Probiotic engineering bacteria and drug-loaded nanoparticle hybrid and preparation method and application thereof

Abstract

The present application relates to the field of biological medicine, and discloses a probiotic engineering bacteria and drug-loaded nanoparticle hybrid and a preparation method and application thereof. The hybrid comprises probiotic engineering bacteria and drug-loaded nanoparticles connected with the probiotic engineering bacteria, the probiotic engineering bacteria comprise an expression cassette capable of expressing a PD-L1 nanobody coding gene and / or an expression cassette capable of expressing a sialidase coding gene, and the drug-loaded nanoparticles carry tumor chemotherapy drugs; the preparation method of the hybrid comprises: mixing the probiotic engineering bacteria and the drug-loaded nanoparticles in a solvent I to make the probiotic engineering bacteria connected with the drug-loaded nanoparticles. The hybrid can target tumor sites, realize the combination of immunological drugs and chemotherapy drugs for inducing cell immunogenic death, improve the infiltration of immune cells in tumor sites, increase the immune response of tumors, and synergistically exert a better tumor killing treatment effect.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a probiotic engineered bacteria and drug-loaded nanoparticle hybrid, its preparation method, and its application. Background Technology

[0002] Tumor immunotherapy is one of the hot topics in the field of cancer treatment today. Tumor immunotherapy agents mainly include monoclonal antibody immune checkpoint inhibitors (such as PD-1 / PD-L1 inhibitors and CTLA-4 inhibitors), therapeutic antibodies (such as anti-Her-2 monoclonal antibodies and anti-EGFR monoclonal antibodies), cancer vaccines, cell therapy, and small molecule inhibitors. They achieve anti-tumor effects by regulating the immune circulation at the tumor site and restoring the body's normal anti-tumor response. This provides a good treatment strategy for patients with diffuse tumors that are resistant to chemotherapy drugs and cannot be surgically removed.

[0003] In recent years, bacteria have gradually entered the field of cancer treatment. Their flexible motility, tumor targeting and penetration, immune activation, invasiveness, and cytotoxicity have made them a new research hotspot for intelligent and precise disease treatment. Probiotics have a significant safety advantage over pathogenic bacteria. Driven by the rapid development of synthetic biology in recent years, they can synthesize complex and multifunctional gene circuits, giving them excellent characteristics such as tumor-specific site drug delivery, sustainable drug release, and controllable therapeutic mechanisms. After recombination, they can serve as a novel in vivo carrier for immunotherapeutic drugs, metabolically regulating the tumor microenvironment and thereby improving the efficacy of immunotherapy.

[0004] While novel tumor immunotherapies have brought hope to many patients, not everyone is receptive to these treatments. It is understood that the low abundance of anti-tumor immune cells within solid tumors is a significant reason for the limited application of immunotherapy. In addition to common senescence, apoptosis, and necrosis, tumor cells also undergo immunogenic cell death (ICD). Anthracycline drugs such as doxorubicin and epirubicin, and platinum-based drugs such as oxaliplatin and cisplatin, can all induce immunogenic cell death in tumor cells. Chemotherapy drugs provide the initial impetus for recruiting immune cells by initiating immunogenic cell death, which is of great practical significance for increasing the infiltration of immune cells into the tumor site and thus enhancing the therapeutic effect of immune checkpoint inhibitors.

[0005] However, the immunotherapeutic drugs in recombinant bacteria in the current technology are relatively limited and have poor effects on immune-insensitive tumors with less immune infiltration. In addition, existing protein drugs are easily inactivated and have poor penetration at the tumor site, making it difficult to achieve good tumor treatment results. Summary of the Invention

[0006] The purpose of this invention is to overcome the problems existing in the prior art and provide a probiotic engineered bacteria and drug-loaded nanoparticle hybrid, its preparation method and application. This hybrid can target tumor sites and achieve the combination of immunotherapeutic drugs and chemotherapeutic drugs that induce cellular immunogenic death, thereby increasing the infiltration of immune cells in the tumor site, enhancing the tumor's immune response, and synergistically exerting a better tumor-killing therapeutic effect.

[0007] To achieve the above objectives, the first aspect of the present invention provides a probiotic engineered bacteria and drug-loaded nanoparticle heterozygote, the heterozygote comprising the probiotic engineered bacteria and drug-loaded nanoparticles connected to the probiotic engineered bacteria, the probiotic engineered bacteria comprising an expression cassette capable of expressing a gene encoding a PD-L1 nanobody and / or an expression cassette capable of expressing a gene encoding a sialidase, and the drug-loaded nanoparticles containing tumor chemotherapy drugs.

[0008] Preferably, the amino acid sequence of the PD-L1 nanobody is as shown in SEQ ID NO.1 or SEQ ID NO.2; and the amino acid sequence of the sialidase is as shown in SEQ ID NO.5.

[0009] Preferably, the nucleotide sequence of the encoding gene of the PD-L1 nanobody is as shown in SEQ ID NO.3 or SEQ ID NO.4; and the nucleotide sequence of the encoding gene of the sialidase is as shown in SEQ ID NO.6.

[0010] Preferably, the weight ratio of the probiotic strains to the drug-loaded nanoparticles is 0.01-2:1.

[0011] Preferably, the probiotic is obtained by genetically modifying a starting strain and introducing an expression cassette that can express the gene encoding the PD-L1 nanobody and / or an expression cassette that can express the gene encoding sialidase, wherein the starting strain is selected from at least one of Escherichia coli, Saccharomyces cerevisiae and Bacillus subtilis.

[0012] Preferably, the starting strain is Escherichia coli Nissle 1917.

[0013] Preferably, the drug-loaded nanoparticles include the tumor chemotherapy drug and a nanocarrier encapsulating the tumor chemotherapy drug, wherein the nanocarrier is selected from at least one of liposomes, metal-organic frameworks, and PLGA.

[0014] Preferably, the tumor chemotherapy drug is anthracycline and / or platinum-based drugs, more preferably doxorubicin and / or oxaliplatin.

[0015] Preferably, the weight ratio of the tumor chemotherapy drug to the nanocarrier is 1:2-50.

[0016] A second aspect of the present invention provides a method for preparing a heterozygote of probiotic engineered bacteria and drug-loaded nanoparticles, comprising the following steps: mixing and reacting probiotic engineered bacteria and drug-loaded nanoparticles in solvent I, such that the probiotic engineered bacteria are linked to the drug-loaded nanoparticles; wherein the probiotic engineered bacteria include an expression cassette capable of expressing a gene encoding a PD-L1 nanobody and / or an expression cassette capable of expressing a gene encoding a sialidase, and the drug-loaded nanoparticles contain tumor chemotherapy drugs.

[0017] Preferably, the amino acid sequence of the PD-L1 nanobody is as shown in SEQ ID NO.1 or SEQ ID NO.2; and the amino acid sequence of the sialidase is as shown in SEQ ID NO.5.

[0018] Preferably, the nucleotide sequence of the encoding gene of the PD-L1 nanobody is as shown in SEQ ID NO.3 or SEQ ID NO.4; and the nucleotide sequence of the encoding gene of the sialidase is as shown in SEQ ID NO.6.

[0019] Preferably, the probiotic is obtained by genetically modifying a starting strain and introducing an expression cassette that can express the gene encoding the PD-L1 nanobody and / or an expression cassette that can express the gene encoding sialidase, wherein the starting strain is selected from at least one of Escherichia coli, Saccharomyces cerevisiae and Bacillus subtilis.

[0020] Preferably, the starting strain is Escherichia coli Nissle 1917.

[0021] Preferably, the drug-loaded nanoparticles include the tumor chemotherapy drug and a nanocarrier encapsulating the tumor chemotherapy drug, wherein the nanocarrier is selected from at least one of liposomes, metal-organic frameworks, and PLGA.

[0022] Preferably, the tumor chemotherapy drug is anthracycline and / or platinum-based drugs, more preferably doxorubicin and / or oxaliplatin.

[0023] Preferably, the weight ratio of the tumor chemotherapy drug to the nanocarrier is 1:2-50.

[0024] Preferably, solvent I is PBS buffer or water.

[0025] Preferably, the process of mixing the probiotics with the drug-loaded nanoparticles includes: mixing the probiotics with a portion of the solvent I to form a probiotic culture, mixing the drug-loaded nanoparticles with another portion of the solvent I to form a drug-loaded nanoparticle solution, and then mixing the probiotic culture with the drug-loaded nanoparticle solution and stirring.

[0026] Preferably, the weight ratio of the solvent I, the probiotic engineered bacteria, and the drug-loaded nanoparticles is 300-11000:0.01-2:1, and the volume ratio of the probiotic engineered bacteria solution to the drug-loaded nanoparticle solution is 10-2:1.

