Marker for breast cancer diagnosis and use thereof

CN116256514BActive Publication Date: 2026-08-07JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
Filing Date
2022-11-30
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

但早期或局部乳腺癌患者的血清CA15-3表达变化不明显,无法与健康女性或患有良性乳腺疾病的女性区分

Benefits of technology

[0042]本申请提供了血浆外泌体中乳腺癌的标志物MUC1-C*多肽,并将MUC1-C*位点、MUC1可变串联重复区(VNTR)位点和/或外泌体标志蛋白等联合,可以完成血浆外泌体中MUC1蛋白的检测,或血浆外泌体CD63亚群中外泌体中MUC1蛋白不同区段的检测,可以解决目前MUC1检测方法中可变数目串联重复区域(VNTR)在不同用个体中大小多态性的干扰问题,提高MUC1蛋白检测的灵敏度和特异性,实现乳腺癌和良性乳腺增生、健康人等对照样本的区分,可以应用于乳腺癌的早期诊断或辅助诊断,并为术后监控提供指导意义。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116256514B_ABST
    Figure CN116256514B_ABST
Patent Text Reader

Abstract

The present application relates to a marker for breast cancer diagnosis and its application. The present application provides a marker for breast cancer diagnosis, which comprises an exosome membrane protein MUC1, and breast cancer is diagnosed by detecting the expression content of the exosome membrane protein MUC1. Specifically, the exosome membrane protein MUC1 comprises MUC1-C* and / or MUC1-VNTR. Different segments of the marker are used to prepare products for diagnosing breast cancer. The present application combines MUC1-C* sites, MUC1 variable tandem repeat (VNTR) sites and / or exosome marker proteins, etc., which can realize the differentiation of breast cancer and benign breast hyperplasia, healthy people and other control samples, can be applied to the early diagnosis or auxiliary diagnosis of breast cancer, and provides guidance significance for postoperative monitoring.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biomedical diagnostics, specifically to biomarkers for the diagnosis of breast cancer and their applications. Background Technology

[0002] In 2020, approximately 19.3 million new cancer cases were diagnosed globally, with breast cancer accounting for 11.7% of these cases in women. For the first time, breast cancer surpassed lung cancer to become the most diagnosed cancer worldwide. Statistics show that early detection and timely, effective treatment of breast cancer are crucial for reducing mortality and improving quality of life. The 5-year survival rate for patients diagnosed with early-stage carcinoma in situ is close to 100%, while the survival rate for late-stage patients is only 27%.

[0003] Currently, the diagnosis of breast cancer (BC) mainly relies on imaging and histopathological examinations. Imaging examinations have high requirements for tumor volume measurement and have a detection limit; histopathological examinations require surgical sampling, which can easily cause physical discomfort to patients. Another method is to detect biological targets. The main biomarker for detecting breast cancer in serum is CA15-3. Serum CA15-3 expression levels are significantly elevated in patients with advanced breast cancer, which is important for assessing recurrence risk and monitoring prognosis. However, serum CA15-3 expression changes are not significant in patients with early or localized breast cancer, making it difficult to distinguish them from healthy women or women with benign breast diseases.

[0004] Currently, there are no FDA or NMPA-approved liquid biopsy products for early screening or diagnosis of breast cancer. Current reports primarily focus on the prognosis of breast cancer or the monitoring and management of advanced-stage patients. Therefore, there is an urgent need for an economical, non-invasive, and objective liquid biopsy product for early screening and diagnosis of breast cancer. Summary of the Invention

[0005] Therefore, it is necessary to provide a biomarker for breast cancer diagnosis, exosomal membrane protein MUC1, by detecting the expression level of exosomal membrane protein MUC1 to diagnose breast cancer.

[0006] In addition, reagents for detecting the MUC1-C* peptide and / or MUC1-VNTR region in plasma exosomes are provided for the early diagnosis of breast cancer or to differentiate breast cancer from benign breast hyperplasia or other cancers, with high sensitivity and specificity.

[0007] The specific technical solution is as follows:

[0008] A biomarker for breast cancer diagnosis, the biomarker comprising exosomal membrane protein MUC1, wherein breast cancer is diagnosed by detecting the expression level of the exosomal membrane protein MUC1.

[0009] In one embodiment, the breast cancer diagnosis includes differentiating breast cancer from benign breast hyperplasia or other cancers or healthy individuals.

[0010] In one embodiment, the exosomes are selected from exosomes derived from blood and / or cell cultures.

[0011] In one embodiment, the exosomal membrane protein MUC1 includes MUC1-C* and / or MUC1-VNTR regions; the expression level of the exosomal membrane protein MUC1 is determined by detecting the content of MUC1-C* and / or MUC1-VNTR regions; preferably, MUC1-C* is detected.

[0012] In one embodiment, the detection includes detecting the expression level of exosomal membrane protein MUC1 using a double-antibody sandwich method.

[0013] In one embodiment, the double-antibody sandwich method includes capture using any of the following antibodies: an antibody that recognizes an exosome surface marker protein, an antibody that specifically recognizes MUC1-C*, and an antibody that specifically recognizes MUC1-VNTR; and

[0014] This includes detection using any of the following antibodies: antibodies that specifically recognize MUC1-C* and antibodies that specifically recognize MUC1-VNTR.

[0015] In one embodiment, the exosome surface marker protein is one or more of CD9, CD18, CD63, CD81, and CD151.

[0016] The use of any of the biomarkers described above for the diagnosis of breast cancer in any of the following:

[0017] 1) Application in the preparation of MUC1 biomarker detection reagents for breast cancer diagnosis.

