Mutated dapA promoter and its applications
By constructing a mutant dapA promoter with high transcriptional activity, the problem of limited dapA gene expression enhancement in existing technologies was solved, thereby improving lysine production efficiency and significantly increasing yield and conversion rate.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- MEIHUA BIOTECH LANGFANG CO LTD
- Filing Date
- 2021-12-14
- Publication Date
- 2026-08-04
AI Technical Summary
In existing technologies, methods for enhancing promoter expression of the dapA gene in Corynebacterium glutamicum mainly rely on increasing the gene copy number, while there is limited research on enhancing transcriptional activity by modifying the dapA promoter itself, resulting in limited lysine production efficiency.
A mutant dapA promoter was designed and constructed, exhibiting significantly enhanced transcriptional activity, which drives the expression of the dapA gene and enhances the expression of dihydropyridine dicarboxylic acid synthase, thereby increasing the production of diaminopimelic acid, a precursor for lysine synthesis.
By modifying the dapA promoter, the expression level of the dapA gene in Corynebacterium glutamicum was significantly increased, thereby improving the yield and conversion rate of lysine and enhancing the growth performance of the strain.
Smart Images

Figure BDA0003411180800000091 
Figure BDA0003411180800000101 
Figure BDA0003411180800000102
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a mutated dapA promoter, recombinant microorganisms containing the promoter, and their applications. Background Technology
[0002] L-Lysine is a basic essential amino acid widely used in animal feed, pharmaceuticals, and the food industry. L-Lysine promotes the absorption and utilization of other amino acids by animals, thereby improving feed quality. Currently, microbial fermentation is the most common method for producing L-Lysine, and *Corynebacterium glutamicum* is an important strain for L-Lysine fermentation production.
[0003] The lysine synthesis pathway of *Corynebacterium glutamicum* is significantly superior to that of *Escherichia coli*. *Corynebacterium glutamicum* requires only one enzymatic step in the synthesis of diaminopimelic acid, the precursor of lysine, catalyzed by diaminopimelic acid dehydrogenase, while *E. coli* requires four enzymatic steps. Dihydropyridinedicarboxylic acid synthase (dapA) is a key enzyme in the biosynthesis of diaminopimelic acid in *Corynebacterium glutamicum*, catalyzing aspartate-β-semialdehyde dehydrogenase to generate tetrahydropyridinedicarboxylic acid. Tetrahydropyridinedicarboxylic acid further synthesizes diaminopimelic acid, the precursor of lysine, under the catalysis of dihydropyridinedicarboxylic acid reductase (dapB) and diaminopimelic acid dehydrogenase (ddh). Therefore, increasing the expression and activity of dihydropyridinedicarboxylic acid synthase can increase the production of diaminopimelic acid, the precursor of lysine, thereby increasing the yield of lysine.
[0004] Currently, the main method to enhance the expression of the dapA gene in Corynebacterium glutamicum is to increase the copy number of the gene, while research on enhancing its expression through modification of the dapA gene's own promoter is still relatively limited. Summary of the Invention
[0005] The purpose of this invention is to provide a mutant dapA promoter whose transcriptional activity is significantly enhanced compared to the wild-type dapA promoter (sequence shown in SEQ ID NO. 2). This invention also provides a recombinant microorganism containing this promoter and a method for producing lysine using this recombinant microorganism.
[0006] Specifically, the present invention provides the following technical solutions:
[0007] The present invention provides a promoter having a nucleotide sequence as shown in SEQ ID NO.1.
[0008] The promoter described in this invention refers to a non-translated nucleic acid sequence located upstream of the coding region of a gene. This sequence contains at least an RNA polymerase binding site and has the activity of initiating the transcription of downstream genes into mRNA. The promoter sequence may also include a 5' untranslated region, which is a binding region for certain transcription factors or regulatory factors.
[0009] The promoter provided above is a mutant dapA promoter. Compared with the wild-type dapA promoter (SEQ ID NO.2), the transcriptional activity of this promoter is significantly improved, and it can be used to drive the expression of genes such as dapA and increase their expression levels.
[0010] Preferably, the sequence of the mutated dapA promoter is shown in SEQ ID NO.1.
[0011] Based on the above promoter, the present invention provides an expression cassette containing the mutated dapA promoter.