[0027] Preferably, the stirring conditions include at least the following: a temperature of 5-40°C and a time of 1-18 hours.

[0028] Preferably, the preparation method further includes: performing solid-liquid separation on the reaction solution obtained from the mixed reaction to obtain a crude product precipitate, and washing the crude product precipitate.

[0029] Preferably, the washing agent is PBS buffer, and the washing is performed 2-4 times.

[0030] The third aspect of this invention provides the application of the aforementioned probiotic engineered bacteria and drug-loaded nanoparticle hybrid molecule, and the probiotic engineered bacteria and drug-loaded nanoparticle hybrid molecule prepared by the aforementioned preparation method, in the preparation of antitumor drugs.

[0031] Preferably, the antitumor drug is a drug for treating breast cancer and / or melanoma.

[0032] The beneficial effects of the present invention through the above technical solution are as follows:

[0033] The heterozygote provided by this invention connects probiotic engineered bacteria with drug-loaded nanoparticles to form an integrated complex. The probiotic engineered bacteria can secrete protein drugs for immunotherapy, such as PD-L1 nanobodies and / or sialidase. The live probiotic engineered bacteria release PD-L1 nanobodies and / or sialidase in real time, solving the problem of easy inactivation and ineffectiveness of protein drugs. At the same time, by utilizing the autonomous activity of the live probiotic engineered bacteria and their targeting to anaerobic sites of tumors, they can secrete and express immunotherapeutic drugs in response to the tumor microenvironment, so that the immunotherapeutic drugs can achieve local enrichment at the tumor site. While the probiotic engineered bacteria release immunotherapeutic drugs in real time, the drug-loaded nanoparticles can release chemotherapeutic drugs, which can not only kill tumor cells, but also induce immunogenic death of tumor cells and stimulate innate and adaptive immunity. This realizes the combination of immunotherapeutic drugs and chemotherapeutic drugs, increases immune infiltration at the tumor site, improves the immune environment at the tumor site, and enhances the tumor's immune response, thus synergistically exerting a better tumor-killing and therapeutic effect. It has significant advantages, especially in the treatment of tumor patients who cannot undergo conventional surgical resection and have low immune responsiveness. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the pSU2718-eSLC recombinant plasmid in this invention;

[0035] Figure 2This is an agarose gel electrophoresis image of the colonies obtained by introducing the pTrc99a-PD-L1 recombinant plasmid into Escherichia coli Nissle 1917 in Example 1 after PCR.

[0036] Figure 3 The images show SDS-PAGE images of whole bacterial protein samples, periplasmic protein samples, and extracellular supernatant samples of the probiotic engineered bacteria EcN(pTrc99a-PD-L1) in Example 2, which were induced by hypoxia to secrete and express PD-L1. (The white boxes indicate the target protein being expressed.) Among them, (a) is the whole bacterial protein sample, (b) is the periplasmic protein sample, and (c) is the extracellular supernatant sample.

[0037] Figure 4 The cell viability (A and B) and IC50 after treatment with free doxorubicin hydrochloride and doxorubicin liposomes for 24 h and 48 h in Example 3 are shown. 50 Calculations (C and D);

[0038] Figure 5 This is the flow cytometry data of CRT generated on the surface of B16F10 cells induced by free doxorubicin hydrochloride and doxorubicin liposomes in Example 3 (**p<0.01, vs control);

[0039] Figure 6 These are transmission electron microscope images of the probiotic engineered bacteria EcN(pTrc99a-PD-L1), doxorubicin liposomes, and heterozygotes in Example 4, where A is doxorubicin liposomes, B is the probiotic engineered bacteria EcN(pTrc99a-PD-L1), and C is a heterozygote;

[0040] Figure 7 This is a graph showing the content of CD8+ T cells in the tumor immune microenvironment under different conditions and the curves of tumor growth inhibition in Example 4. In this graph, A is the PBS group, B is the heterozygous DOX@Lip / aPD-L1@EcN group, C is the probiotic EcN(pTrc99a-PD-L1) group, and D is the tumor growth curve of the three groups.

[0041] Figure 8 The images show the effects of the probiotic engineered bacteria and heterozygotes prepared in Examples 6-7 of the test cases, as well as the heterozygotes prepared in Comparative Example 1 and the Escherichia coli Nissle 1917 described in Comparative Example 2 on inhibiting tumor growth. Detailed Implementation

[0042] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0043] The first aspect of the present invention provides a probiotic engineered bacteria and drug-loaded nanoparticle heterozygote, the heterozygote comprising the probiotic engineered bacteria and drug-loaded nanoparticles connected to the probiotic engineered bacteria, the probiotic engineered bacteria comprising an expression cassette capable of expressing a gene encoding a PD-L1 nanobody and / or an expression cassette capable of expressing a gene encoding a sialidase, and the drug-loaded nanoparticles containing a tumor chemotherapy drug.

[0044] The heterozygote provided by this invention connects probiotic engineered bacteria with drug-loaded nanoparticles to form an integrated complex. The probiotic engineered bacteria can secrete protein drugs for immunotherapy, such as PD-L1 nanobodies and / or sialidase. The live probiotic engineered bacteria release PD-L1 nanobodies and / or sialidase in real time, solving the problem of easy inactivation and ineffectiveness of protein drugs. At the same time, by utilizing the autonomous activity of the live probiotic engineered bacteria and their targeting to anaerobic sites of tumors, they can secrete and express immunotherapeutic drugs in response to the tumor microenvironment, so that the immunotherapeutic drugs can achieve local enrichment at the tumor site. While the probiotic engineered bacteria release immunotherapeutic drugs in real time, the drug-loaded nanoparticles can release chemotherapeutic drugs, which can not only kill tumor cells, but also induce immunogenic death of tumor cells and stimulate innate and adaptive immunity. This realizes the combination of immunotherapeutic drugs and chemotherapeutic drugs, increases immune infiltration at the tumor site, improves the immune environment at the tumor site, and enhances the tumor's immune response, thus synergistically exerting a better tumor-killing and therapeutic effect. It has significant advantages, especially in the treatment of tumor patients who cannot undergo conventional surgical resection and have low immune responsiveness.

[0045] According to the present invention, the PD-L1 nanobody refers to an inhibitor of the PD-L1 protein that binds to PD-1 on tumor cells and T lymphocytes, and any PD-L1 nanobody protein can be selected. Preferably, the amino acid sequence of the PD-L1 nanobody is as shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene of the PD-L1 nanobody is as shown in SEQ ID NO.3; or, the PD-L1 nanobody with the amino acid sequence shown in SEQ ID NO.1 is subjected to molecular docking and molecular dynamics simulation to obtain a mutant sequence of the PD-L1 nanobody, the amino acid sequence of which is shown in SEQ ID NO.2, and the nucleotide sequence of the encoding gene of the PD-L1 nanobody is as shown in SEQ ID NO.4.

[0046] According to the present invention, preferably, the amino acid sequence of the sialidase is as shown in SEQ ID NO.5, and in this case, the nucleotide sequence of the gene encoding the sialidase is as shown in SEQ ID NO.6.

[0047] According to the present invention, preferably, the weight ratio of the probiotic strains to the drug-loaded nanoparticles is 0.01-2:1. The inventors of the present invention have found that, under this preferred embodiment, it is beneficial for immunotherapeutic drugs and chemotherapeutic drugs to form a better synergistic therapeutic effect.

[0048] According to the present invention, preferably, the probiotic engineered bacteria are obtained by genetically engineering a starting strain to introduce an expression cassette that can express the coding gene of PD-L1 nanobodies and / or an expression cassette that can express the coding gene of sialidase.

[0049] In this invention, genetic engineering modification can be performed by introducing recombinant plasmids or by gene editing technology. For example, the recombinant plasmid can be constructed by first constructing an expression cassette containing a gene encoding the PD-L1 nanobody or an expression cassette containing a gene encoding sialidase, and then introducing the corresponding recombinant plasmid into the starting strain.

[0050] In this invention, the recombinant plasmid can be constructed using various methods known in the art for constructing recombinant plasmids, by ligating the target gene fragment into a plasmid vector, such as, but not limited to, the classic "enzyme digestion-ligation" method, the Gateway cloning system developed by Invitrogen, the Creator cloning system developed by Clontech, the Univector cloning system developed by Stephen Elledge's laboratory, and the GoldenGate cloning method based on type IIs restriction endonucleases.