[0018] 2) Application in the preparation of reagents and kits for breast cancer diagnosis.

[0019] 3) Application in the preparation of systems for breast cancer diagnosis.

[0020] In one embodiment, the breast cancer diagnosis includes differentiating breast cancer from benign breast hyperplasia or other cancers or healthy individuals.

[0021] In one embodiment, the method for diagnosing breast cancer using the biomarker includes the following steps:

[0022] Detecting the expression levels of the biomarkers in exosome samples from subjects; and

[0023] Breast cancer can be diagnosed based on the expression levels of the aforementioned biomarkers.

[0024] In one embodiment, the method further includes enriching exosome samples from the subject's blood;

[0025] Optionally, the exosome sample is total exosomes from the blood. Optionally, the exosome sample is exosomes specifically secreted by breast tissue from the blood.

[0026] In one embodiment, the exosomes specifically secreted by the breast tissue are exosomes expressing the MUC1-C* and / or MUC1-VNTR regions on their membranes.

[0027] The application of reagents for detecting the expression of exosomal membrane protein MUC1 in the preparation of products for diagnosing breast cancer, said reagents including reagents for detecting the expression of MUC1-C* and / or MUC1-VNTR regions.

[0028] In one embodiment, the diagnosis of breast cancer includes differentiating breast cancer from benign breast hyperplasia, or differentiating breast cancer from other cancers, or differentiating breast cancer from healthy individuals.

[0029] In one embodiment, the expression reagent for detecting MUC1-C* includes an antibody that specifically recognizes MUC1-C*; optionally, it includes detection antibodies and capture antibodies that specifically recognize different peptides of MUC1-C*, respectively.

[0030] In one embodiment, the antibody that specifically recognizes MUC1-C* includes PA5-95487 antibody and / or MA5-30688 antibody.

[0031] In one embodiment, the reagent includes an antibody that specifically recognizes MUC1-C* and an antibody that specifically recognizes MUC1-VNTR.

[0032] Optionally, the antibody that specifically recognizes MUC1-VNTR is used as a capture antibody, and the antibody that specifically recognizes MUC1-C* is used as a detection antibody.

[0033] In one embodiment, the reagent includes an antibody that specifically recognizes MUC1-C* and an antibody that recognizes exosome marker proteins.

[0034] Optionally, the antibody that recognizes the exosome marker protein is used as a capture antibody, and the antibody that specifically recognizes MUC1-C* is used as a detection antibody.

[0035] In one embodiment, the reagent includes an antibody that specifically recognizes MUC1-VNTR and an antibody that recognizes exosome marker proteins.

[0036] Optionally, the antibody that recognizes exosome marker proteins is used as a capture antibody, and the antibody that recognizes MUC1-VNTR is used as a detection antibody.

[0037] In one embodiment, the exosome marker protein is one or more of CD9, CD18, CD63, CD81, and CD151.

[0038] A diagnostic kit for breast cancer, the kit comprising the reagents defined in any of the preceding claims.

[0039] In one embodiment, the test sample of the kit includes exosomes in blood and / or exosomes in cell cultures.

[0040] In one embodiment, the kit further includes exosome extraction reagents and / or protein calibrators.

[0041] Compared with the prior art, this application has the following beneficial effects:

[0042] This application provides a biomarker for breast cancer in plasma exosomes, the MUC1-C* peptide, and combines the MUC1-C* site, the MUC1 variable tandem repeat (VNTR) site, and / or exosome marker proteins to detect MUC1 protein in plasma exosomes, or to detect different segments of MUC1 protein in exosomes from the CD63 subset of plasma exosomes. This solves the interference problem of variable number tandem repeat (VNTR) size polymorphism in different individuals in current MUC1 detection methods, improves the sensitivity and specificity of MUC1 protein detection, and enables the differentiation between breast cancer and control samples such as benign breast hyperplasia and healthy individuals. It can be applied to the early diagnosis or auxiliary diagnosis of breast cancer and provides guidance for postoperative monitoring. Attached Figure Description

[0043] Figure 1 This is a schematic diagram of the amino acid sequence of the MUC1 protein;

[0044] Figure 2 This is a schematic diagram of the MUC1 protein structure;

[0045] Figure 3 Standard curve for the MUC1-C* sandwich system;

[0046] Figure 4 Scatter plot of test results for MUC1-C* sandwich system samples;

[0047] Figure 5 ROC analysis of the test results of the MUC1-C* sandwich system samples;

[0048] Figure 6 Standard curve for the VNTR-MUC1-C* sandwich system;

[0049] Figure 7 Scatter plot of test results for VNTR-MUC1-C* sandwich system samples;

[0050] Figure 8 ROC analysis of the detection results of VNTR-MUC1-C* sandwich system samples;

[0051] Figure 9 Standard curve for the CD63-MUC1-C* sandwich system;

[0052] Figure 10 Scatter plot of test results for CD63-MUC1-C* sandwich system samples;

[0053] Figure 11 ROC analysis of the test results of the CD63-MUC1-C* sandwich system samples;

[0054] Figure 12 The standard curve for the CD63-VNTR sandwich system;

[0055] Figure 13 Scatter plot of test results for CD63-VNTR sandwich system samples;

[0056] Figure 14 ROC analysis of the detection results of CD63-VNTR sandwich system samples;

[0057] Figure 15 Comparison of detection results for VNTR-MUC1-C* sandwich system, MUC1-C* sandwich system, CD63-VNTR sandwich system, CD63-MUC1-C* sandwich system and commercial CA15-3 kit;

[0058] Figure 16 ROC analysis of the detection results for the VNTR-MUC1-C* sandwich system, MUC1-C* sandwich system, CD63-VNTR sandwich system, CD63-MUC1-C* sandwich system, and the commercially available CA15-3 kit. Detailed Implementation

[0059] To make the above-mentioned objectives, features, and advantages of this application more apparent and understandable, a detailed description of specific embodiments of this application is provided below. Many specific details are set forth in the following description to provide a thorough understanding of this application. However, this application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of this application. Therefore, this application is not limited to the specific embodiments disclosed below.

