably includes the following steps:

[0042] Recombinant viruses were obtained by co-transfecting cells with recombinant lentiviral plasmids containing shRNA and helper plasmids;

[0043] The recombinant virus was used to infect cells, which were then cultured and screened using a culture medium containing puromycin.

[0044] The expression level of HS3ST5 in the screened cells was detected.

[0045] In this invention, the cells preferably comprise the BHK-21 cell line. The culture temperature is preferably 37°C, and the culture time is preferably 6–7 days. The concentration of puromycin is preferably 4 μg / mL.

[0046] In this invention, the method for detecting the expression level of HS3ST5 in the screened cells is preferably performed using real-time quantitative PCR (RT-qPCR) and Western blot hybridization. The primers used for the real-time quantitative PCR detection are preferably SEQ ID NO:6 and SEQ ID NO:7.

[0047] Since knockout cells of the HS3ST5 gene are used to culture viruses, and results show that knockout cells are detrimental to the proliferation of progeny viruses, this invention provides an application of a reagent for knocking down the HS3ST5 gene in cells for preparing cells that reduce viral proliferation. This invention also provides an application of a reagent for knocking down the HS3ST5 gene in cells for preparing drugs against viral infections.

[0048] In this invention, the reagent preferably includes one or more of the following: the shRNA, the recombinant lentiviral plasmid, or the recombinant lentivirus. The virus preferably includes a virus that invades cells using the HS receptor, such as foot-and-mouth disease virus. The cells preferably include the BHK-21 cell line.

[0049] The present invention provides an antiviral drug, wherein the shRNA, the recombinant lentiviral vector or the recombinant lentivirus is the active ingredient, and further comprises pharmaceutically acceptable excipients.

[0050] This invention does not impose any special limitations on the excipients used; any excipients for gene therapy drugs well-known in the art can be used. This invention also does not impose any special limitations on the preparation method of the drug; any preparation method for gene therapy drugs well-known in the art can be used.

[0051] This invention provides the application of the recombinant BHK-21 cell line in materials resistant to viral infection.

[0052] The following detailed description, in conjunction with embodiments, illustrates an shRNA for silencing HS3ST5 gene expression, its recombinant lentiviral vector, and its applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0053] Example 1

[0054] A method for constructing a recombinant lentiviral vector that silences HS3ST5 gene expression

[0055] 1. Materials

[0056] 1.1 Cells and Plasmids

[0057] BHK-21 and HEK-293T cells were obtained from the China Center for Type Culture Collection, and pMD2.G, psPAX2, and pLKO.1 plasmids were purchased from Invitrogen.

[0058] 1.2 Main Reagents

[0059] High-glucose DMEM, MEM medium, Lipofectamine 2000, Opti-MEM medium, and trypsin were purchased from Invitrogen. Fetal bovine serum (FBS) and puromycin were purchased from Gibco. Rabbit-derived HS3ST5 polyclonal antibody was purchased from Novus. Mouse-derived β-actin monoclonal antibody was purchased from Kangwei Century. Lentiviral rapid test strips were purchased from Beijing Bio-Long Immunotherapy Co., Ltd., and ChamQ SYBR qPCR MasterMix was purchased from Novizan.

[0060] 1.3 Primers

[0061] The upstream primer for the HS3ST5 gene is 5'-CCATTTGCCCTGTTGAAAGCC-3' (SEQ ID NO:6), and the downstream primer is 5'-CCGGAATTCATGCAGCAGAC-3' (SEQ ID NO:7); the upstream primer for the internal control primer GAPDH is 5'-CAAGAAGGTGGTGAAGCA-3' (SEQ ID NO:8), and the downstream primer is 5'-AAGTGGAAGAGTGAGTGTC-3' (SEQ ID NO:9). All primers were synthesized by Genewiz Biotechnology Co., Ltd.

[0062] 2. Methods

[0063] 2.1 Design and synthesis of shRNA targeting the HS3ST5 gene

[0064] Based on the HS3ST5 gene sequence in BHK-21 cells, shRNAs targeting HS3ST5 were designed using the BLOCK-iTRNAi Designer (Invitrogen) online software. The sequences are shown in Table 1. The designed shRNA sequences were synthesized by Genewiz Biotechnology Co., Ltd.

