A mutant glu b promoter and its use

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to a mutated gluB promoter and application thereof. The present application finds that the expression of the gluB gene is strengthened, which can significantly improve the ability of a strain to produce aspartic acid family amino acids such as lysine. The mutated gluB promoter provided by the present application has obviously higher transcription initiation activity than the wild-type gluB promoter. By replacing the natural promoter of the gluB gene with the promoter, the expression of the gluB gene is obviously enhanced, and the yield and conversion rate of lysine of the recombinant microorganism constructed are significantly improved. The mutated gluB promoter provided by the present application can be used to regulate the expression of amino acid synthesis related genes such as the gluB gene, and provides a new molecular tool and method for gene expression regulation.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a mutated gluB promoter and its applications. Background Technology

[0002] Corynebacterium glutamicum is a Gram-positive microorganism characterized by rapid growth, non-pathogenicity, and weak ability to degrade its own metabolites. As a traditional industrial microorganism, Corynebacterium glutamicum is widely used in the production of various amino acids, nucleotides, and organic acids.

[0003] The use of Corynebacterium glutamicum for amino acid production dates back to the 1960s, first discovered by Kyowa Corporation in Japan. This bacterium can produce glutamic acid in natural environments, and mutagenic Corynebacterium glutamicum can also produce lysine, valine, and other amino acids. With the rapid development of metabolic engineering and genome sequencing technologies, the metabolic pathways of Corynebacterium glutamicum have become increasingly clear. Researchers have successively identified the genetic mechanisms underlying the high-yield production of various metabolites and achieved efficient production of multiple metabolites.

[0004] The glutamate uptake system in Corynebacterium glutamicum includes a nucleotide-binding protein gene (gluA), a periplasmic binding protein gene (gluB), and two transmembrane protein genes (gluC and gluD), among which the periplasmic binding protein gene (gluB) is crucial for glutamate uptake. gluB possesses a signal sequence and a short target sequence for a signal peptidase, leading to lipid modification of the N-terminal cysteine ​​residue in a series of reactions, responsible for anchoring the binding protein to the membrane. Currently, there are no reports on whether gluB affects the accumulation of aspartic amino acids such as L-lysine. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the gluB gene in lysine fermentation production, as well as a mutated gluB promoter and its application.

[0006] This invention reveals that enhanced expression of the gluB gene improves the ability of strains to produce aspartic amino acids such as lysine. By point mutation of the promoter region of the gluB gene, a mutant gluB promoter was obtained, which exhibits higher transcriptional initiation activity compared to the natural gluB promoter. This promoter can be applied to regulate amino acid metabolic pathways, showing a significant improvement in amino acid production.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] First, this invention provides the application of enhanced expression of the periplasmic binding protein gene gluB or enhanced activity of the periplasmic binding protein GluB in increasing the yield of aspartic amino acids in microorganisms or in constructing microorganisms that produce aspartic amino acids.

[0009] The enhanced expression described above can be achieved through any one or more of the following methods (1) to (3):

[0010] (1) Use elements with higher transcription or translation initiation activity to initiate the transcription or translation of the periplasmic binding protein gene gluB;

[0011] (2) Increase the copy number of the periplasmic binding protein gene gluB;

[0012] (3) Mutate the periplasmic binding protein gene gluB to increase its expression level.

[0013] In (1) above, "higher activity" refers to the natural transcriptional or translational element of the periplasmic binding protein gene gluB.

[0014] Transcriptional elements include promoters and enhancers; translational elements include ribosome binding sites and 5'-UTR.

[0015] In (2) above, the copy number of a gene can be increased by introducing an expression plasmid carrying the gene, or by increasing the copy number of the gene on the chromosome.

[0016] The enhanced activity of the periplasmic binding protein GluB described above can be achieved by mutating the periplasmic binding protein gene gluB, thereby enhancing the activity of the encoded protein.

[0017] The periplasmic binding protein gene gluB described in this invention has the GenBank number NCgl1876.

[0018] In the above-described applications, the microorganism is a Corynebacterium bacterium, preferably Corynebacterium glutamicum.

[0019] In the applications described above, the aspartic amino acids include aspartic acid, asparagine, lysine, threonine, methionine, or isoleucine; preferably lysine.

[0020] On the other hand, the present invention provides a promoter having a nucleotide sequence as shown in SEQ ID NO.1.

[0021] The promoter described in this invention refers to a non-translated nucleic acid sequence located upstream of the coding region of a gene. This sequence contains at least an RNA polymerase binding site and has the activity of initiating the transcription of downstream genes into mRNA. The promoter sequence may also include a 5' untranslated region, which is a binding region for certain transcription factors or regulatory factors.