[0060] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0061] The term “and / or” includes any and all combinations of one or more of the related listed items.

[0062] The term "MUC1-C*" refers to the 45-amino acid sequence at the C-terminus of the β-subunit of MUC1 that remains bound to the membrane after the N-terminus has detached, such as... Figure 1 As shown. The polypeptide of MUC1-C* includes at least one of the amino acid sequences shown in SEQ ID NO.1 to 5.

[0063] The term "exosome" refers to extracellular vesicles, 30-150 nm in size, secreted by living cells and widely distributed in various body fluids. Exosomes secreted by tumor cells carry host-specific proteins and nucleic acids. Exosomes can transfer these tumor-specific substances and promote tumor cell proliferation, metastasis, invasion, and tumor angiogenesis through multiple regulatory pathways. Studies have shown that the expression of various tumor marker proteins differs significantly at the exosome level, and exosomes have become an emerging biomarker for detection in the field of liquid biopsy.

[0064] The term "MUC1" belongs to the mucin family and is a single-pass transmembrane glycoprotein of approximately 400 kDa. During cellular carcinogenesis, MUC1 is abnormally highly expressed throughout the surface of tumor cells. MUC1 expression levels are also correlated with tumor metastasis and recurrence. The extracellular segment of MUC1, CA15-3, is clinically used as a diagnostic marker for breast and pancreatic cancer; CA15-3 refers to the free extracellular portion of MUC1 shed into peripheral blood. MUC1 is highly expressed in over 90% of breast cancers, and serum CA15-3 levels are currently the most widely used diagnostic marker for breast cancer. The detection region of CA15-3 is located in the variable-number tandem repeat (VNTR) region of MUC1. Sandwich assays primarily use two antibodies: a capture antibody binds to a glycopeptide epitope on the repeat structure, and a detection antibody binds to a portion of the amino acid sequence in the 20-amino acid tandem repeat region (e.g., the DF3 antibody recognizes the Asp-Thr-Arg-Pro-Ala-Pro-Gly-Ser sequence). In actual clinical testing, serum CA15-3 levels are rarely elevated in patients with early or localized breast cancer, remaining roughly the same as in healthy women or patients with benign breast cancer. The varying number of MUC1 tandem repeat sequences between individuals (ranging from 25 to 100) and their size polymorphism may be one reason for the less-than-ideal detection results.

[0065] MUC1 protein, as an important tumor marker and drug research target, has seen relatively recent and limited research at the exosome level in breast cancer. This application found that detecting different segments of MUC1 protein expressed in plasma exosomes, or combining detection with exosome marker proteins, can effectively diagnose breast cancer and differentiate it from benign breast hyperplasia. Exosomal MUC1 protein has significant application value in the early diagnosis of breast cancer. Developing a breast cancer exosomal MUC1 protein detection product holds promise for early diagnosis of breast cancer patients, providing important assistance in breast cancer risk stratification, and having profound implications for patient prognosis and treatment guidance.

[0066] Therefore, one embodiment of this application provides a biomarker for breast cancer diagnosis, the biomarker including exosomal membrane protein MUC1, and breast cancer is diagnosed by detecting the expression level of exosomal membrane protein MUC1.

[0067] In this application, the diagnosis of breast cancer includes distinguishing breast cancer from healthy individuals, or distinguishing breast cancer from benign breast hyperplasia, or distinguishing breast cancer from other cancers.

[0068] In a specific example, diagnosing breast cancer also includes early diagnosis and auxiliary diagnosis.

[0069] In one specific example, exosomes may be selected from exosomes derived from blood or exosomes from cell cultures.

[0070] In one specific example, the exosomal membrane protein MUC1 includes the MUC1-C* and / or MUC1-VNTR regions.

[0071] In one specific example, the expression level of the exosomal membrane protein MUC1 can be detected by measuring the content of the MUC1-C* and / or MUC1-VNTR regions. Optionally, MUC1-C* is detected.

[0072] In a specific example, the detection includes determining the expression level of the exosomal membrane protein MUC1 using a double-antibody sandwich assay. Specifically, the double-antibody sandwich assay includes capture using any of the following antibodies: antibodies recognizing exosomal surface marker proteins, antibodies specifically recognizing MUC1-C*, and antibodies specifically recognizing MUC1-VNTR; and detection using antibodies specifically recognizing MUC1-C* and / or antibodies specifically recognizing MUC1-VNTR. Further, the exosomal surface marker protein is one or more of CD9, CD18, CD63, CD81, and CD151.

[0073] This application also provides the use of any of the above-described biomarkers for breast cancer diagnosis in the preparation of a detection reagent for the MUC1 biomarker for breast cancer diagnosis, or in the preparation of a product for breast cancer diagnosis. Optionally, the product may include reagents, kits, and diagnostic systems, etc.