[0051] In this invention, the recombinant plasmid is constructed based on the pTrc99a plasmid and contains a signal peptide, a hypoxia promoter, and a gene encoding either a PD-L1 nanobody or a sialidase (Sia) gene. The hypoxia promoter can be a PfnrS promoter, fnrS promoter, nirB promoter, narG promoter, or aspA promoter, etc. The signal peptide is a conventional bacterial signal peptide, specifically an OmpA signal peptide, pelB signal peptide, MalE signal peptide, or OmpC signal peptide, etc. For example, the recombinant plasmid pTrc99a-aPD-L1 or pTrc99a-Sia can be constructed based on the pTrc99a plasmid to secrete and express PD-L1 nanobody or sialidase in response to a hypoxic environment. After being introduced into the starting strain, it yields a probiotic engineered bacterium capable of secreting and expressing PD-L1 nanobody or sialidase in a hypoxic environment.

[0052] Furthermore, based on the introduction of recombinant plasmid pTrc99a-Sia into the starting strain, a recombinant plasmid containing a gene capable of quorum sensing and periodic cleavage can also be introduced. This enables the probiotic strain to secrete and express sialidase under tumor hypoxic conditions and possess periodic cleavage function. For example, the recombinant plasmid pSU2718-eSLC, which enables the gene for quorum sensing and periodic cleavage, is used. Figure 1 The image shows a plasmid modified from the pTrc99a plasmid, containing... The gene cleavage circuit, wherein the amino acid sequence of luxI is shown in SEQ ID No. 7 and the nucleotide sequence is shown in SEQ ID No. 8, and the amino acid sequence of luxR is shown in SEQ ID No. 9 and the nucleotide sequence is shown in SEQ ID No. 10. The amino acid sequence is shown in SEQ ID No. 11, and the nucleotide sequence is shown in SEQ ID No. 12.

[0053] After obtaining recombinant plasmids containing expression cassettes encoding genes capable of expressing PD-L1 nanobodies and / or expression cassettes containing expression cassettes encoding genes capable of expressing sialidase, the corresponding recombinant plasmids can be introduced into the starting strain using conventional methods in the art, such as, but not limited to, microinjection, gene gun, transformation (e.g., electroporation), infection, or transfection. Microinjection, gene gun, transformation, infection, or transfection are all conventional operations in the art. For example, transformation refers to treating cells using known methods in molecular biology and genetic engineering to make the treated cells competent, thereby allowing them to come into contact with exogenous DNA, thus allowing the exogenous DNA to enter the competent cells. Commonly used transformation methods include protoplast transformation, chemical transformation, and electroporation transformation. Infection refers to using artificially modified bacteriophages or live viruses as vectors, recombining the vector with the target DNA sequence, and then packaging the recombinant DNA into viable bacteriophages or viruses in vitro using the capsid proteins of the bacteriophage or virus, thereby allowing the recombinant DNA to enter the host cell via infection. Transfection refers to the process of treating cells into competent cells using methods such as CaCl2 or electroporation, and then allowing these competent cells to accept recombinant phage DNA.

[0054] After introducing a recombinant plasmid containing an expression cassette encoding a gene capable of expressing PD-L1 nanobodies and / or a recombinant plasmid containing an expression cassette encoding a gene capable of expressing sialidase into the starting strain, positive clones can be screened by selection markers (e.g., resistance genes) and verified by genomic PCR or by genomic DNA sequencing to obtain the probiotic engineered bacteria.

[0055] According to the present invention, the starting strain is a conventional probiotic, which may be selected from at least one of Escherichia coli, Saccharomyces cerevisiae, and Bacillus subtilis. Preferably, the starting strain is Escherichia coli Nissle 1917.

[0056] For example, probiotics expressing PD-L1 nanobodies under tumor hypoxia were obtained by transforming Escherichia coli Nissle 1917 competent cells with the pTrc99a-aPD-L1 recombinant plasmid; probiotics expressing sialidase under tumor hypoxia were obtained by transforming Escherichia coli Nissle 1917 competent cells with the pTrc99a-sia recombinant plasmid; and probiotics expressing sialidase and having periodic lysis function under tumor hypoxia were obtained by transforming Escherichia coli Nissle 1917 competent cells with the pTrc99a-nanH recombinant plasmid and the pSU2718-eSLC recombinant plasmid.

[0057] In this invention, the surface of the drug-loaded nanoparticles has groups capable of reacting with amino groups, such as aldehyde groups and carboxyl groups, allowing the drug-loaded nanoparticles to form linkages with the amino groups on probiotic engineered bacteria through the aldehyde or carboxyl groups, thereby forming the heterozygote. Preferably, the drug-loaded nanoparticles include the tumor chemotherapy drug and a nanocarrier encapsulating the tumor chemotherapy drug, wherein the nanocarrier is selected from at least one of liposomes, metal-organic frameworks (MOFs), and PLGAs.

[0058] In this invention, tumor chemotherapy drugs and nanocarriers such as liposomes, metal-organic frameworks and PLGA can be commercially available or prepared by means of methods disclosed in the prior art.

[0059] In this invention, the drug-loaded nanoparticles can be commercially available or prepared in-house using existing methods.

[0060] For example, when the nanocarrier is a liposome, the preparation method of the drug-loaded nanoparticles includes: mixing soybean lecithin, cholesterol, and DSPE-PEG-CHO in a weight ratio of 5-10:1-3:1, then mixing with chloroform to form a chloroform solution; rotary evaporating the chloroform solution at a temperature of 35-45°C to form a thin film; adding ammonium sulfate solution and rotary evaporating for hydration for 25-35 minutes to obtain a blank liposome solution; briefly sonicating the blank liposome solution in an ice bath, and then sequentially passing it through 0.45μm and 0.22μm nanometers. Microporous membranes are used for granulation, followed by dialyzing with physiological saline or PBS buffer (0.01M, pH 7.4) for 12-24 hours to obtain blank liposomes. The blank liposomes are then mixed with an aqueous solution of tumor chemotherapy drugs (drug-liposome ratio of approximately 1:5 to 1:20) and incubated in a water bath at 55-65℃ for 25-35 minutes to obtain tumor chemotherapy drug liposome precipitates. These precipitates are then dialyzed with physiological saline or PBS buffer (0.01M, pH 7.4) for 12-24 hours to obtain tumor chemotherapy drug liposomes, which are the drug-loaded nanoparticles.

[0061] When the nanocarrier is a metal-organic framework (MOF), the preparation method of drug-loaded nanoparticles includes: mixing and fully dissolving 0.1-0.5 g of Zn(OAc)₂ with DMF to form a Zn(OAc)₂ solution as reaction solution I; reaction solution II and the initial solution are both: mixing 0.005-0.1 g of imidazole-2-carboxaldehyde (2-ICA) with DMF and ultrasonically dissolving in a water bath for 2-5 min to form an imidazole-2-carboxaldehyde solution; at a reaction temperature of 25-35℃, reaction solution I and reaction solution II are simultaneously added to the initial solution at a rate of 0.3-0.8 mL / min, and the reaction is carried out for 50 min. After the reaction, centrifugation is performed to obtain ZIF-90 precipitate, which is then washed with DMF. The ZIF-90 powder was obtained by washing once with methanol, then washing three times with methanol, and finally drying at 35-45℃. The ZIF-90 powder was mixed with 5-12 mL of ultrapure water, sonicated for 15-25 min, and then polyvinylpyrrolidone (PVP) was added to dissolve it completely, so as to obtain a ZIF-90 aqueous solution with a concentration of 0.1-0.5 mg / mL. The oxaliplatin aqueous solution was mixed with the ZIF-90 aqueous solution, stirred at room temperature for 12-24 h, and then centrifuged to obtain the drug-loaded nanoparticle precipitate. The drug-loaded nanoparticle precipitate was washed multiple times with PBS buffer to remove unloaded oxaliplatin, and the drug-loaded nanoparticle precipitate was obtained.

[0062] In this invention, the tumor chemotherapy drug can be any type of chemotherapy drug. Preferably, the tumor chemotherapy drug is anthracycline and / or platinum-based drugs, more preferably doxorubicin and / or oxaliplatin. The inventors have found that, under this preferred embodiment, the chemotherapy drug can better induce tumor immunogenic death, increase the infiltration of immune cells at the tumor site, and enhance the killing effect of the heterozygote on tumor cells.

[0063] According to the present invention, preferably, the weight ratio of the tumor chemotherapy drug to the nanocarrier is 1:2-50. The inventors have found that, under this preferred embodiment, the heterozygous tumor chemotherapy drug and the real-time formed immune protein drug can form a better synergistic effect.