[0012] The expression cassette described above may be recombinant DNA obtained by operably linking the target gene downstream of the promoter, or recombinant DNA obtained by operably linking the target gene downstream of the promoter and operably linking other transcriptional regulatory elements or translational regulatory elements upstream or downstream.
[0013] The present invention does not impose any special restrictions on the target gene. The promoter provided by the present invention can drive any gene to be transcribed in Corynebacterium glutamicum. When a gene has an expression intensity requirement that matches the promoter, the promoter can be used. Therefore, the target gene can be the dapA gene or other genes besides the dapA gene.
[0014] As a preferred embodiment of the present invention, the promoter is used to drive the expression of the dapA gene, thereby increasing the expression level of the dapA gene in Corynebacterium glutamicum.
[0015] The present invention also provides a vector containing the dapA promoter or the expression cassette containing the mutation.
[0016] The vectors mentioned above can be expression vectors or cloning vectors, including but not limited to plasmid vectors, phage vectors, transposons, etc.
[0017] As a preferred embodiment of the present invention, the present invention provides a homologous recombination vector containing the promoter and a homologous arm fragment for replacing the original dapA promoter with the mutated dapA promoter. This homologous recombination vector is constructed based on the pK18mobsacB vector.
[0018] The present invention also provides a host cell containing the dapA promoter with the mutation, the expression cassette or the vector.
[0019] The host cell mentioned above is preferably a microbial cell.
[0020] The microbial cells are preferably Escherichia, Corynebacterium, or Brevibacterium bacteria. Specifically, Escherichia coli is preferred; Corynebacterium species are preferably Corynebacterium glutamicum, Corynebacterium pekinense, Corynebacterium efficiens, Corynebacterium crenatum, Corynebacterium thermoaminogenes, or Corynebacterium aminogenes; and Brevibacterium species are preferably Brevibacterium flavum or Brevibacterium lactofermentum.
[0021] Based on the functionality of the mutated dapA promoter provided by this invention, this invention further provides any of the following applications of the mutated dapA promoter, the expression cassette, the vector, or the host cell:
[0022] (1) Driving gene expression in microorganisms;
[0023] (2) Enhance gene expression in microorganisms;
[0024] (3) Increase the yield and / or conversion rate of microbial metabolites;
[0025] (4) Constructing microbial strains for producing microbial metabolites;
[0026] (5) Fermentation to produce microbial metabolites.
[0027] In the above applications, the metabolites can be any metabolites that microorganisms can synthesize, including but not limited to amino acids, organic acids, nucleosides, etc.
[0028] In the above applications, the microorganism is preferably a Corynebacterium spp. More preferably, it is Corynebacterium glutamicum, Corynebacterium pekinense, Corynebacterium efficiens, Corynebacterium crenatum, Corynebacterium thermoaminogenes, or Corynebacterium aminogenes.
[0029] The present invention provides a recombinant microorganism, wherein the upstream intergenetic region of the dihydropyridine dicarboxylic acid synthase encoding gene of the recombinant microorganism contains the mutated dapA promoter.
[0030] The upstream gene region of the dihydropyridine dicarboxylic acid synthase encoding gene mentioned above specifically refers to the nucleotide sequence between the start codon of the dihydropyridine dicarboxylic acid synthase encoding gene on the microbial chromosome and the coding region of its upstream gene.
[0031] Preferably, the recombinant microorganism is recombinant Corynebacterium glutamicum, and its dihydropyridine dicarboxylic acid synthase encoding gene is expressed by the mutated dapA promoter.
[0032] The present invention provides a recombinant Corynebacterium glutamicum, wherein the dihydropyridine dicarboxylic acid synthase encoding gene is expressed by the mutated dapA promoter.
[0033] Specifically, in the recombinant Corynebacterium glutamicum, the natural promoter of the dihydropyridine dicarboxylic acid synthase gene is replaced by the mutated dapA promoter.
[0034] The recombinant microorganisms described above exhibited significantly increased expression levels of dihydropyridine dicarboxylic acid synthase, resulting in a markedly enhanced ability to synthesize lysine and its derivatives, and higher lysine yield and conversion rate compared to the original strain.
[0035] The starting strain of the recombinant microorganism is preferably a Corynebacterium species capable of accumulating lysine or its derivatives. Corynebacterium glutamicum, particularly capable of accumulating lysine or its derivatives, is preferred.