[0074] In a specific example, the method for diagnosing breast cancer using the above-mentioned biomarkers includes the following steps: detecting the expression level of the biomarkers in the subject's exosome sample; and diagnosing breast cancer based on the expression level of the biomarkers.

[0075] In a more specific example, the method also includes enriching exosome samples from the subject's blood.

[0076] Specifically, exosome samples can be total exosomes from the blood, which can be enriched by capturing exosome surface marker proteins. Exosome samples can also be exosomes specifically secreted by breast tissue from the blood, which can be enriched by capturing exosome membranes expressing MUC1-C* and / or MUC1-VNTR regions.

[0077] An embodiment of this application also provides the use of a reagent for detecting the expression of the exosomal membrane protein MUC1 in the preparation of products for diagnosing breast cancer, the reagent comprising a reagent for detecting the expression of the MUC1-C* and / or MUC1-VNTR regions.

[0078] In one specific example, the expression reagent for detecting MUC1-C* includes an antibody that specifically recognizes MUC1-C*. Optionally, the antibody that specifically recognizes MUC1-C* includes PA5-95487 antibody and / or MA5-30688 antibody.

[0079] In one specific example, it includes detection antibodies and capture antibodies that specifically recognize different peptides of MUC1-C*, respectively.

[0080] In a specific example, the MUC1-C* sandwich system, comprising PA5-95487 and MA5-30688 antibodies, can significantly distinguish breast cancer patients from healthy individuals by detecting the MUC1 protein content in plasma exosomes. ROC analysis showed an area under the curve (AUC) of 0.8542, a sensitivity of 70%, and a specificity of 95%. The closer the AUC is to 1, the greater its diagnostic value, indicating that this detection system can efficiently differentiate breast cancer from healthy individuals.

[0081] Optionally, PA5-95487 antibody is used as the capture antibody, and MA5-30688 is used as the detection antibody. Alternatively, MA5-30688 antibody is used as the capture antibody, and PA5-95487 is used as the detection antibody.

[0082] In one specific example, the reagent includes an antibody that specifically recognizes MUC1-C* and an antibody that specifically recognizes MUC1-VNTR.

[0083] In a specific example, the VNTR-MUC1-C* sandwich system, comprising antibodies specifically recognizing MUC1-C* and MUC1-VNTR, can distinguish between breast cancer patients and healthy individuals by detecting the MUC1 protein content in plasma exosomes. ROC analysis showed an area under the curve (AUC) of 0.9525, a sensitivity of 80%, and a specificity of 95%. Furthermore, the VNTR-MUC1-C* sandwich system can also significantly distinguish between breast cancer and benign breast hyperplasia patients, with an AUC of 0.9047, a sensitivity of 70%, and a specificity of 96%. In addition, the VNTR-MUC1-C* sandwich system also has clinical significance in distinguishing breast cancer from other cancer types, with an AUC of 0.8167, a sensitivity of 70%, and a specificity of 85%.

[0084] Optionally, the antibody that specifically recognizes MUC1-VNTR is used as the capture antibody, and the antibody that specifically recognizes MUC1-C* is used as the detection antibody. Optionally, the antibody that specifically recognizes MUC1-C* can be selected from PA5-95487 antibody or MA5-30688 antibody.

[0085] In one specific example, the reagent includes an antibody that specifically recognizes MUC1-C* and an antibody that recognizes exosome marker proteins.

[0086] Optionally, an antibody that recognizes an exosome marker protein is used as a capture antibody, and an antibody that specifically recognizes MUC1-C* is used as a detection antibody. Optionally, an antibody that specifically recognizes MUC1-C* is used as a capture antibody, and an antibody that recognizes an exosome marker protein is used as a detection antibody. Optionally, the exosome marker protein is one or more of CD9, CD18, CD63, CD81, and CD151.

[0087] In one specific example, a CD63-MUC1-C* sandwich system, comprising an antibody specifically recognizing MUC1-C* and an antibody recognizing the exosome marker protein CD63, was used to significantly distinguish breast cancer patients from healthy individuals by detecting the MUC1-C* terminal polypeptide of the MUC1 protein in plasma exosomes from the CD63 subset. ROC analysis showed an AUC of 0.8392, a sensitivity of 76.67%, and a specificity of 80%, demonstrating certain clinical guiding significance.

[0088] In one specific example, the reagent includes an antibody that specifically recognizes MUC1-VNTR and an antibody that recognizes exosome marker proteins.

[0089] Optionally, antibodies that recognize exosome marker proteins are used as capture antibodies, and antibodies that specifically recognize the MUC1-VNTR region are used as detection antibodies. Optionally, the exosome marker proteins are one or more of CD9, CD18, CD63, CD81, and CD151.

[0090] In a specific example, a CD63-VNTR sandwich system, comprising an antibody specifically recognizing the MUC1-VNTR and an antibody recognizing the exosomal marker protein CD63, significantly distinguished breast cancer patients from healthy individuals by detecting the MUC1-VNTR region of the MUC1 protein in plasma exosomal CD63 subsets. ROC analysis showed an area under the curve (AUC) of 0.9150, sensitivity of 73.3%, and specificity of 95%. Furthermore, the CD63-VNTR sandwich system also showed significant differentiation between breast cancer and benign breast hyperplasia patients, with an AUC of 0.8673, sensitivity of 73.3%, and specificity of 80%. In addition, this sandwich system could also significantly distinguish breast cancer from other cancer types, with an AUC of 0.7225, sensitivity of 70%, and specificity of 70%. Specific Implementation

[0092] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0093] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. For temperature and time parameters, acceptable deviations due to instrument testing accuracy or operational precision are permissible.