[0022] The promoter provided above is a mutant gluB promoter. Compared with the wild-type gluB promoter (SEQ ID NO.2), the transcriptional activity of this promoter is significantly improved, and it can be used to drive the expression of genes such as gluB and increase their expression levels.

[0023] Preferably, the sequence of the mutated gluB promoter is shown in SEQ ID NO.1.

[0024] Based on the above promoter, the present invention provides biological materials containing the mutated gluB promoter, wherein the biological material is an expression cassette, a vector or a host cell.

[0025] The expression cassette may be a recombinant DNA obtained by operably linking a target gene downstream of the promoter, or a recombinant DNA obtained by operably linking a target gene downstream of the promoter and operably linking other transcriptional regulatory elements or translational regulatory elements upstream or downstream.

[0026] The present invention does not impose any special restrictions on the target gene. The promoter provided by the present invention can drive any gene to be transcribed in Corynebacterium glutamicum. When a gene has an expression intensity requirement that matches the promoter, the promoter can be used. Therefore, the target gene can be the gluB gene or other genes besides the gluB gene.

[0027] The aforementioned vectors can be expression vectors or cloning vectors, including but not limited to plasmid vectors, phage vectors, transposons, etc.

[0028] As a preferred embodiment of the present invention, the present invention provides a homologous recombination vector containing a mutated gluB promoter and a homologous arm fragment for replacing the natural gluB promoter with the mutated gluB promoter. This homologous recombination vector is constructed based on the pK18mobsacB vector.

[0029] The host cells are preferably microbial cells. The microbial cells are preferably Escherichia or Corynebacterium bacteria. Specifically, the preferred Escherichia species is *Escherichia coli*; the preferred Corynebacterium species are *Corynebacterium glutamicum*, *Corynebacterium pekinense*, *Corynebacterium efficiens*, *Corynebacterium crenatum*, *Corynebacterium thermoaminogenes*, or *Corynebacterium aminogenes*.

[0030] Based on the functionality of the mutated gluB promoter provided by this invention, this invention further provides any of the following applications of the mutated gluB promoter or the biological material:

[0031] (1) Driving gene expression in microorganisms;

[0032] (2) Enhance gene expression in microorganisms;

[0033] (3) Increase the yield and / or conversion rate of microbial metabolites;

[0034] (4) Constructing microbial strains for producing microbial metabolites;

[0035] (5) Fermentation to produce microbial metabolites.

[0036] Preferably, in the above applications, the microorganism is a Corynebacterium bacterium, and more preferably Corynebacterium glutamicum.

[0037] The metabolites can be any metabolites that microorganisms can synthesize, including but not limited to amino acids, organic acids, nucleosides, etc.

[0038] The present invention further provides a recombinant microorganism in which the periplasmic binding protein gene gluB is enhanced or the activity of the periplasmic binding protein GluB is enhanced.

[0039] The enhanced expression described above can be achieved through any one or more of the following methods (1) to (3):

[0040] (1) Use elements with higher transcription or translation initiation activity to initiate the transcription or translation of the periplasmic binding protein gene gluB;

[0041] (2) Increase the copy number of the periplasmic binding protein gene gluB;

[0042] (3) Mutate the periplasmic binding protein gene gluB to increase its expression level.

[0043] In (1) above, "higher activity" refers to the natural transcriptional or translational element of the periplasmic binding protein gene gluB.

[0044] Transcriptional elements include promoters and enhancers; translational elements include ribosome binding sites and 5'-UTR.

[0045] In (2) above, the copy number of a gene can be increased by introducing an expression plasmid carrying the gene, or by increasing the copy number of the gene on the chromosome.

[0046] The enhanced activity of the periplasmic binding protein GluB described above can be achieved by mutating the periplasmic binding protein gene gluB, thereby enhancing the activity of the encoded protein.

[0047] Preferably, the upstream intergenic region of the periplasmic binding protein gene gluB of the recombinant microorganism contains the mutated gluB promoter.

[0048] Specifically, the upstream gene region refers to the nucleotide sequence between the start codon of the periplasmic binding protein gene gluB on the microbial chromosome and the coding region of its upstream gene.

[0049] Preferably, the recombinant microorganism is recombinant Corynebacterium glutamicum, and its periplasmic binding protein gene gluB is expressed by the mutated gluB promoter.

[0050] The recombinant microorganisms described above showed significantly increased expression of the periplasmic binding protein GluB, and their lysine synthesis capacity was significantly enhanced, exhibiting significantly higher lysine yield and conversion rate compared to the original strain.