[0065] Table 1 shRNA sequences

[0066]

[0067] 2.2 Construction of pLKO-shRNA recombinant lentiviral plasmid

[0068] The shRNA forward and reverse interference sequences synthesized in Table 1 were dissolved in ddH2O at a concentration of 10 μM, as shown in Table 2 below. The forward and reverse interference sequences were annealed to form double-stranded sticky-terminated DNA. The system was placed in an environment of 100℃ for 4 min and then allowed to cool naturally.

[0069] The pLKO.1 vector was digested with AgeI and EcoRI, and the 7000 bp fragment was recovered after agarose gel electrophoresis. This fragment was then ligated with the shRNA annealing product in a 16℃ metal bath for 14-16 h. After the ligation reaction was complete, plasmid transformation was performed, and the plasmid was extracted. The constructed shRNA recombinant lentiviral plasmid was initially identified by agarose gel electrophoresis. Positive plasmids were then sent to Genewiz Biotechnology Co., Ltd. for sequencing using the 5'-CAAGGCTGTTAGAGATAATTGGA-3' (SEQ ID NO:5). Large quantities of the correctly identified plasmids, along with the helper plasmids pMD2.G and psPAX2, were extracted and prepared for use.

[0070] Table 2 shRNA interference sequence annealing system

[0071]

[0072] 3. Construction and identification results of pLKO-shRNA recombinant lentiviral plasmid

[0073] The pLKO.1 vector was digested with AgeI and EcoRI. Two fragments were observed by agarose gel electrophoresis. The 7000bp fragment was recovered and ligated with the double-stranded DNA product of shRNA. After preliminary identification by agarose gel electrophoresis, the positive clones were sent to Genewiz Biotechnology Co., Ltd. for sequence identification. The results showed that two recombinant lentiviral plasmids, pLKO-shRNA-807 and pLKO-shRNA-954, were successfully constructed. The positive plasmids with correct sequencing were extracted and stored for later use.

[0074] Example 2

[0075] A rescue method for recombinant lentiviruses targeting HS3ST5 gene silencing

[0076] HEK-293T cells were seeded in 10cm cell culture dishes. When the cells were in good condition and the density reached 70%, plasmid transfection was performed using Lipofectamine 2000 (10μg of the two recombinant lentiviral plasmids prepared in Example 1 + 7.5μg ps PAX2 helper plasmid + 2.5μg ps MD2.G helper plasmid). After 6 hours, 4ml of DMEM complete medium was added, and the cells were incubated at 37°C. After 48 hours, the cell supernatant was collected, and the lentivirus was used to confirm successful packaging using a lentivirus rapid detection card. The lentivirus solution was then filtered through a 0.45μm filter and stored for later use.

[0077] Establishment and identification results of recombinant BHK-21 cell line with shRNA knockdown of HS3ST5

[0078] HEK-293T cells were transfected with two recombinant lentiviral plasmids, pLKO-shRNA-807 and pLKO-shRNA-954. After 48 hours, the cell supernatant was added to a lentiviral rapid detection card. The lentiviral rapid detection cards all turned deep red, indicating a lentiviral titer of approximately 1.25 x 10⁻⁶. 6-7 TU / ml indicates that the two lentiviruses were successfully packaged.

[0079] Example 3

[0080] Construction of a recombinant BHK-21 cell line with stable HS3ST5 knockdown

[0081] 1. Determination of the screening concentration of puromycin

[0082] BHK-21 cells were seeded into six-well plates. Once the cell density reached 80%, puromycin at concentrations of 1, 2, 3, 4, 5, and 6 μg / mL was added for treatment. The treatment was repeated every 24 hours, and cell viability was observed for 7 consecutive days. The lowest drug concentration at which no cells survived was selected as the optimal concentration for puromycin screening.