[0094] Example 1: Examination of antibody recognition sites

[0095] Multiple antibodies were purchased. Due to the unknown antigenic epitopes recognized by the antibodies, the MUC1-C*-terminal polypeptide sequence was designed and synthesized as shown below:

[0096] SEQ ID NO.1: TQFNQYKTEAASRYNL;

[0097] SEQ ID NO.2: NLTISDVSVSDVPPFF;

[0098] SEQ ID NO.3: VSVSDVPFPFSAQSGA;

[0099] SEQ ID NO.4: TEAASRYNLTISDVSV;

[0100] SEQ ID NO.5: TINVHDVETQFNQYKT.

[0101] The target peptide fragment was obtained, diluted, and prepared with coating buffer (pH 9.6) to a concentration of 1 μg / ml. 100 μl was added to each well of a microplate and incubated overnight at 4°C. 200 μL of plate stabilizer was added to the dried microplate and incubated at 37°C for 2 hours. The blocking buffer was discarded, and the plate was dried at 37°C for 30 minutes. The detection antibody was prepared to a concentration of 200 ng / ml, then serially diluted for detection. The plate was incubated at 37°C for 1 hour, washed, and then the corresponding secondary antibody was added. The plate was incubated at 37°C for 1 hour, washed, and then TMB substrate was added for color development. The results (Table 1) showed that the PA5-95487 antibody could recognize the SEQ ID NO.1 and SEQ ID NO.5 peptides at the MUC1-C* end, and the MA5-30688 antibody could recognize the SEQ ID NO.2 peptide at the MUC1-C* end. Thus, two antibodies capable of recognizing the MUC1-C* end peptide were obtained.

[0102] In addition, the antibody SC7313 HRP (Santa Cruz), which can recognize the VNTR region, was purchased.

[0103] Table 1. Antibody screening for identifying MUC1-C*-terminal peptides.

[0104]

[0105] Example 2: Expression, purification, and identification of CD63:MUC1-C* fusion protein and CD63:VNTR fusion protein

[0106] 1. Protein expression

[0107] NCBI was used to search for the protein-coding sequences corresponding to human CD63 and MUC1 regions, namely CD63 (SEQ ID NO. 6), MUC1-C* (SEQ ID NO. 7), and VNTR (SEQ ID NO. 8). The CD63:MUC1-C* and CD63:VNTR sequences were synthesized, and the genes in these two sequences were linked together using a linker sequence (SEQ ID NO. 9). A sequence (SEQ ID NO. 10) was added before the first gene, and a sequence (SEQ ID NO. 11) was added before the second gene. The entire sequence was then ligated into the pVAX1 vector. The two recombinant human plasmids, pVAX1-CD63+MUC1-C*-His and pVAX1-CD63+VNTR-His, were transformed into eukaryotic mammalian 293F cells. Transfection enhancer was added 18-22 hours after transfection, and the cells were collected after 5-7 days. The supernatant was filtered through a 0.22 μm filter and used for subsequent protein purification.

[0108] Prepare the equilibration (washing) buffer: 20mM imidazole, 250mM NaCl, 20mM phosphate buffer, pH 7.4.

[0109] Prepare the elution buffer: 100mM imidazole, 250mM NaCl, 20mM phosphate buffer, pH 7.4.

[0110] The obtained filtrate and packing material were incubated at 4°C with rotation for 2-3 hours to allow protein binding to the packing material. The sample / packing material mixture was then transferred to a plastic column, and the filtrate was allowed to flow out naturally. After washing with approximately 20 mL of equilibration buffer, approximately 20 mL of washing buffer was used to remove impurities. Finally, 20-30 mL of elution buffer was used to elute the protein, and the eluent was collected. The protein solution was concentrated using a 10 kDa ultrafiltration tube and stored in 50 mM PBS (pH 7.4) at -80°C. The obtained protein was identified by SDS-PAGE electrophoresis to determine its size and purity, obtaining the target protein for subsequent experiments.

[0111] SEQ ID NO.6:

[0112] GCTGGCTATGTGTTTAGAGATAAGGTGATGTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCGAAAAACAACCACACTGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACACAGATTGGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAATGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTG;

[0113] SEQ ID NO.7:

[0114] ACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACG GAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGAT GTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGG;

[0115] SEQ ID NO.8:

[0116] CCTGCCCCCGGGTCCACAGCCCCTCCCGCCCATGGCGTGACAAGCGCTCCCGACACCCGGCCCGCTCCCGGCAGCACAGCCCCCCCCGCCCACGGGGTGACAAGCGCTCCTGACACACGGCCCGCCCCTGGGTCCACCGCTCCCCCCGCTCACGGCGTGACAAGCGCTCCCGATACAAGACCCGCTCCCGGGTCCACAGCTCCCCCTGCTCATGGCGTCACAAGCGCTCCTGACACCCGGCCCGCTCCCGGCTCCACAGCTCCCCCCGCTCACGGCGTGACAAGCGCTCCTGACACAAGACCCGCCCCTGGCAGCACAGCCCCCCCTGCCCATGGCGTCACAAGCGCTCCCGACACACGGCCTGCCCCTGGGAGCACCGCCCCCCCCGCTCACGGGGTGACATCCGCTCCCGACACAAGACCTGCCCCTGGGTCCACAGCTCCCCCTGCCCACGGCGTCACCTCCGCCCCTGACACCCGGCCTGCCCCTGGCAGCACAGCTCCCCCTGCTCATGGGGTCACAAGCGCCCCTGACACCCGGCCCGCCCCCGGGAGCACAGCTCCCCCTGCCCACGGCGTGACAAGCGCTCCCGACACCCGG;