[0036] The present invention further discovers that the above-mentioned modification of the promoter encoding the dihydropyridine dicarboxylic acid synthase, combined with the modification of certain specific metabolic engineering targets, is more conducive to improving the yield and conversion rate of lysine. Based on this, the starting strain of the above-mentioned recombinant microorganism is preferably modified as follows (1) or (2) based on wild-type Corynebacterium glutamicum:
[0037] (1) Mutate the lysC gene on the chromosome to make it encode lysC. T311I Mutant (amino acid 311 is mutated from T to I); mutates the pyc gene on the chromosome to encode pyc. P458S The mutant (amino acid mutation at position 458, changing from P to S) increases the copy number of the lysE gene.
[0038] (2) Introduce point mutation T311I in lysC on chromosomes, point mutation V59A in hom, point mutation P458S in pyc, and point mutation S361F in gnd; increase the copy number of dapA, dapB, and ddh; and change the promoter sequence of aceE to weaken the expression of pyruvate dehydrogenase.
[0039] In a preferred embodiment of the present invention, the starting strain of the recombinant microorganism is a lysine-producing bacterium with accession number CGMCCNo.13407. This strain was deposited on November 30, 2016, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and is classified as *Corynebacterium glutamicum*. This strain has been disclosed in patent CN106635944A. Using the mutated dapA promoter provided by the present invention to drive the expression of its dihydropyridine dicarboxylic acid synthase encoding gene, the modified strain exhibits significantly improved lysine production and conversion rate, and its growth performance is also enhanced.
[0040] As another preferred embodiment of the present invention, the starting strain of the recombinant microorganism is a lysine-producing bacterium with accession number CGMCCNo.11942. This strain was deposited on December 25, 2015, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and is classified as *Corynebacterium glutamicum*. This strain has been disclosed in patent CN105734004B. Using the mutated dapA promoter provided by the present invention to drive the expression of its dihydropyridine dicarboxylic acid synthase encoding gene, the modified strain showed significantly improved lysine production and conversion rate, and its growth performance was also improved.
[0041] The present invention provides a method for constructing the recombinant microorganism, the method comprising the step of replacing the natural promoter of the dihydropyridine dicarboxylic acid synthase encoding gene with the mutated dapA promoter.
[0042] Specifically, the method involves replacing the natural promoter of the dihydropyridine dicarboxylic acid synthase encoding gene in the starting strain with the mutated dapA promoter.
[0043] The aforementioned replacement promoter can be implemented using conventional methods in the art. For example, the upstream and downstream fragments of the promoter to be replaced, as well as the mutated dapA promoter, can be ligated into a homologous recombination vector and introduced into the starting strain, thereby replacing the original dapA promoter in the starting strain through homologous recombination.
[0044] This invention provides any of the following applications of the recombinant microorganism:
[0045] (1) Application in the fermentation production of microbial metabolites or their derivatives;
[0046] (2) Application in the selection of production strains of microbial metabolites or their derivatives;
[0047] Preferably, the microbial metabolite is lysine. The derivatives include, but are not limited to, trifluoroacetyllysine.
[0048] The present invention provides a method for producing lysine or its derivatives by fermentation, comprising culturing the recombinant microorganism and isolating lysine or its derivatives from the culture.
[0049] Specifically, the above method includes: inoculating the recombinant microorganism into a seed culture medium for seed culture to obtain a seed liquid; inoculating the seed liquid into a fermentation culture medium for culture to obtain a fermentation broth; and separating and extracting the fermentation broth to obtain lysine or its derivatives.
[0050] Preferably, the fermentation medium comprises the following components: glucose 25-35 g / L, ammonium sulfate 5-15 g / L, yeast extract 1-3 g / L, peptone 3-5 g / L, KH2PO4 1-2 g / L, MgSO4·7H2O 1-3 g / L, FeSO4·7H2O 0.1-0.3 g / L, MnSO4·H2O 0.1-0.3 g / L, nicotinamide 0.03-0.07 g / L, calcium pantothenate 0.005-0.015 g / L, biotin 0.001-0.002 g / L, and thiamine 0.005-0.015 g / L.
[0051] The present invention also provides a method for expressing a target gene, the method comprising: operably linking the target gene to the mutated dapA promoter to obtain recombinant DNA, and introducing the recombinant DNA into a host cell to express the target gene.