[0064] A second aspect of the present invention provides a method for preparing a heterozygote of probiotic engineered bacteria and drug-loaded nanoparticles, comprising the following steps: mixing and reacting probiotic engineered bacteria and drug-loaded nanoparticles in solvent I, such that the probiotic engineered bacteria are linked to the drug-loaded nanoparticles; wherein the probiotic engineered bacteria include an expression cassette capable of expressing a gene encoding a PD-L1 nanobody and / or an expression cassette capable of expressing a gene encoding a sialidase, and the drug-loaded nanoparticles contain tumor chemotherapy drugs.

[0065] The method for preparing probiotic engineered bacteria and drug-loaded nanoparticle hybrids provided by this invention is simple and mild, which is beneficial for its application in the production of anti-tumor drugs.

[0066] In this invention, the probiotic engineered bacteria can be obtained by fermentation culture of genetically modified probiotic engineered bacteria strains. Exemplarily, the probiotic engineered bacteria strain is inoculated into an engineered bacteria culture medium and cultured at 30-45℃ for 10-20 hours to obtain a fermentation broth. The fermentation broth is then centrifuged at 4000-8000 rpm for 2-5 minutes to obtain the probiotic engineered bacteria cells, which are used as raw materials for preparing heterozygotes. The engineered bacteria culture medium can be selected according to the starting strain of the probiotic engineered bacteria. For example, when the starting strain is *Escherichia coli* Nissle 1917, the engineered bacteria culture medium can be LB medium.

[0067] According to the present invention, preferably, the amino acid sequence of the PD-L1 nanobody is as shown in SEQ ID NO.1 or as shown in SEQ ID NO.2; and the amino acid sequence of the sialidase is as shown in SEQ ID NO.5.

[0068] According to the present invention, preferably, the nucleotide sequence of the encoding gene of the PD-L1 nanobody is as shown in SEQ ID NO.3 or SEQ ID NO.4; and the nucleotide sequence of the encoding gene of the sialidase is as shown in SEQ ID NO.6.

[0069] According to the present invention, preferably, the probiotic is obtained by genetically modifying a starting strain and introducing an expression cassette that can express the coding gene of PD-L1 nanobody and / or an expression cassette that can express the coding gene of sialidase, wherein the starting strain is selected from at least one of Escherichia coli, Saccharomyces cerevisiae and Bacillus subtilis.

[0070] According to the present invention, preferably, the starting strain is Escherichia coli Nissle 1917.

[0071] According to the present invention, preferably, the drug-loaded nanoparticles include the tumor chemotherapy drug and a nanocarrier encapsulating the tumor chemotherapy drug, wherein the nanocarrier is selected from at least one of liposomes, metal-organic frameworks and PLGA.

[0072] According to the present invention, preferably, the tumor chemotherapy drug is an anthracycline and / or a platinum-based drug, more preferably doxorubicin and / or oxaliplatin.

[0073] According to the present invention, preferably, the weight ratio of the tumor chemotherapy drug to the nanocarrier is 1:2-50.

[0074] According to the present invention, preferably, the solvent I is PBS buffer or water, so as to improve the stability of the linkage between probiotics and drug-loaded nanoparticles after reaction; more preferably, it is 0.1M PBS buffer.

[0075] According to the present invention, preferably, the process of mixing and reacting the probiotics with drug-loaded nanoparticles includes: mixing the probiotics with a portion of solvent I to form a probiotic culture; mixing the drug-loaded nanoparticles with another portion of solvent I to form a drug-loaded nanoparticle solution; and then mixing the probiotic culture and the drug-loaded nanoparticle solution and stirring. The inventors have found that, under this preferred embodiment, it is beneficial to improve the sufficiency of the reaction between the probiotics and the drug-loaded nanoparticles and to increase the efficiency of heterozygote preparation. More preferably, the OD of the probiotic culture is 0.1-6, and the volume ratio of the probiotic culture to the drug-loaded nanoparticle solution is 10-2:1.

[0076] According to the present invention, preferably, the weight ratio of the solvent I, the probiotic engineered bacteria and the drug-loaded nanoparticles is 300-11000:0.01-2:1.

[0077] According to the present invention, preferably, the stirring conditions include at least: a temperature of 5-40°C and a time of 1-18 hours. The inventors have found that this preferred embodiment is beneficial for improving the linkage effect between probiotics and drug-loaded nanoparticles, and enhancing the stability of the heterozygote.

[0078] According to the present invention, preferably, the preparation method further includes: performing solid-liquid separation on the reaction solution obtained from the mixed reaction to obtain a crude product precipitate, and washing the crude product precipitate. In the present invention, solid-liquid separation can be performed using common separation methods such as centrifugation and filtration. For example, the reaction solution can be centrifuged at a speed of 4000-8000 rpm for 3-5 min to remove the supernatant and obtain the crude product precipitate.

[0079] According to the present invention, preferably, the washing agent is PBS buffer (0.01M, pH 7.4), and the washing is performed 2-4 times. The inventors have found that this preferred embodiment is beneficial to the purity of the heterozygote and avoids interference from impurities in the combined use of immunotherapeutic and chemotherapeutic drugs.

[0080] The third aspect of this invention provides the application of the aforementioned probiotic engineered bacteria and drug-loaded nanoparticle hybrid molecule, and the probiotic engineered bacteria and drug-loaded nanoparticle hybrid molecule prepared by the aforementioned preparation method, in the preparation of antitumor drugs.

[0081] The probiotic engineered bacteria and drug-loaded nanoparticle hybrids provided by this invention can significantly increase the content of cytotoxic T cells in tumor tissue, amplify the local immune response of the tumor, and have a better inhibitory effect on tumor proliferation, thus exhibiting a significant anti-tumor effect.

[0082] According to the present invention, the tumor chemotherapy drugs loaded in the drug-loaded nanoparticles generally have broad-spectrum activity. The heterozygotes provided by the present invention can be used to prepare therapeutic drugs for a variety of tumors (e.g., breast cancer, melanoma, lung cancer, gastric cancer, colorectal cancer, etc.). Preferably, the antitumor drug is a drug for treating breast cancer and / or melanoma.

[0083] In this invention, the dosage form of the antitumor drug can be a liquid formulation, which can be prepared according to conventional methods in the art and may also contain a pharmaceutically acceptable carrier. The content of probiotic engineered bacteria and drug-loaded nanoparticle heterozygotes in the antitumor drug can be designed and adjusted according to the dosage.

[0084] In this invention, probiotic engineered bacteria and drug-loaded nanoparticle heterozygotes can be fully dispersed in PBS buffer (0.01M, pH 7.4) and used in the research and development and production of anti-tumor drugs.

[0085] The present invention will be described in detail below through embodiments.

[0086] In the following examples, the Gibson assembly steps were performed according to the instructions of the Beyotime Seamless Cloning Enzyme Kit; Escherichia coli Nissle 1917 was purchased from Beijing Biobw Biotechnology Co., Ltd. (NCBI serial number: NZ_CP022686.1); and melanoma cells B16F10 were purchased from Wuhan Pronoss Co., Ltd. (ATCC, CRL-6475).

[0087] The LB medium formula is as follows: Add 10g of tryptone, 5g of yeast extract and 10g of NaCl to 950mL of deionized water, shake the container until the solute is dissolved, adjust the pH to 7.0 with 5mol / L NaOH solution, and make up the volume to 1L with deionized water. Sterilize by steam and use for later use.

[0088] The preparation process of Escherichia coli Nissle 1917 competent cells (EcN competent cells) is as follows: EcN is inoculated into LB medium and cultured overnight (12-18 h) at 37℃ and 220 rpm on a shaker to obtain EcN bacterial suspension I; then, 1 mL of the obtained EcN bacterial suspension I is transferred to a 100 mL Erlenmeyer flask containing antibiotic-free LB medium and amplified at 37℃ and 220 rpm on a shaker for 2 h until OD... 600 EcN bacterial suspension II was obtained by reaching a concentration of approximately 0.5. EcN bacterial suspension II was aliquoted into two pre-chilled sterile 50 mL centrifuge tubes, 50 mL per tube. The tubes were placed on ice for 10 min, centrifuged at 4000 rpm for 10 min at 4°C, and the supernatant was discarded to obtain bacterial precipitate. The bacterial precipitate was resuspended in 10 mL of pre-chilled 0.1 M CaCl2 solution, allowed to stand on ice for 30 min, and then centrifuged at 4000 rpm for 10 min at 4°C. The supernatant was discarded, and the bacterial cells were resuspended in 1 mL of pre-chilled 0.1 M CaCl2 solution containing 10% glycerol. The suspension was aliquoted into pre-chilled 1.5 mL centrifuge tubes at 100 μL per tube and stored at -80°C.