[0117] SEQ ID NO.9:

[0118] GGCGGTGGTAGCGGCGGTGGCAGCGGCGGTGGTAGCGGCGGTGGCA GC;

[0119] SEQ ID NO.10:

[0120] AAGCTTGCCACCATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG;

[0121] SEQ ID NO.11:

[0122] CATCACCATCACCACCATCATCACCATCACTAACTCGAG。

[0123] 2. Identification of the activity of the fusion protein:

[0124] The fusion proteins were serially diluted with coating buffer (pH 9.6) and added to microplates, 100 μL per well. Coating was carried out overnight at 4°C. After washing, 200 μL of ELISA plate stabilizer was added, and the plates were incubated at 37°C for 2 hours. The blocking buffer was discarded, and the plates were blotted dry at 37°C for 30 min. The detection antibody was diluted to 0.25 ug / ml and incubated at 37°C for 1 hour. After washing, TMB substrate chromogenic solution was added for color development, and the OD value was measured. The results showed that the two fusion proteins exhibited good reactivity and met the requirements, as shown in Table 2.

[0125] Table 2. Activity identification of CD63:MUC1-C* and CD63:VNTR fusion proteins.

[0126]

[0127]

[0128] Example 3: Construction of the MUC1-C* system and plotting of standard curves

[0129] The MUC1-C* protein sandwich assay system includes capture antibody, detection antibody, and protein calibrators. First, the capture antibody is diluted to 2 μg / mL with coating buffer (pH 9.6), and 100 μl is added to each well of the microplate. Incubate overnight at 4°C. After washing, add 200 μL of microplate stabilizer and incubate at 37°C for 2 hours. Discard the blocking solution and blot dry. Dry at 37°C for 30 minutes. The calibrator proteins were diluted with protein stabilizer to concentrations of 0 ng / ml, 0.195 ng / ml, 0.39 ng / ml, 0.781 ng / ml, 1.562 ng / ml, 3.125 ng / ml, 12.5 ng / ml, and 25 ng / ml, respectively. The calibrators were added sequentially to pre-coated microplates, 100 μL per well, and incubated at 37°C for 1.5 h. The plates were washed three times with washing buffer, and 100 μL of HRP-labeled detection antibody (0.25 μg / ml) was added to each well, incubated at 37°C for 1 h. The plates were then washed three more times with washing buffer, and the substrate chromogenic solution was added. The OD values ​​of each well were measured. The standard concentration was used as the independent variable (X), and the corresponding absorbance value was used as the dependent variable (Y). A logistic regression equation was obtained by fitting the equation using the four-parameter logistic regression method. As shown in Table 3, the results indicate that the capture antibody (manufacturer: Thermo, catalog number: PA5-95487) and the detection antibody (manufacturer: Thermo, catalog number: MA5-30688) are well-matched and can be used to construct a double antibody sandwich system. Figure 3 The standard curve for the detection system has a linear range of 0.39–25 ng / ml and a limit of detection of 0.39 ng / ml.

[0130] Table 3 Antibody pairings in the MUC1-C* sandwich system

[0131]

[0132] Example 4: Clinical validation of the MUC1-C* sandwich system

[0133] In this embodiment, the sample type tested was plasma exosomes, with a total of 75 samples included. Among them, there were 30 cases of breast cancer (10 cases of ductal carcinoma in situ, 5 cases of invasive ductal carcinoma, 10 cases of lobular carcinoma in situ, and 5 cases of invasive lobular carcinoma), 25 cases of benign breast hyperplasia, and 20 healthy individuals.

[0134] The plasma exosomes were processed as follows: 1 ml of plasma was added to an SEC adsorption column containing Capto Core 700 packing material, followed by 0.5 ml of PBS for elution. Another 1.5 ml of PBS was added, and the elution was collected. The final 1.5 ml of elution was the plasma exosomes. The aforementioned MUC1-C* protein sandwich detection system was used to detect the plasma exosomes. The luminescence values ​​of the tested samples were substituted into the standard curve to determine the target content of the corresponding samples. The scatter plot is shown below. Figure 4 As shown, the MUC1-C* protein sandwich system detection showed the best discriminatory power between breast cancer patients and healthy individuals, with a statistically significant difference. ROC analysis is as follows... Figure 5 The area under the curve (AUC) was 0.8542, cutoff value: 4.291 ng / ml; sensitivity: 70%; specificity: 95%. This system also significantly differentiated between breast cancer and benign breast hyperplasia, with an AUC of 0.7493, cutoff value: 3.931 ng / ml; sensitivity: 80%; specificity: 68%.