[0083] 2. Method for constructing a recombinant BHK-21 cell line with stable HS3ST5 knockdown

[0084] Lentiviral solution (recombinant lentivirus strains containing shRNA-807 or shRNA-954 rescued in Example 2) and complete cell culture medium were mixed at a 1:1 volume ratio to prepare a mixed culture medium. Normal BHK-21 cells were seeded in six-well plates and cultured in the mixed culture medium. After the cells reached confluence, they were transferred to T25 cell culture flasks, and the mixed culture medium was added again. The mixed culture medium was changed every 24 hours. After 7 days, the lentivirus-infected cells were treated with the optimal concentration of puromycin. The complete culture medium containing puromycin was changed every 24 hours. Cell samples were collected after 7 days, and the relative mRNA level of HS3ST5 was analyzed using real-time quantitative PCR (RT-qPCR). The reverse transcription system for the RT-qPCR method is shown in Table 3. The reverse transcription program was 37℃ for 15 min and 85℃ for 5 s. The amplification system for the RT-qPCR method is shown in Table 4. The amplification reaction program was: 95℃ for 30 s pre-denaturation; 95℃ for 5 s, 60℃ for 30 s, 72℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 1 min, 95℃ for 30 s, 60℃ for 15 s. The relative mRNA copy number of HS3ST5 was calculated using the ΔΔCT method. The protein level of HS3ST5 was detected by Western blotting. The primary antibodies used in the Western blotting were rabbit-derived HS3ST5 polyclonal antibody and mouse-derived β-actin monoclonal antibody. The secondary antibodies used were HRP-labeled goat anti-mouse IgG and HRP-labeled goat anti-rabbit IgG.

[0085] Table 3 RT-qPCR reverse transcription system for HS3ST5

[0086]

[0087]

[0088] Table 4. Amplification system of HS3ST5 RT-qPCR

[0089]

[0090] The digested positive recombinant cells were counted, diluted with culture medium to form single cells, and then added to 96-well plates. After the cells reached confluence, the monoclonal recombinant cells were expanded and cryopreserved. The expression of HS3ST5 in the monoclonal recombinant cells was detected by RT-qPCR and Western Blot.

[0091] result

[0092] BHK-21 cells were treated with gradient concentrations of puromycin. It was observed that after one week of selection with a minimum concentration of 4 μg / mL of puromycin, all BHK-21 cells died. Therefore, the optimal puromycin concentration for screening recombinant BHK-21 cell lines in subsequent experiments was determined to be 4 μg / mL.

[0093] One week after BHK-21 cells were infected with recombinant lentivirus and selected with the optimal concentration of puromycin, Western blotting and RT-qPCR were used to determine whether the cell line had been successfully established. Figure 1 Western blotting and RT-qPCR results showed a significant decrease in HS3ST5 protein and mRNA levels in BHK-shHS3ST5-807-KD and BHK-shHS3ST5-954-KD cells, indicating the successful establishment of two recombinant BHK-21 cell lines with HS3ST5 knockdown. Fifty monoclonal clones from each recombinant cell line were then seeded into 12-well plates. After collecting the samples, the expression levels of HS3ST5 protein and mRNA in the monoclonal recombinant BHK-21 cells were detected using Western blotting and RT-qPCR. Three monoclonal cells with the best knockdown effect were selected from BHK-shHS3ST5-807-KD and BHK-shHS3ST5-954-KD cells.

[0094] like Figure 2 Western blot results showed that, compared with normal BHK-21 cells, the HS3ST5 protein level was significantly decreased in all recombinant cell lines. Figure 2In section b, the RT-qPCR results were consistent with the Western Blot results, showing a significant decrease in HS3ST5 mRNA levels in all recombinant cell lines. These results indicate that two recombinant BHK-21 cell lines with HS3ST5 knockdown were successfully constructed using shRNA. The recombinant BHK cells with the best HS3ST5 knockdown effect, namely BHK-shHS3ST5-807-2-KD and BHK-shHS3ST5-954-47-KD, were selected for subsequent functional validation experiments.

[0095] Example 4

[0096] Effect of recombinant BHK-21 cells on FMDV proliferation

[0097] Recombinant BHK-21 cells and normal BHK-21 cells were separated into 6-well plates and incubated at 37°C. After 18 hours, 1 MOI of FMDV was seeded, and samples were collected at 4, 8, 12, and 16 hours. The FMDV titer in the samples was determined using a plaque formation assay to evaluate the effect of shRNA silencing of HS3ST5 on FMDV proliferation.

[0098] Specific steps of the etch spot formation test:

[0099] (1) After digesting the confluent BHK-21 cells, they were divided into 6-well plates and incubated in a 37°C incubator for 18 hours.