[0089] Example 1

[0090] 1.1 Construction of pTrc99a-aPD-L1 recombinant plasmid

[0091] a. PD-L1 Nanobody Expression Kit: The amino acid sequence of the PD-L1 nanobody is shown in SEQ ID NO.1, selected from the RCSB PDB database (PDB ID: 5DXW), and the nucleotide sequence shown in SEQ ID NO.3 was obtained by reverse translation. The PD-L1 nanobody expression kit PfnrS-RBS-OmpA-PD-L1 was constructed, where PfnrS is a hypoxia promoter, the RBS nucleotide sequence was predicted by RBS Calculator (https: / / salislab.net / software / reverse), and OmpA is a commonly used signal peptide of Escherichia coli. The nucleotide sequence of the PD-L1 nanobody expression kit is shown in SEQ ID NO.13.

[0092] PD-L1 nanobody expression cassette (SEQ ID No. 13): In this sequence, the italicized part is the PfnrS nucleotide sequence, the lowercase part is the RBS sequence, the underlined part is the OmpA signal peptide nucleotide sequence, and the regular uppercase part is the PD-L1 nanobody nucleotide sequence.

[0093] b. Preparation of pTrc99a-PD-L1 recombinant plasmid

[0094] The SfoⅠ and BamHI restriction sites on the pTrc99a plasmid were selected as integration sites. Linearized vector fragments were obtained through enzyme digestion and gel recovery. The PD-L1 nanobody expression cassette was synthesized by Qingke Biotechnology Co., Ltd. The pTrc99a plasmid backbone and the aforementioned PD-L1 nanobody expression cassette PfnrS-RBS-OmpA-PD-L1 were connected using Gibson assembly to construct the pTrc99a-PD-L1 recombinant plasmid containing the PD-L1 nanobody expression cassette.

[0095] 1.2 Construction of probiotic engineered bacteria

[0096] After thawing EcN competent cells on ice, 5 μL of pTrc99a-aPD-L1 recombinant plasmid was added. The mixture was incubated on ice for 30 min, followed by heat shock at 42℃ for 90 s, then incubated on ice for 3 min. 1 mL of LB medium was added, and the mixture was incubated at 37℃ and 220 rpm for 40-60 min. After incubation, the mixture was centrifuged at 4000 rpm for 10 min, and 1 mL of the supernatant (remaining 100 μL) was aspirated. The supernatant was then evenly spread onto 100 μg / mL ampicillin-resistant plates for further incubation. Ten single colonies grew on each plate, numbered 1-10. Colony PCR identification was performed, as detailed below:

[0097] Preparation of the PCR system: 50 μL Taq enzyme + 40 μL ddH2O + 4 μL upstream primer PD-L1-F (nucleotide sequence as shown in SEQ ID No. 14) + 4 μL downstream primer PD-L1-R (nucleotide sequence as shown in SEQ ID No. 15), 9.8 μL per tube, and mixed in single colonies (corresponding to 1-10 respectively), for PCR amplification; PCR amplification conditions: pre-denaturation: 95℃ for 5 min, denaturation: 95℃ for 15 s, annealing: 60℃ for 15 s, extension: 72℃ for 40 s, 33 cycles, final extension: 72℃ for 5 min;

[0098] PD-L1-F(5'-3'): TGGCGCCTAACAAAAGCAA (SEQ ID No. 14),

[0099] PD-L1-R(5'-3'): AGGTCGACTCTAGAGGATCCTTAATG (SEQ ID No. 15);

[0100] Agarose gel electrophoresis: PCR amplification products from 10 single colonies were subjected to gel electrophoresis at a sample volume of 1.5 μL and a voltage of 140 V. The results are shown in the figure. Figure 2 All 10 single colonies showed bands. Colony No. 4 was picked and inoculated into Amp-resistant LB medium and cultured at 37°C and 220 rpm for 12 h. Plasmid was extracted from the bacterial culture and sequenced. The sequencing results were correct. Colony No. 4 was used as the probiotic engineered strain EcN (pTrc99a-PD-L1) with the pTrc99a-PD-L1 recombinant plasmid.

[0101] Example 2: Probiotic expression of PD-L1 nanobodies

[0102] The probiotic engineered bacteria EcN (pTrc99a-PD-L1) was inoculated into 5 mL of LB liquid medium (Amp+) overnight to obtain the primary culture medium. 500 μL of the primary culture medium was inoculated into 50 mL of fresh liquid medium (Amp+) and cultured until OD = 0.6-0.8 to obtain the secondary culture medium. 1 mL of the secondary culture medium was taken as the pre-induction sample and centrifuged at 12000 rpm for 1 min. The supernatant was collected to obtain precipitate I and stored at 4℃. The supernatant was induced under hypoxic conditions for 0, 2, 4, 6, 8, 12, 24, 36, and 48 h respectively, and 1 mL of the sample was taken and centrifuged at 12000 rpm for 1 min. The extracellular supernatant was collected for later use. The separated precipitate II was stored at 4℃.

[0103] Periplasmic protein extract was prepared using the osmotic shock method (two steps: plasmolysis and outer membrane rupture). Specifically: a. Precipitate I was washed three times with 10 mM Tris-HCl (pH 8.0); b. After washing, 200 μL of hypertonic solution (20% sucrose, 20 mM Tris-HCl, 5 mM EDTA, pH 8.0) was added to precipitate I, mixed thoroughly, and placed in an ice bath for 30 min; c. The cells were collected by centrifugation, and then 100 μL of 5 mM MgSO4 solution was added, mixed thoroughly, and placed in an ice bath for 30 min. The supernatant was then collected by centrifugation, which is the periplasmic protein extract.

[0104] Sample preparation: Add precipitate I to 100 μL PBS buffer and mix well to obtain a suspension. Take 30 μL of the suspension and mix with 10 μL 4× protein loading buffer (containing DTT) and treat at 95℃ for 5 min. Then centrifuge at 12000 rpm for 5 min. The supernatant is used as the whole bacterial protein sample. Take 30 μL of extracellular supernatant or periplasmic protein extract and mix with 10 μL 4× protein loading buffer (containing DTT) respectively and treat at 95℃ for 5 min. Then centrifuge at 12000 rpm for 5 min. The supernatant is used as the extracellular supernatant sample or the periplasmic protein sample.

[0105] The above samples were subjected to SDS-PAGE gel electrophoresis (separating gel concentration 15%) with a sample volume of 10 μL. The results are shown in the figure. Figure 3 The results showed that after 2 hours of induction, the probiotic engineered bacteria EcN(pTrc99a-PD-L1) produced a clear band of expression product with a size of approximately 17 kDa in the electrophoresis images of the bacterial cells and periplasmic protein samples. However, a clear band was only observed in the extracellular supernatant after 24 hours of induction, and the band deepened over time. This indicates that the PD-L1 nanobody in the probiotic engineered bacteria EcN(pTrc99a-PD-L1) can be expressed intracellularly and can enter the supernatant after a certain period of time.

[0106] Example 3

[0107] 3.1 Preparation of drug-loaded nanoparticles (doxorubicin hydrochloride liposomes)

[0108] Soybean lecithin, cholesterol, and DSPE-PEG-CHO were mixed in a weight ratio of 4:1:0.5, dissolved in 5 mL of chloroform, and evaporated at 40 °C to form a thin film. Then, 0.25 mol / L ammonium sulfate solution was added, and the mixture was hydrated by rotary evaporation for 30 min to obtain a blank liposome solution. The blank liposome solution was briefly sonicated in an ice bath (1 s sonication, 2 s interval, 30% intensity, 10 min), and then sequentially passed through 0.45 μm and 0.22 μm microporous membranes for granulation. The liposomes were dialyzed with 1 L of 0.9% physiological saline for 20 h to obtain blank liposomes. An aqueous solution of doxorubicin hydrochloride (drug-liposome ratio approximately 1:10) was added to 1 mL of the dialyzed blank liposomes, and the mixture was incubated in a 60 °C water bath for 30 min to obtain doxorubicin hydrochloride liposome precipitate. This precipitate was then dialyzed with 1 L of 0.9% physiological saline for 20 h to obtain doxorubicin liposomes (hereinafter referred to as Dox-Lip).