[0135] Example 5: Construction of the VNTR-MUC1-C* system and plotting of standard curves

[0136] The VNTR-MUC1-C* sandwich detection system includes capture antibody, detection antibody, and protein calibrators. First, the capture antibody is diluted to 2 μg / mL with coating buffer (pH 9.6), and 100 μl is added to each well of the microplate. Incubation is performed overnight at 4°C. After washing, 200 μL of microplate stabilizer is added, and incubation is performed at 37°C for 2 hours. The blocking buffer is discarded, and the plate is blotted dry at 37°C for 30 min. The calibrator protein is serially diluted with protein stabilizer, and 100 μL is added to each well sequentially. Incubation is performed at 37°C for 1.5 hours. The plate is washed three times with washing buffer, and 100 μl of HRP-labeled detection antibody (0.25 μg / mL) is added to each well. Incubation is performed at 37°C for 1 hour. The plate is washed three more times with washing buffer, and substrate chromogenic solution is added. The OD value of each well is measured. The standard concentration is used as the independent variable (X), and the corresponding absorbance value is used as the dependent variable (Y). A logistic regression equation is obtained by fitting the equation using the four-parameter logistic regression method. As shown in Table 4, the results indicate that the capture antibody (manufacturer: Santa Cruz, catalog number: SC7313 HRP) and the detection antibody (manufacturer: Thermo, catalog number: PA5-95487) are well-matched and can be used to construct a double antibody sandwich system. Figure 6 The standard curve for the detection system has a linear range of 0.19–12.5 ng / ml.

[0137] Table 4 Antibody pairings in the VNTR-MUC1-C* sandwich system

[0138]

[0139]

[0140] Example 6: Clinical validation of the VNTR-MUC1-C* sandwich system

[0141] In this embodiment, the sample type tested was plasma exosomes, with a total of 95 samples included. Among them, there were 30 breast cancer patients (10 ductal carcinoma in situ, 5 invasive ductal carcinoma, 10 lobular carcinoma in situ, and 5 invasive lobular carcinoma), 25 patients with benign breast hyperplasia, 20 patients with other cancers (10 colorectal cancer, 6 skin cancer, and 4 gastric cancer), and 20 healthy individuals.

[0142] The plasma exosomes were detected using the aforementioned plasma exosome separation method and the VNTR-MUC1-C* sandwich detection system described in Example 5. The luminescence values ​​of the samples were substituted into the standard curve to determine the target content of the corresponding samples. The scatter plot of sample content is shown below. Figure 7 As shown, the VNTR-MUC1-C* sandwich detection system exhibits good differentiation between breast cancer and healthy individuals; ROC analysis is as follows. Figure 8The area under the curve (AUC) was 0.9525, cutoff value: 3.386 ng / ml; sensitivity: 80%; specificity: 95%. The VNTR-MUC1-C* sandwich assay system also significantly differentiated breast cancer from benign breast hyperplasia, with an AUC of 0.9047, cutoff value: 4.08 ng / ml; sensitivity: 70%; specificity: 96%. The VNTR-MUC1-C* sandwich assay system also showed clinical significance in differentiating breast cancer from other cancer types, with an AUC of 0.8167, cutoff value: 4.189 ng / ml; sensitivity: 70%; specificity: 85%.

[0143] Example 7: Construction and Standard Curve of CD63-MUC1-C* Sandwich System

[0144] The CD63-MUC1-C* sandwich assay system includes a capture antibody, a detection antibody, and a fusion protein calibrator. First, the capture antibody is diluted to 2 μg / mL with coating buffer (pH 9.6) and coated overnight. After blocking and drying the ELISA plate, the CD63:MUC1-C* fusion protein is serially diluted with protein stabilizer, and the calibrator is added sequentially to each well (100 μL), incubated at 37°C for 1.5 hours. The plate is then washed three times with washing buffer, and 100 μL of HRP-labeled detection antibody (0.25 μg / mL) is added to each well, incubated at 37°C for 1 hour. The plate is then washed three more times with washing buffer, and the substrate chromogenic solution is added, and the OD value of each well is measured. Using the standard concentration as the independent variable (X) and its corresponding absorbance value as the dependent variable (Y), a regression equation is obtained by fitting the logistic four-parameter method. As shown in Table 5, the results indicate that the capture antibody (manufacturer: LSBio, catalog number: LS-C320194) and the detection antibody (manufacturer: Thermo, catalog number: MA5-30688) are well-matched and can be used to construct a double antibody sandwich system. Figure 9 The standard curve for the detection system has a linear range of 1.56–50 ng / ml.

[0145] Table 5. Antibody pairing in CD63-MUC1-C* sandwich system

[0146]

[0147] Example 8: Clinical validation of the CD63-MUC1-C* sandwich system

[0148] In this embodiment, the sample type tested was plasma exosomes, with a total of 75 samples included. Among them, there were 30 cases of breast cancer (10 cases of ductal carcinoma in situ, 5 cases of invasive ductal carcinoma, 10 cases of lobular carcinoma in situ, and 5 cases of invasive lobular carcinoma), 25 cases of benign breast hyperplasia, and 20 healthy individuals.

[0149] The plasma exosomes were detected using the aforementioned plasma exosome separation method and the CD63-MUC1-C* sandwich detection system described in Example 7. The luminescence values ​​of the test samples were substituted into the standard curve to obtain the target content of the corresponding samples. The scatter plot of sample content is shown below. Figure 10 As shown, the CD63-MUC1-C* sandwich detection system exhibited the best differentiation between breast cancer and healthy individuals, with a statistically significant difference; ROC analysis is as follows. Figure 11 The area under the curve (AUC) was 0.8392, cutoff value: 5.363 ng / ml; sensitivity: 76.67%; specificity: 80%. The CD63-MUC1-C* sandwich detection system also significantly differentiated between breast cancer and benign breast hyperplasia patients, with an AUC of 0.7960, cutoff value: 5.345 ng / ml; sensitivity: 80%; specificity: 72%.