[0052] Specifically, the target gene is operatively linked downstream of the mutated dapA promoter; or, upstream and downstream DNA fragments of the target gene on the chromosome are operatively linked upstream and downstream of the mutated dapA promoter, respectively.
[0053] The target gene mentioned above can be any protein-coding gene (e.g., amino acid synthesis-related genes) or RNA molecule-coding gene (e.g., interfering RNA molecules, regulatory RNA molecules, sgRNA, etc.).
[0054] The beneficial effects of this invention are as follows: The mutant dapA promoter provided by this invention has significantly higher transcriptional initiation activity compared to the wild-type dapA promoter, enabling efficient expression of the target gene in microorganisms. Replacing the natural promoter of the dapA gene with this promoter significantly enhances dapA gene expression, resulting in a significant increase in lysine production and conversion rate of the recombinant bacteria constructed thereby. The mutant dapA promoter provided by this invention can be used to regulate the expression of amino acid synthesis-related genes such as the dapA gene, providing a new molecular tool and method for gene expression regulation. Detailed Implementation
[0055] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.
[0056] Unless otherwise specified, the techniques or conditions described in the following examples shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0057] The primer sequence information used in the following examples is shown in Table 1.
[0058] Table 1 Primer sequence information
[0059] Primer name Sequence (5'-3') P-1f CGCGGATCCATGCCAATGCCACGATGTAT P-1r TCGTGGGTGTGAGCTTTGCGTTAAAAGTCCATGACATACG P-2f AGAAGGTAACCTTGAACTCTATGAGCACAGGTTTAACAGC P-2r CCCAAGCTTCCCTTGGCGTCCTTGACCGC RT-16S-f AATGGCGCATACAAAGAGAAGC RT-16S-R GTTGCAGACTCCAATCCGGA RT-dapA-f GAGACGCCTGAGTGAATTACCTACG RT-dapA-r CGCCCAAAGCAAGCCAAACAAG
[0060] The mutant promoter PdapA provided by this invention * The nucleotide sequence of the mutant dapA gene promoter is shown in SEQ ID NO.1, and the mutant promoter PdapA in patent application CN111197021A is also described. ** The nucleotide sequence is shown in SEQ ID NO.7. The mutant promoter PdapA was synthesized by Genewiz Biotechnology Co., Ltd. (China). * The mutant promoter PdapA in CN111197021A ** The two promoters were used to regulate the expression of the dapA gene in the lysine synthesis pathway.
[0061] Example 1 Construction of recombinant plasmid
[0062] Using the genome of *Corynebacterium glutamicum* ATCC 13032 as a template, PCR amplification was performed using the P-1f / P-1r primer pair to obtain the upstream homologous arm fragment P-up; PCR amplification was performed using the P-2f / P-2r primer pair to obtain the downstream homologous arm fragment P-dn. P-up, P-dn, and PdapA were then analyzed. * Using a mixture of three fragments as a template, PCR amplification was performed with the P-1f / P-2r primer pair to obtain the fragment up-PdapA. * -dn, up-PdapA * -dn was double-digested with BamHI and HindIII, and the vector pK18mobsacB (GenBank: FJ437239.1; kindly provided by Professor Yang Sheng of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, or commercially available) was double-digested with the same enzymes. The two digested products were ligated with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-PdapA. * .
[0063] The recombinant plasmid pK18mobsacB-PdapA was constructed using the same method. ** .
[0064] Example 2: Introducing a mutated promoter of the dapA gene into the starting strain CGMCC No. 13407.
[0065] Competent cells of CGMCC No. 13407 were prepared according to the C. glutamicum Handbook (Chartter 23). The recombinant plasmid pK18mobsacB-PdapA was then applied. * Transformed into CGMCC No. 13407 competent cells by electroporation, and transformants were screened on BHI selective medium containing 15 mg / L kanamycin. The selected transformants were cultured overnight in standard BHI liquid medium at 33°C with shaking at 220 rpm. During this culture, the transformants underwent a second recombination, removing the vector sequence from the genome through gene exchange. The culture was then serially diluted (10⁻⁶ m² / L). -2 Continuous dilution to 10 -4The diluted solution was spread onto ordinary BHI solid medium containing 10% sucrose and incubated at 33°C for 48 hours. Colonies growing on the solid medium did not carry the inserted vector sequence in their genomes. The target fragment was amplified by PCR and analyzed by nucleotide sequencing, revealing the introduction of the promoter PdapA before the dapA gene in CGMCC No. 13407. * The recombinant strain, namely PdapA * The recombinant strain that replaced the natural promoter of the dapA gene was named 13407-PdapA. * ::PdapA-dapA.