[0109] 3.2 Cytotoxicity of Doxorubicin Hydrochloride and Doxorubicin Liposomes

[0110] Logarithmic growth phase melanoma cells B16F10 were collected after digestion with 0.25% trypsin, resuspended in DMEM containing 10% FBS, and seeded at a concentration of 5000-6000 cells / well in 96-well plates. The cells were cultured at 37℃ and 5% CO2 (v / v) until adherence, then the old culture medium was discarded. Doxorubicin hydrochloride (Dox·HCl) at concentrations of 0, 0.01, 0.1, 0.2, 0.5, 1, 2, 5, 8, and 10 μg / mL were added to the corresponding wells. 100 μL of Dox-Lip culture medium was added, with blank control wells (containing DMEM blank medium) and zeroing wells (containing PBS buffer), 6 replicates per group. After co-incubation for 24 h or 48 h, the liquid in the wells was discarded, and 100 μL of 0.5 mg / mL MTT was added to each well for further incubation for 4 h. After removing the MTT, 150 μL of DMSO was added to each well to fully dissolve the formazan crystals at the bottom. The absorbance was measured at 570 nm using a microplate reader, and the cell viability was calculated according to the following formula. The results are as follows: Figure 4 As shown.

[0111]

[0112] Among them, OD sample The absorbance value of the drug delivery well, OD blank The absorbance value of the zeroing aperture, OD control This is the absorbance value of the control well.

[0113] Figure 4 The results showed that, after 24 hours of drug treatment, the IC50 values ​​of free doxorubicin hydrochloride and doxorubicin liposomes were significantly reduced. 50The concentrations were 0.35 μg / mL and 0.58 μg / mL, respectively. Since free doxorubicin in its initial state can rapidly enter cells via passive diffusion to produce a tumor-killing effect, while the release and phagocytosis of doxorubicin liposomes are time-dependent, the toxicity of free doxorubicin was greater than that of doxorubicin liposomes at 24 h. When treated with the drug for 48 h, the IC50 values ​​for free doxorubicin and doxorubicin liposomes were... 50 The concentrations were 0.61 μg / mL and 0.48 μg / mL, respectively. The toxicity of doxorubicin liposomes exceeded that of free doxorubicin. This is because doxorubicin liposomes can enter cells through endocytosis, thereby increasing the amount of drug taken up.

[0114] 3.3 Doxorubicin hydrochloride and doxorubicin liposomes induce immunogenic cell death

[0115] In an air incubator at 37°C and 5% (v / v) CO2 concentration, B16F10 melanoma cells in the logarithmic growth phase were digested with trypsin, resuspended in DMEM containing 10% FBS, and then incubated at 2×10⁻⁶ ppm. 5 B16F10 cells were seeded at a density of 1 mL / well in 12-well plates, with 1 mL of cell suspension added to each well. Doxorubicin hydrochloride (Dox·HCl) or Dox-Lip was added at concentrations of 0.1, 0.25, 0.5, and 0.75 μg / mL as treatment groups, and a blank control group (with blank DMEM medium) was set up. At 48 h after drug administration, the expression of calreticulin (CRT) on the surface of B16F10 cells treated with doxorubicin hydrochloride and doxorubicin liposomes was detected by flow cytometry.

[0116] In an air incubator at 37°C and 5% (v / v) CO2 concentration, B16F10 melanoma cells in the logarithmic growth phase were digested with trypsin, resuspended in DMEM containing 10% FBS, and then incubated at 2×10⁻⁶ ppm. 5Cells were seeded at a density of 1 mL / well in 12-well plates, with 1 mL of cell suspension added to each well. Doxorubicin hydrochloride (Dox·HCl) or Dox-Lip was then added at concentrations of 0.1, 0.25, 0.5, and 0.75 μg / mL as treatment groups. A blank control group (containing blank DMEM medium) was also included. After 48 h of treatment, the supernatant was aspirated and collected, then stored at -20°C. Adherent cells in the wells were washed three times with ice-cold PBS buffer, and 0.2 mL of the solution was added to each well. Digest with 0.25% trypsin-EDTA for 2 min, then add DMEM to terminate the digestion. Collect cells from each well, centrifuge at 1000 rpm for 5 min, resuspend in 1 ml of PBS buffer, wash once, discard the supernatant, add 200 μL of blocking buffer to the cell pellet and block at room temperature for 30 min, centrifuge at 1000 rpm for 5 min, resuspend in 0.5 ml of PBS buffer, centrifuge again at 1000 rpm for 5 min, discard the supernatant, add 200 μL of anti-CRT rabbit monoclonal antibody (1:1000) to the cell pellet and incubate at 4℃ for 1 h, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend cells in PBS buffer, centrifuge again, wash once with PBS buffer, discard the supernatant, add Alexa Fluor to the cell pellet. 488-labeled goat anti-rabbit IgG (1:2000) was incubated at room temperature in the dark for 30 min, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in 200 μL of PBS buffer. After centrifugation, the cells were washed twice with PBS buffer, and the supernatant was discarded. The cell pellet was fixed in 200 μL of 4% paraformaldehyde at room temperature for 10 min, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cell pellet was resuspended in 200 μL of PBS. The cells were then analyzed by flow cytometry (Alexa Fluor 488 channel). The results are shown below. Figure 5 As shown.

[0117] Figure 5 The results showed that the mean fluorescence of cells treated with Dox·HCl and Dox-Lip was significantly increased compared to the blank control group, indicating that Dox·HCl and Dox-Lip could induce immunogenic cell death in tumor cells; simultaneously, from Figure 4 As can be seen, CRT expression does not increase with increasing concentrations of Dox·HCl and Dox-Lip. For free Dox·HCl, the highest CRT expression level is achieved at a concentration of 0.5 μg / mL, while for Dox-Lip, the highest CRT expression level is achieved at a Dox·HCl concentration of 0.25 μg / mL.

[0118] Example 4: Preparation of hybrids of probiotic engineered bacteria and drug-loaded nanoparticles

[0119] 4.1 The probiotic engineered bacteria EcN(pTrc99a-PD-L1) obtained in Example 1 was inoculated into LB culture medium and cultured overnight (about 12 h) at 37°C and 220 rpm to obtain fermentation broth. The fermentation broth was centrifuged at 6000 rpm for 3 min to obtain probiotic engineered bacteria cells. The probiotic engineered bacteria cells were dispersed in 0.1M PBS buffer and the OD=3 of the cells was adjusted to obtain probiotic engineered bacteria culture. The culture was mixed with the drug-loaded nanoparticle (doxorubicin liposome) solution prepared in Example 3 at a volume ratio of 8:1, so that the weight ratio of PBS buffer, probiotic engineered bacteria and drug-loaded nanoparticles was 1000:0.5:1. The mixture was then stirred at room temperature for 9 h to obtain reaction solution. The reaction solution was centrifuged at 6000 rpm for 4 min to remove the supernatant and obtain crude product precipitate. The crude product precipitate was washed three times with PBS buffer to obtain probiotic engineered bacteria and drug-loaded nanoparticle heterozygotes.

[0120] 4.2 Transmission electron micrograph of the connection between liposomes and probiotics

[0121] The copper meshes of the carbon-supported membrane were placed face up in a petri dish. The probiotic engineered bacteria EcN (pTrc99a-PD-L1) prepared in Example 1, the doxorubicin liposomes prepared in Example 3, and the heterozygote prepared in Example 4 were mixed and thoroughly dispersed with PBS buffer (0.01M, pH 7.4) to form samples. 5 μL of the sample was dropped onto the mesh surface and dried to remove moisture. Then, 5 μL of 2% phosphotungstic acid solution was added, and the sample was stained at room temperature in the dark for 5 min. The dye was then removed. After drying, excess negative staining reagent was absorbed using filter paper. 5 μL of deionized water was dropped onto the copper mesh and immediately removed. This washing process was repeated 2-3 times. The copper mesh was dried in an oven for 30 min, and observed and photographed using a transmission electron microscope. The results are shown in [Figure number missing]. Figure 6 . Figure 6 The results showed that the size of the doxorubicin liposomes ranged from approximately 30 to 60 nm, the probiotics were short rod-shaped, and the surface became relatively rough after they were linked with the doxorubicin liposomes to form heterozygotes.

[0122] 4.3 Antitumor effects and immune amplification effects of liposomes and Escherichia coli hybrids

[0123] To investigate the antitumor effects and mechanisms of the probiotic engineered bacteria and drug-loaded nanoparticle hybrid obtained in Example 4, a 4T1 breast cancer mouse model was established by tumor inoculation. The mice were then randomly divided into three groups: (1) PBS, (2) probiotic engineered bacteria EcN (pTrc99a-PD-L1), and (3) probiotic engineered bacteria and drug-loaded nanoparticle hybrid DOX@Lip / aPD-L1@EcN. The long and short diameters of the tumor were measured every three days after intratumoral administration. On the 5th day after administration, three mice from each group were dissected, and tumor tissue was extracted for immunofluorescence analysis. Cy5-antiCD8 antibody was used to stain the tumor microenvironment to mark the number of CD8 T cells. Tumor growth curves were plotted to examine the differences in tumor tissue among different tissues. The results are shown in […]. Figure 7 .