[0150] Example 9: Construction of CD63-VNTR sandwich system and standard curve

[0151] The CD63-VNTR sandwich detection system includes a capture antibody, a detection antibody, and a fusion protein calibrator. First, the capture antibody is diluted to 2 μg / mL with coating buffer (pH 9.6) and coated overnight at 4°C. After the ELISA plate is blocked and dried, the CD63:VNTR fusion protein is serially diluted with protein stabilizer, and the calibrator is added sequentially to each well (100 μL), incubated at 37°C for 1.5 hours. The plate is then washed three times with washing buffer, and 100 μL of HRP-labeled detection antibody (0.25 μg / mL) is added to each well, incubated at 37°C for 1 hour. The plate is then washed three more times with washing buffer, and the substrate chromogenic solution is added, and the luminescence value of each well is measured. The standard concentration is used as the independent variable (X), and the corresponding absorbance value is used as the dependent variable (Y). A regression equation is obtained by fitting the logistic four-parameter method. As shown in Table 6, the results show that the capture antibody (manufacturer: LSBio, catalog number: LS-C320194) and the detection antibody (manufacturer: Santa Cruz, catalog number: SC7313 HRP) are well matched and can be used to construct a double antibody sandwich system. Figure 12 The standard curve for the detection system has a linear range of 0.78–50 ng / ml.

[0152] Table 6 Antibody Pairing in CD63-VNTR Sandwich System

[0153]

[0154] Example 10: Clinical validation of the CD63-VNTR sandwich system

[0155] In this embodiment, the sample type tested was plasma exosomes, with a total of 95 samples included. Among them, there were 30 breast cancer patients (10 ductal carcinoma in situ, 5 invasive ductal carcinoma, 10 lobular carcinoma in situ, and 5 invasive lobular carcinoma), 25 patients with benign breast hyperplasia, 20 patients with other cancers (10 colorectal cancer, 6 skin cancer, and 4 gastric cancer), and 20 healthy individuals.

[0156] The plasma exosomes were detected using the aforementioned plasma exosome separation method and the CD63-VNTR sandwich detection system described in Example 9. The luminescence values ​​of the tested samples were substituted into the standard curve to determine the target content of the corresponding samples. A scatter plot of sample content is shown below. Figure 13 As shown, the CD63-VNTR sandwich detection system exhibits significant differences in detection results for breast cancer and healthy individuals; ROC analysis is as follows. Figure 14 The area under the curve (AUC) for this assay was 0.9150, with a cutoff value of 6.748 ng / ml; sensitivity was 73.3%; and specificity was 95%. The CD63-VNTR sandwich assay also showed some differentiation between breast cancer and benign breast hyperplasia patients, with an AUC of 0.8673, a cutoff value of 7.030 ng / ml, sensitivity of 73.3%, and specificity of 80%. This sandwich assay also significantly differentiated breast cancer from other cancers, with an AUC of 0.7225, a cutoff value of 7.323 ng / ml, sensitivity of 70%, and specificity of 70%.

[0157] Example 11: Comparison of sample detection results for VNTR-MUC1-C* sandwich system, MUC1-C* sandwich system, CD63-VNTR sandwich system, CD63-MUC1-C* sandwich system, and commercial CA15-3 kit.

[0158] This embodiment tested plasma exosomes, with a total of 55 samples included, of which 35 were from early-stage breast cancer patients (TNM staging: 15 stage I, 10 stage IIA, and 10 stage IIB) and 20 were from healthy individuals. The MUC1-C* sandwich system and the VNTR-MUC1-C* sandwich system were constructed in the above embodiments, respectively. The commercially available CA15-3 reagent kit was from Beijing Furui Runkang Biotechnology Co., Ltd. The scatter plots of the sample detection for the three systems are shown below. Figure 15 As shown, they were all statistically significant in distinguishing healthy individuals from early-stage breast cancer patients. ROC analysis is as follows... Figure 16 As shown, the area under the curve (AUC) of the VNTR-MUC1-C* sandwich system was 0.95, and the AUC of the MUC1-C* sandwich system was 0.8314. The AUC of the CA15-3 kit was 0.8279, indicating that the VNTR-MUC1-C* sandwich system was the most effective in distinguishing between healthy individuals and early-stage breast cancer patients.

[0159] Under the premise of ensuring 100% specificity, the VNTR-MUC1-C* sandwich system had the highest detection rate for early breast cancer, at 48.57%. The detection rates for early breast cancer patients using the MUC1-C* sandwich system, CD63-VNTR sandwich system, and CD63-MUC1-C* sandwich system were 45.71%, 37.14%, and 34.29%, respectively. According to the instructions for the commercially available CA15-3 kit, a CA15-3 detection value greater than or equal to 35 U / ml indicates the detection of breast cancer; therefore, the early breast cancer detection rate of the kit was 17.14%.

[0160] The above results further demonstrate that the VNTR-MUC1-C* system is most effective in the early diagnosis of breast cancer.

[0161] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0162] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. The application of a reagent for detecting the expression of exosome membrane protein MUC1 in the preparation of products for diagnosing breast cancer, characterized in that, The reagents include antibodies that specifically recognize MUC1-C and antibodies that specifically recognize MUC1-VNTR, and the product is produced using a double-antibody sandwich method.

2. The application according to claim 1, characterized in that, The diagnosis of breast cancer includes differentiating breast cancer from benign breast hyperplasia, or differentiating breast cancer from healthy individuals.

3. The application according to claim 2, characterized in that, The antibody that specifically recognizes MUC1-VNTR is used as a capture antibody, and the antibody that specifically recognizes MUC1-C is used as a detection antibody.

Citation Information

Patent Citations

  • MUC1 protein quantitative detection method based on exosome detection and single-molecule fluorescence bleaching technology

    CN113049552A