[0066] The same method was used to obtain the promoter PdapA introduced before the dapA gene in CGMCC No. 13407. ** The recombinant strain, namely PdapA ** The recombinant strain that replaced the natural promoter of the dapA gene was named 13407-PdapA. ** ::PdapA-dapA.
[0067] Example 3: Test of the ability of recombinant bacteria to produce L-lysine through fermentation
[0068] The starting strain CGMCC No. 13407 and the recombinant strain 13407-PdapA obtained in Example 2 were compared. * ::PdapA-dapA and 13407-PdapA ** Fermentation validation was performed using ::PdapA-dapA. A 1L Dasgip quadruple fermenter was used to simultaneously validate the fermentation of the starting strain and its modified recombinant strain. The fermentation medium formulation is shown in Table 2, and the fermentation control process is shown in Table 3.
[0069] Table 2 Fermentation medium formulation
[0070] Element Concentration (g / L) glucose 30 ammonium sulfate 10 yeast powder 2 peptone 4 <![CDATA[KH2PO4]]> 1.5 <![CDATA[MgSO4·7H2O]]> 2.0 <![CDATA[FeSO4·7H2O]]> 0.2 <![CDATA[MnSO4·H2O]]> 0.2 Niacinamide 0.05 Calcium pantothenate 0.01 Biotin 0.001 Thiamine 0.01 Defoamer 0.5 Initial volume determination 400ml
[0071] Table 3 Fermentation process control parameters
[0072]
[0073]
[0074] The fermentation test results are shown in Table 4. The starting strain and its modified recombinant strain were each fermented in three parallel batches. 2 mL of fermentation broth was centrifuged (12000 rpm, 2 min), and the supernatant was collected. The lysine content in the fermentation broth of the starting strain and its modified recombinant strain was detected by HPLC. The average value of the three batches was taken as the final experimental result. 100 μl of fermentation broth was diluted appropriately, and the OD was detected at a wavelength of 562 nm using a spectrophotometer. The average value of the three batches was taken as the final experimental result.
[0075] Table 4 Results of L-Lysine fermentation experiment
[0076]
[0077] The fermentation results showed that the modified recombinant strain had significantly higher lysine production and sugar-acid conversion rate than the original strain, with a statistically significant difference (P < 0.05). The original strain CGMCC No. 13407 had a lysine production of 74.8 g / L and a sugar-acid conversion rate of 49.8%, achieved using the mutated dapA gene promoter PdapA. * Recombinant strain 13407-PdapA, which replaces the natural promoter of the dapA gene. * The lysine yield of ::PdapA-dapA was 77.8 g / L, and the sugar-acid conversion rate was 51.8%, which was 2.0 percentage points higher than that of the starting strain. The growth of the recombinant strain also showed improvement. The mutant dapA... ** gene promoter PdapA ** Recombinant strain 13407-PdapA, which replaces the natural promoter of the dapA gene. ** The lysine yield of ::PdapA-dapA was 76.7 g / L, and the sugar-acid conversion rate was 51.1%. Both recombinant strains showed significantly improved lysine yield and conversion rate compared to the starting strain CGMCC No. 13407 (P < 0.05). However, the recombinant strain 13407-PdapA... ** The lysine yield and conversion rate of PdapA-dapA were significantly lower than those of recombinant strain 13407-PdapA (P < 0.05). * ::PdapA-dapA. Therefore, it can be seen that the promoter PdapA... * Compared to PdapA ** It has stronger initiation activity.
[0078] Example 4: Introducing a mutated dapA gene promoter into the starting strain CGMCC No. 11942.
[0079] To further verify the effect of the mutant dapA gene promoter on lysine production, the promoters of two mutant dapA genes (SEQ ID NO.1 and SEQ ID NO.7) were introduced into another lysine-producing bacterium, CGMCC No.11942.
[0080] The recombinant plasmid pK18mobsacB-PdapA was prepared according to the method in Example 2. * The cells were transformed into competent cells of CGMCC No.11942. The target fragment was amplified by PCR and analyzed by nucleotide sequencing, revealing the presence of the promoter PdapA preceding the dapA gene in CGMCC No.11942. * The recombinant bacteria, namely PdapA * The recombinant bacterium that replaced the natural promoter of the dapA gene was named 11942-PdapA. * ::PdapA-dapA.