[0124] Figure 7 The results showed that the probiotic engineered bacteria and drug-loaded nanoparticle heterozygote (DOX-Lip / aPD-L1@EcN) could significantly increase the content of cytotoxic T cells in tumor tissue, amplify the local immune response of the tumor, and have a better inhibitory effect on tumor proliferation, thus exhibiting a significant anti-tumor effect.

[0125] Example 5

[0126] 5.1 Construction of pTrc99a-PD-L1 mutant recombinant plasmid

[0127] a. PD-L1 nanobody mutant expression cassette: The PD-L1 nanobody mutant PD-L1' was obtained by molecular docking and molecular dynamics simulation mutation of the PD-L1 nanobody with the amino acid sequence shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2; the nucleotide sequence of the PD-L1 nanobody mutant PD-L1' was obtained by reverse translation, as shown in SEQ ID NO.4; the PD-L1 nanobody expression cassette PfnrS-RBS-OmpA-PD-L1' was constructed, where PfnrS is a hypoxia promoter, the RBS nucleotide sequence was predicted by RBS Calculator (https: / / salislab.net / software / reverse), and OmpA is a commonly used signal peptide of Escherichia coli. The nucleotide sequence of the PD-L1 nanobody expression cassette is shown in SEQ ID NO.16;

[0128] PD-L1 nanobody mutant expression cassette (SEQ ID No. 16): In this sequence, the italicized part is the PfnrS nucleotide sequence, the lowercase part is the RBS sequence, the underlined part is the OmpA signal peptide nucleotide sequence, and the regular uppercase part is the PD-L1 mutant nucleotide sequence.

[0129] b. Preparation of pTrc99a-PD-L1 mutant recombinant plasmid

[0130] In Example 1, the pTrc99a-PD-L1 recombinant plasmid constructed by method 1.1 was used as a template. PCR amplification was performed using upstream primer PD-L1'-GJ-F (nucleotide sequence as shown in SEQ ID NO.17) and downstream primer PD-L1'-GJ-R (nucleotide sequence as shown in SEQ ID NO.18) to obtain a linearized vector backbone containing PfnrS and OmpA fragments. The PD-L1 mutant sequence was synthesized by Qingke Biotechnology Co., Ltd. PCR amplification of the PD-L1 mutant sequence PD-L1' was performed using upstream primer PD-L1'-F (nucleotide sequence as shown in SEQ ID NO.19) and downstream primer PD-L1'-R (nucleotide sequence as shown in SEQ ID NO.20). The linearized vector backbone and PD-L1' fragment were assembled using Gibson to construct the pTrc99a-PD-L1 mutant recombinant plasmid containing the PD-L1 nanobody mutant expression cassette.

[0131] PD-L1'-GJ-F(5'-3'):GACAGTTTCAAGCGGTGGTCT (SEQ ID NO.17);

[0132] PD-L1'-GJ-R(5'-3'):TCCTGTTTCAACCAGCTGCACCT(SEQ ID NO.18);

[0133] PD-L1'-F(5'-3'):CAGCTGGTTGAAACAGGAGGG (SEQ ID NO. 19);

[0134] PD-L1'-R(5'-3'):ACCGCTTGAAACTGTCACCT (SEQ ID NO. 20).

[0135] 5.2 Construct the probiotic engineered bacteria EcN (pTrc99a-PD-L1 mutant) according to the method in 1.2 of Example 1;

[0136] 5.3 The probiotic engineered bacteria and drug-loaded nanoparticle hybrid was prepared according to the method in 4.1 of Example 4.

[0137] Example 6

[0138] 6.1 Construction of pTrc99a-Sia recombinant plasmid

[0139] a. Sialidase expression cassette: The sialidase gene Sia sequence was obtained by codon optimization based on the sialidase gene sequence of Salmonella typhimurium (GenBank: M55342.1) according to the preferred codons of Escherichia coli. Its amino acid sequence is shown in SEQ ID NO.5, and its nucleotide sequence is shown in SEQ ID NO.6, which is the sialidase coding gene fragment. The sialidase expression cassette contains PfnrS-RBS-Sia, where the RBS nucleotide sequence was predicted by RBS Calculator (https: / / salislab.net / software / reverse). The nucleotide sequence of the sialidase expression cassette is shown in SEQ ID NO.21.

[0140] Sialidase expression cassette (SEQ ID NO.17): AGCAAACTGTCTCGCGTGATGGACCCGACCTGTATTGTTGCGAATATTCAGGGCCGTGAAACCATCCTGGTTATGGTTGGGAAATGGAACAACAACGACAAGACGTGGGGTGCGTATCGTGATAAAGCACCGGATACCGACTGGGATCTGGTCTTGTACAAATCTACCGATGATGGTGTGACATTTAGCAAGGTGGAAACCAATATCCACGATATCGTGACCAAGAACGGCACGATCAGCGCTATGCTGGGTGGTGTTGGCTCAGGCTTGCAGCTGAATGACGGCAAGTTGGTTTTCCCGGTTCAAATGGTTCGTACCAAGAACATCACCACGGTCCTGAACACCAGCTTCATCTACAGTACTGACGGTATTACCTGGTCATTACCGAGCGGTTACTGCGAGGGCTTCGGTTCGGAAAATAACATTATCGAGTTCAACGCTTCCCTCGTTAACAACATCCGTAACAGCGGTCTGCGCCGTTCGTTCGAGACGAAGGACTTCGGCAAGACGTGGACGGAGTTCCCACCGATGGATAAGAAGGTGGACAACCGCAATCACGGCGTGCAAGGTTCCACCATCACCATTCCGAGCGGCAACAAGTTAGTCGCCGCGCACAGCAGCGCGCAGAATAAGAATAATGACTATACCCGTTCCGACATTTCGTTGTACGCACATAACCTGTACTCCGGCGAGGTCAAACTTATCGACGCATTTTATCCGAAAGTGGGTAACGCGTCTGGTGCCGGTTACAGCTGCCTGTCCTACCGCAAAAACGTTGATAAAGAAACCCTGTACGTTGTCTATGAGGCGAACGGTTCTATTGAGTTCCAGGATCTGAGTCGTCATCTGCCGGTCATTAAAAGCTATAACCATCATCATCATCATCATTAA; wherein the italicized part is the PfnrS nucleotide sequence, the lowercase letter part is the RBS sequence, and the ordinary uppercase letter part is the sialidase Sia nucleotide sequence.

[0141] Preparation of recombinant plasmid b.pTrc99a-Sia

[0142] Using the pTrc99a plasmid constructed by method 1.1 in Example 1 as a template, PCR amplification was performed using upstream primer Sia-GJ-F (nucleotide sequence as shown in SEQ ID NO.22) and downstream primer Sia-GJ-R (nucleotide sequence as shown in SEQ ID NO.23) to obtain a linearized vector backbone. The sialidase expression cassette sequence was synthesized by Qingke Biotechnology Co., Ltd. The sialidase expression sequence was amplified by PCR using upstream primer Sia-F (nucleotide sequence as shown in SEQ ID NO.24) and downstream primer Sia-R (nucleotide sequence as shown in SEQ ID NO.25). The linearized vector backbone and the sialidase expression cassette gene fragment were ligated by Gibson assembly to construct the pTrc99a-Sia recombinant plasmid containing the sialidase expression cassette.

[0143] Sia-GJ-F (5'-3'): CATCATCATCATTAAGGATCCTCTAGAGTCGACCT (SEQ ID NO. 22);

[0144] Sia-GJ-R(5'-3'): GTTACAGTCATTTCAGAATATTTGCCAG (SEQ ID NO. 23);

[0145] Sia-F (5'-3'): TTCTGAAATGAGCTGTAACAAAAGCAATTTTTCCGGCTG (SEQ ID NO. 24);

[0146] Sia-R(5'-3'): GGATCCTTAATGATGATGATGATGATGGTTATAGC (SEQ ID NO. 25).

[0147] 6.2 Construct the probiotic engineered bacteria EcN(pTrc99a-Sia) according to the method in 1.2 of Example 1.

[0148] 6.3 The probiotic engineered bacteria and drug-loaded nanoparticle heterozygote EcN(pTrc99a-Sia) / MOF@oxa was prepared according to the method in 4.1 of Example 4.

[0149] Example 7

[0150] 7.1 Construction of pSU2718-eSLC recombinant plasmid

[0151] a. Obtaining the eSLC coding gene: The eSLC coding gene contains luxI, luxR, and The entire eSLC gene is synthesized in two segments: gene segment A (nucleotide sequence as shown in SEQ ID NO. 26) and gene segment B (nucleotide sequence as shown in SEQ ID NO. 27).