[0100] (2) Rinse the cells in the 6-well plate twice with PBS, and take 100 μL of sample. Use serum-free MEM medium (containing 1% penicillin and antibiotics) as diluent to perform a 10-fold serial dilution to 10⁻⁶. -7 , 10 -4 10 -5 and 10 -6 Add the sample dilution buffer to the cells in a 6-well plate, repeating each dilution in 2 wells. Incubate the 6-well plate in a 37°C cell culture incubator for 1 hour, shaking once every 10 minutes.

[0101] (3) Mix 1.2% astragalus gum and 2×MEM in a 1:1 ratio, add 2 mL of the mixture to each well, and incubate in a 37℃ constant temperature incubator for 44 h;

[0102] (4) Discard the liquid, add 2 mL of pre-cooled fixative (methanol and acetone volume ratio = 1:1) to each well, and place at -20℃ for 2 h;

[0103] (5) Discard the fixative, add 2 mL of crystal violet staining solution to each well, and incubate at room temperature for 6 h;

[0104] (6) Rinse the 6-well plate with water until no staining solution remains.

[0105] After the plaque formation experiment was completed, the plaques were counted and the viral plaque forming units (PFU) at different time points were calculated.

[0106] Results of shRNA knockdown of HS3ST5 on FMDV generation in progeny

[0107] Samples were collected from BHK-shHS3ST5-807-2-KD recombinant cells, BHK-shHS3ST5-954-47-KD recombinant cells, and BHK-21 normal cells after FMDV infection. Progeny virus was quantified using a plaque formation assay to evaluate the effect of shRNA knockdown of HS3ST5 on progeny FMDV generation. Figure 3 In all time points, compared with normal BHK-21 cells, the number of FMDV plaques in the BHK-shHS3ST5-807-2-KD and BHK-shHS3ST5-954-47-KD recombinant cell lines was significantly reduced. The number of viral plaques in the samples reached its peak at 12 h. At this time, compared with the control, the number of plaques in the BHK-shHS3ST5-807-2-KD recombinant cell line was reduced by 40%, and the number of plaques in the BHK-shHS3ST5-954-47-KD recombinant cell line was reduced by 38%. These results indicate that HS3ST5 knockdown in BHK-21 recombinant cells significantly inhibited FMDV generation in progeny cells.

[0108] As can be seen from the results of the above embodiments, the present invention constructs a recombinant lentiviral plasmid carrying shRNA and establishes a recombinant BHK-21 cell line with HS3ST5 knockdown using the packaged recombinant lentivirus. RT-qPCR and Western Blot experiments demonstrate that the designed recombinant lentiviral plasmid carrying shRNA can significantly reduce the expression level of HS3ST5, indicating that the constructed recombinant lentiviral plasmid or its recombinant lentivirus can be used as an effective tool to inhibit the proliferation of various viruses such as FMDV that use HS as a receptor, providing a new approach for the preparation of antiviral drugs.

[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a reagent for knocking down the HS3ST5 gene in cells in the preparation of cells that reduce viral proliferation or in the preparation of drugs for antiviral infection, wherein the virus is foot-and-mouth disease virus, and the reagent is one or more of the following: shRNA, a recombinant lentiviral plasmid containing the shRNA, or a recombinant lentivirus, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO:1 and / or SEQ ID NO:3, and the recombinant lentivirus is obtained by rescuing a recombinant lentiviral plasmid and a helper plasmid.

2. The application according to claim 1, characterized in that, The backbone plasmid of the recombinant lentiviral plasmid is the pLKO.1 vector.

3. A drug for treating viral infections, characterized in that, The active ingredient is shRNA, a recombinant lentiviral plasmid containing the shRNA, or a recombinant lentivirus, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO:1 and / or SEQ ID NO:3, and the active ingredient is pharmaceutically acceptable excipients. The recombinant lentivirus is obtained by rescuing a recombinant lentiviral plasmid and a helper plasmid. The virus is foot-and-mouth disease virus.

4. A recombinant BHK-21 cell line based on shRNA-mediated stable knockdown of the HS3ST5 gene, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO:1 and / or SEQ ID NO:3.

Images