[0081] The same method was used to obtain the promoter PdapA introduced before the dapA gene in CGMCC No. 11942. ** The recombinant strain, namely PdapA ** The recombinant strain that replaced the natural promoter of the dapA gene was named 11942-PdapA. ** ::PdapA-dapA.
[0082] Example 5: Test of the ability of recombinant bacteria to produce L-lysine through fermentation
[0083] The method described in Example 3 was used to process CGMCC No. 11942 and its modified recombinant strain 11942-PdapA. * ::PdapA-dapA and 11942-PdapA ** ::PdapA-dapA was used for fermentation verification. The results of the lysine fermentation experiment are shown in Table 5.
[0084] Table 5 Results of L-Lysine fermentation experiment
[0085]
[0086] The fermentation results showed that the two recombinant strains had significantly higher lysine production and sugar-acid conversion rates than the original strain, with statistically significant differences (P < 0.05). The original strain CGMCC No. 11942 had a lysine production of 89.5 g / L and a sugar-acid conversion rate of 59.4%, achieved using the mutated dapA gene promoter PdapA. * Recombinant bacteria 11942-PdapA with the natural promoter replaced by the dapA gene* The lysine yield of ::PdapA-dapA was 92.5 g / L, and the sugar-acid conversion rate was 61.7%, which was 2.3 percentage points higher than that of the starting strain. The growth of the recombinant strain also showed improvement. The mutant dapA... ** gene promoter PdapA ** Recombinant strain 13407-PdapA, which replaces the natural promoter of the dapA gene. ** The lysine yield of ::PdapA-dapA was 91.4 g / L, and the sugar-acid conversion rate was 60.9%. Its lysine yield and conversion rate were significantly lower than those of recombinant strain 13407-PdapA (P < 0.05). * ::PdapA-dapA. Therefore, it can be seen that the promoter PdapA... * Compared to PdapA ** It has stronger initiation activity.
[0087] The improved lysine yield and conversion rate of recombinant bacteria obtained by replacing the natural promoter of the dapA gene with PdapA* represent a significant performance improvement for lysine-producing bacteria that already have relatively high conversion rates. This demonstrates the effectiveness of using the mutated dapA gene promoter PdapA* in Corynebacterium glutamicum. * Regulating the expression of the dapA gene helps to increase L-lysine production and conversion rate.
[0088] Example 6: Detection of transcriptional activity of mutant promoters
[0089] To further verify the mutant promoter PdapA provided in this invention * And the mutant promoter PdapA in patent application CN111197021A ** The transcriptional activity of the mutant promoter in the origin strain CGMCC No.11942 was detected by real-time quantitative PCR. The primers used are shown in Table 1.
[0090] Real-time quantitative PCR method: Logarithmic growth phase bacterial cells were collected, and total RNA was extracted from *Corynebacterium glutamicum* according to the CW BIO ULITrapure RNA Kit instructions. Agarose gel electrophoresis was used to verify that the extracted RNA met experimental requirements, and the RNA concentration was quantified using a microplate reader. mRNA was reverse transcribed into cDNA using the US EVERBRIGHT reverse transcription kit from Suzhou Yuheng Biotechnology Co., Ltd. in a two-step process. Real-time quantitative PCR was performed using 2×Super EvaGreen Master Mix (USEVERBRIGHT) and a CFX96 real-time PCR detection system (Bio-Rad). Negative controls and standards were included for each reaction, and three biological replicates and three technical replicates were set up to ensure the validity of the experimental data. After the reaction, the specificity of the PCR products was analyzed based on the melting curve. 16S rDNA was used as an internal reference gene. The difference in CT values obtained from different strains was recorded as ΔCt value. The transcriptional level of the reporter gene's dihydropyridine dicarboxylic acid synthase was normalized to the transcriptional level of the 16S rRNA gene, which was used as an endogenous control. The 2×Super EvaGreen Master Mix (USEVERBRIGHT) and CFX96 real-time PCR detection system (Bio-Rad) were used. -△△Ct The data were processed using the method (Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T))[J].Methods,2001,25(4):402-408.), and the transcriptional levels of the dihydropyridine dicarboxylic acid synthase gene in the two recombinant bacteria were finally obtained. The results are shown in Table 6.