[0051] The starting bacteria for the aforementioned recombinant microorganisms are preferably Corynebacterium bacteria capable of accumulating lysine or its derivatives. Corynebacterium glutamicum, particularly capable of accumulating lysine or its derivatives, is preferred.

[0052] The present invention further discovers that the above-mentioned modification of replacing the gluB promoter of the periplasmic binding protein gene, combined with the modification of certain specific metabolic engineering targets, is more conducive to improving the yield and conversion rate of lysine. Based on this, the starting strain of the above-mentioned recombinant microorganism is preferably modified based on wild-type Corynebacterium glutamicum as follows (1) or (2):

[0053] (1) Mutate the lysC gene on the chromosome to make it encode lysC. T311IMutant (amino acid 311 is mutated from T to I); mutates the pyc gene on the chromosome to encode pyc. P458S The mutant (amino acid mutation at position 458, changing from P to S) increases the copy number of the lysE gene.

[0054] (2) Introduce point mutation T311I in lysC on chromosomes, point mutation V59A in hom, point mutation P458S in pyc, and point mutation S361F in gnd; increase the copy number of dapA, dapB, and ddh; and change the promoter sequence of aceE to weaken the expression of pyruvate dehydrogenase.

[0055] In a preferred embodiment of the present invention, the starting strain of the recombinant microorganism is a lysine-producing bacterium with accession number CGMCCNo.13407. This strain was deposited on November 30, 2016, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and is classified as *Corynebacterium glutamicum*. This strain has been disclosed in patent CN106635944A. Using the mutated gluB promoter provided by the present invention to drive the expression of its periplasmic binding protein gene gluB, the modified strain exhibits significantly improved lysine production and conversion rate, and its growth performance is also enhanced.

[0056] As another preferred embodiment of the present invention, the starting strain of the recombinant microorganism is a lysine-producing bacterium with accession number CGMCCNo.11942. This strain was deposited on December 25, 2015, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and is classified as *Corynebacterium glutamicum*. This strain has been disclosed in patent CN105734004B. Using the mutated gluB promoter provided by the present invention to drive the expression of its periplasmic binding protein gene gluB, the modified strain showed significantly improved lysine production and conversion rate, and also improved growth performance.

[0057] The present invention provides a method for constructing the recombinant microorganism, the method comprising the step of replacing the natural promoter of the periplasmic binding protein gene gluB with the mutated gluB promoter.

[0058] Specifically, the method involves replacing the natural promoter of the periplasmic binding protein gene gluB in the starting bacteria with the mutated gluB promoter.

[0059] The natural promoters described above are preferably wild-type gluB promoters.

[0060] The aforementioned replacement promoter can be implemented using conventional methods in the art. For example, the upstream and downstream fragments of the promoter to be replaced, as well as the mutated gluB promoter, are ligated into a homologous recombination vector and introduced into the starting bacteria, where the natural gluB promoter in the starting bacteria is replaced by homologous recombination.

[0061] This invention provides any of the following applications of the recombinant microorganism:

[0062] (1) Application in the fermentation production of aspartic amino acids or their derivatives;

[0063] (2) Application in selecting production strains of aspartic amino acids or their derivatives as starting bacteria.

[0064] Preferably, the aspartic acid family amino acid is lysine. The derivatives include, but are not limited to, trifluoroacetyllysine.

[0065] The present invention provides a method for producing lysine or its derivatives by fermentation, comprising culturing the recombinant microorganism and isolating lysine or its derivatives from the culture.

[0066] Specifically, the above method includes: inoculating the recombinant microorganism into a seed culture medium for seed culture to obtain a seed liquid; inoculating the seed liquid into a fermentation culture medium for culture to obtain a fermentation broth; and separating and extracting the fermentation broth to obtain lysine or its derivatives.

[0067] Preferably, the fermentation medium comprises the following components: glucose 55-65 g / L, ammonium sulfate 20-30 g / L, potassium dihydrogen phosphate 1.5-2.5 g / L, magnesium sulfate heptahydrate 0.8-1.2 g / L, soybean meal hydrolysate 8-12 g / L, calcium carbonate 25-35 g / L, and the pH is adjusted to 7.0-7.2.

[0068] The present invention also provides a method for expressing a target gene, the method comprising: operably linking the target gene to the mutated gluB promoter to obtain recombinant DNA, and introducing the recombinant DNA into a host cell to express the target gene.

[0069] Specifically, the target gene is operatively linked downstream of the mutated gluB promoter; or, upstream and downstream DNA fragments of the target gene on the chromosome are operatively linked upstream and downstream of the mutated gluB promoter, respectively.