[0152] Gene fragment A (SEQ ID NO.26):

[0153]

[0154]

[0155] Gene fragment B (SEQ ID NO.27):

[0156]

[0157] The underlined parts are the homologous arms of gene fragment A and gene fragment B;

[0158] b. Preparation of pSU2718-eSLC recombinant plasmid: The pSU2718 plasmid was double-digested with Sma I and Hind III, and the linearized vector backbone was obtained after gel extraction and purification. Gene fragment A and gene fragment B were synthesized by Qingke Biotechnology Co., Ltd. Gene fragment A was amplified by PCR using upstream primer eSLC-FrA-F (nucleotide sequence as shown in SEQ ID NO.28) and downstream primer eSLC-FrA-R (nucleotide sequence as shown in SEQ ID NO.29). Gene fragment B was amplified by PCR using upstream primer eSLC-FrB-F (nucleotide sequence as shown in SEQ ID NO.30) and downstream primer eSLC-FrB-R (nucleotide sequence as shown in SEQ ID NO.31). Gene fragment A and gene fragment B were obtained after gel extraction and purification. The linearized vector backbone, gene fragment A, and gene fragment B were ligated by Gibson assembly to construct the pSU2718-eSLC recombinant plasmid containing the eSLC encoding gene.

[0159] eSLC-FrA-F(5'-3'): AGCTCGGTACCCGGGGATCCTATTTCAAAATAAGTATGTG (SEQ IDNO.28);

[0160] eSLC-FrA-R(5'-3'): GGGATAAACATAATCAGCAGAGACGGAAGCAACAGGCTTA (SEQ ID NO. 29);

[0161] eSLC-FrB-F(5'-3'): TAAGCCTGTTGCTTCCGTCTCTGCTGATTATGTTTATCCC (SEQ IDNO.30);

[0162] eSLC-FrB-R(5'-3'): CGACGGCCAGTGCCAAGCTTATATGTATTATGTTCGAGTA (SEQ ID NO. 31).

[0163] 7.2 Following the method in 1.2 of Example 1, the pTrc99a-Sia recombinant plasmid and pSU2718-eSLC recombinant plasmid obtained in Example 6 were introduced into EcN competent cells to construct the probiotic engineered bacteria EcN(pTrc99a-Sia-pSU2718-eSLC);

[0164] 7.3 The probiotic engineered bacteria and drug-loaded nanoparticle heterozygote EcN(pTrc99a-Sia-pSU2718-eSLC) / MOF@oxa was prepared according to the method in 4.1 of Example 4.

[0165] Comparative Example 1

[0166] The probiotic engineered bacteria EcN(pTrc99a-PD-L1) was replaced with the starting strain Escherichia coli Nissle 1917, and the E. coli and drug-loaded nanoparticle heterozygote EcN / MOF@oxa was prepared according to the method in 4.1 of Example 4.

[0167] Comparative Example 2

[0168] The original strain, Escherichia coli Nissle 1917, was used as control example 2.

[0169] Test case

[0170] Following the antitumor effect testing method in Example 4.3, the antitumor effects of the probiotic engineered bacteria and heterozygotes prepared in Examples 6-7, as well as the heterozygotes prepared in Comparative Example 1 and the *E. coli* Nissle 1917 described in Comparative Example 2, on tumor growth were tested. The results are shown in […]. Figure 8 . Figure 8 The results showed that, using the tumor size of the control group with PBS buffer as a control, the heterozygous EcN(pTrc99a-Sia) / MOF@oxa prepared in Example 6 and the heterozygous EcN(pTrc99a-Sia-pSU2718-eSLC) / MOF@oxa prepared in Example 7 could significantly increase the content of cytotoxic T cells in tumor tissue, amplify the local immune response of the tumor, and better inhibit tumor proliferation. Moreover, the inhibitory effect on tumor proliferation was significantly better than that of the probiotic engineered bacteria itself and the starting strain.

[0171] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A probiotic engineered bacteria and drug-loaded nanoparticle hybrid, characterized in that, The heterozygote comprises a probiotic strain and drug-loaded nanoparticles linked to the probiotic strain. The probiotic strain is obtained by genetically engineering a starting strain to introduce an expression cassette that can express a gene encoding a PD-L1 nanobody or an expression cassette that can express a gene encoding a sialidase. The drug-loaded nanoparticles contain tumor chemotherapy drugs. The amino acid sequence of the PD-L1 nanobody is shown in SEQ ID NO.

1. The amino acid sequence of the sialidase is shown in SEQ ID NO.

5. The starting strain of the probiotic strain is Escherichia coli Nissle 1917. The expression cassette that can express the gene encoding the PD-L1 nanobody includes the hypoxia promoter PfnrS and the signal peptide OmpA. The expression cassette that can express the gene encoding the sialidase includes the hypoxia promoter PfnrS.

2. The probiotic engineered bacteria and drug-loaded nanoparticle hybrid according to claim 1, characterized in that, The nucleotide sequence of the encoding gene of the PD-L1 nanobody is shown in SEQ ID NO.3; the nucleotide sequence of the encoding gene of the sialidase is shown in SEQ ID NO.6; And / or, the weight ratio of the probiotic strains to the drug-loaded nanoparticles is 0.01-2:

1.

3. The probiotic engineered bacteria and drug-loaded nanoparticle hybrid according to claim 1, characterized in that, The drug-loaded nanoparticles include the tumor chemotherapy drug and a nanocarrier encapsulating the tumor chemotherapy drug, wherein the nanocarrier is selected from at least one of liposomes, metal-organic frameworks and PLGA.

4. The probiotic engineered bacteria and drug-loaded nanoparticle hybrid according to claim 3, characterized in that, The tumor chemotherapy drugs are anthracyclines and / or platinum-based drugs; And / or, the weight ratio of the tumor chemotherapy drug to the nanocarrier is 1:2-50.

5. The probiotic engineered bacteria and drug-loaded nanoparticle hybrid according to claim 4, characterized in that, The chemotherapy drugs for the tumor are doxorubicin and / or oxaliplatin.

6. A method for preparing a probiotic engineered bacteria and drug-loaded nanoparticle hybrid as described in claim 1, characterized in that, Includes the following steps: In solvent I, probiotics and drug-loaded nanoparticles are mixed and reacted to link the probiotics and drug-loaded nanoparticles; solvent I is PBS buffer or water.

7. The preparation method according to claim 6, characterized in that, The nucleotide sequence of the encoding gene of the PD-L1 nanobody is shown in SEQ ID NO.3; the nucleotide sequence of the encoding gene of the sialidase is shown in SEQ ID NO.

6.

8. The preparation method according to claim 6, characterized in that, The drug-loaded nanoparticles include the tumor chemotherapy drug and a nanocarrier encapsulating the tumor chemotherapy drug, wherein the nanocarrier is selected from at least one of liposomes, metal-organic frameworks and PLGA; And / or, the tumor chemotherapy drug is anthracycline and / or platinum-based drugs; And / or, the weight ratio of the tumor chemotherapy drug to the nanocarrier is 1:2-50.

9. The preparation method according to claim 8, characterized in that, The chemotherapy drugs for the tumor are doxorubicin and / or oxaliplatin.

10. The preparation method according to claim 9, characterized in that, The process of mixing the probiotics with the drug-loaded nanoparticles includes: mixing the probiotics with a portion of the solvent I to form a probiotic solution, mixing the drug-loaded nanoparticles with another portion of the solvent I to form a drug-loaded nanoparticle solution, and then mixing the probiotic solution with the drug-loaded nanoparticle solution and stirring. And / or, the weight ratio of solvent I, the probiotic engineered bacteria and the drug-loaded nanoparticles is 300-11000:0.01-2:1, and the volume ratio of the probiotic engineered bacteria solution to the drug-loaded nanoparticle solution is 10-2:1; And / or, the stirring conditions include at least: a temperature of 5-40°C and a time of 1-18h.

11. The preparation method according to claim 6, characterized in that, The preparation method further includes: performing solid-liquid separation on the reaction solution obtained from the mixed reaction to obtain a crude product precipitate, and washing the crude product precipitate.

12. The preparation method according to claim 11, characterized in that, The washing agent used is PBS buffer, and the washing is performed 2-4 times.

13. The application of the probiotic engineered bacteria and drug-loaded nanoparticle heterozygote according to any one of claims 1 to 5, and the probiotic engineered bacteria and drug-loaded nanoparticle heterozygote prepared by the preparation method according to any one of claims 6 to 12, in the preparation of antitumor drugs.

14. The application according to claim 13, characterized in that, The antitumor drug is a drug for treating breast cancer and / or melanoma.

Images