[0091] Table 6. Relative transcriptional levels of promoters
[0092]
[0093]
[0094] The recombinant strain 11942-PdapA was directly compared using quantitative real-time PCR. * ::PdapA-dapA and 11942-PdapA ** The transcriptional level of the dihydropyridine dicarboxylic acid synthase gene dapA in PdapA-dapA was analyzed, indicating that the dapA gene plays a crucial role in the promoter PdapA. * Under the control of PdapA, its transcription level is at PdapA ** The transcriptional level was 1.6 times higher than that under control, and the difference was statistically significant (P < 0.05), indicating that PdapA... *The promoter has excellent transcription initiation activity.
[0095] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention. sequence list <110> Langfang Meihua Biotechnology Development Co., Ltd. <120> Mutated dapA promoter and its applications <130> KHP211123993.1 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 200 <212> DNA <213> Artificial Sequence <400> 1 cgcaaagctc acaccccacga gctaaaaatt catatagtta agacaacatt tttggctgta 60 aaagacagcc gtaaaaacct cttgctcgtg tcaattgttc ttatcggaat gtggcttggg 120 cgattgttat gcaaaagttg ttaggttttt tgcggggttg tttaaccccc aaatgaggga 180 atgtggtatc attgaactct 200 <210> 2 <211> 200 <212> DNA <213> Artificial Sequence <400> 2 cgcaaagctc acaccccacga gctaaaaatt catatagtta agacaacatt tttggctgta 60 aaagacagcc gtaaaaacct cttgctcgtg tcaattgttc ttatcggaat gtggcttggg 120 cgattgttat gcaaaagttg ttaggttttt tgcggggttg tttaaccccc aaatgaggga 180 agaaggtaac cttgaactct 200 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <400> 3 cgcggatcca tgccaatgcc acgatgtat 29 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <400> 4 tcgtgggtgt gagctttgcg ttaaaagtcc atgacatacg 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <400> 5 agaaggtaac cttgaactct atgagcacag gtttaacagc 40 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <400> 6 cccaagcttc ccttggcgtc cttgaccgc 29 <210> 7 <211> 200 <212> DNA <213> Artificial Sequence <400> 7 cgcaaagctc acaccccacga gctaaaaatt catatagtta agacaacatt tttggctgta 60 gaagacagcc gtaaaaacct cttgctcgtg tcaattgttc ttatcggaat gtggcttggg 120 cgattgttat gcaaaagttg ttaggttttt tgcggggttg tttaaccccc aaatgaggga 180 atgtggtatc attgaactct 200 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <400> 8 aatggcgcat acaaagagaa gc 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 gttgcagact ccaatccgga 20 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 gagacgcctg agtgaattacctacg 25 <210> 11 <211> twenty two <212> DNA <213> Artificial Sequence <400> 11 cgcccaaagc aagccaaaca ag 22
Claims
1. A promoter, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. Any of the following applications of the promoter according to claim 1: (1) Driving dapA gene expression in Corynebacterium glutamicum; (2) Enhance dapA gene expression in Corynebacterium glutamicum.
3. A recombinant Corynebacterium glutamicum, characterized in that, The upstream intergenic region of the dapA gene of the recombinant Corynebacterium glutamicum contains the promoter as described in claim 1.
4. The recombinant Corynebacterium glutamicum according to claim 3, characterized in that, Its dapA gene is expressed by the promoter described in claim 1.
5. The method for constructing recombinant Corynebacterium glutamicum according to claim 3 or 4, characterized in that, Replace the natural promoter of the dapA gene with the promoter described in claim 1.
6. Any of the following applications of the recombinant Corynebacterium glutamicum according to claim 3 or 4: (1) Application in the fermentation production of lysine; (2) Application in the selection and breeding of Corynebacterium glutamicum for lysine production.
7. A method for producing lysine by fermentation, characterized in that, Culturing the recombinant Corynebacterium glutamicum as described in claim 3 or 4, lysine is isolated from the culture.
8. A method for expressing the dapA gene in Corynebacterium glutamicum, characterized in that, include: The dapA gene is operatively linked to the promoter of claim 1 to obtain recombinant DNA, which is then introduced into Corynebacterium glutamicum to express the dapA gene.