[0070] The target gene mentioned above can be any protein-coding gene (e.g., amino acid synthesis-related genes) or RNA molecule-coding gene (e.g., interfering RNA molecules, regulatory RNA molecules, sgRNA, etc.).

[0071] The beneficial effects of this invention are as follows: This invention discovers that enhancing the expression of the gluB gene can significantly improve the ability of strains to produce aspartic amino acids such as lysine. The mutant gluB promoter provided by this invention has significantly higher transcriptional initiation activity compared to the wild-type gluB promoter, enabling efficient expression of the target gene in microorganisms. Replacing the natural promoter of the gluB gene with this promoter can significantly enhance gluB gene expression, resulting in significantly improved lysine yield and conversion rate in the constructed recombinant microorganisms. The mutant gluB promoter provided by this invention can be used to regulate the expression of genes related to amino acid synthesis, such as the gluB gene, providing new molecular tools and methods for gene expression regulation. Detailed Implementation

[0072] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0073] Unless otherwise specified, the techniques or conditions described in the following examples shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0074] The primer sequence information used in the following examples is shown in Table 1:

[0075] Table 1 Primer sequence information

[0076] P-1f CGGGATCCCTTTGCCGCACGATCAACCG P-1r GGAATCTGGTTCCGTATCTTCCACAATGAGCCCATCCGCC P-2f TAGATATATAAGGAGACAACATGTCTGCAAAGCGTACTTT P-2r GCGTCGACTCCTTGACCTTCTGAGCTGG RT-16S-f AATGGCGCATACAAAGAGAAGC RT-16S-R GTTGCAGACTCCAATCCGGA RT-gluB-f GGAAGGCACCGACGCTATCAAC RT-gluB-R TCTTCAACAACCACGGAGTCTTCAC

[0077] Example 1: Recombinant plasmid pK18mobsacB-PgluB * Construction

[0078] Mutated gluB promoter PgluB * The nucleotide sequence is shown in SEQ ID NO.1 and was synthesized by Genewiz Biotechnology Co., Ltd. (China). PCR amplification using the P-1f / P-1r primer pair yielded the upstream homologous arm fragment P-up; using the Corynebacterium glutamicum ATCC 13032 genome as a template, PCR amplification using the P-2f / P-2r primer pair yielded the downstream homologous arm fragment P-dn. P-up, P-dn, and PgluB... * Using a mixture of three fragments as a template, PCR amplification was performed with the P-1f / P-2r primer pair to obtain the up-PgluB fragment. * -dn will add up-PgluB* -dn was double-digested with BamHI and SalI, and the vector pK18mobsacB (GenBank: FJ437239.1; kindly provided by Professor Yang Sheng of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, or commercially available) was double-digested with the same enzymes. The digested products were ligated with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-PgluB. * .

[0079] Example 2: Introducing a mutated gluB promoter into the originating strain CGMCC No. 13407

[0080] Competent cells of CGMCC No. 13407 were prepared according to the C. glutamicum Handbook (Chartter 23). The recombinant plasmid pK18mobsacB-PgluB was then applied. * Competent cells were transformed by electroporation, and transformants were screened on BHI selective medium containing 15 mg / L kanamycin. The screened transformants were cultured overnight in standard BHI liquid medium at 33°C with shaking at 220 rpm. During this culture, the transformants underwent a second recombination, removing the vector sequence from the genome through gene exchange. The culture was then serially diluted (10⁻⁶ m² / L). -2 Continuous dilution to 10 -4 The diluted solution was spread onto ordinary BHI solid medium containing 10% sucrose and incubated at 33°C for 48 hours. The genomes of the grown colonies did not carry the inserted vector sequence. The target sequence was amplified by PCR and analyzed by nucleotide sequencing. The PgluB promoter was introduced before the gluB gene. * Recombinant bacteria (using PgluB) * (Replacing the natural promoter of the gluB gene) and named it 13407-PgluB * ::PgluB-gluB.

[0081] Example 3: Shake-flask fermentation test of the lysine fermentation capacity of recombinant bacteria

[0082] The recombinant strain 13407-PgluB constructed in Example 2 * ::PgluB-gluB was used in a shake-flask fermentation experiment. The culture medium used for shake-flask fermentation was as follows:

[0083] Seed activation medium: BHI 37 g / L, 18 g / L agar powder.

[0084] Seed culture medium: 20 g / L sucrose, 5 g / L yeast extract, 10 g / L peptone, 5 g / L urea, 0.4 g / L magnesium sulfate heptahydrate, adjusted to pH 7.0.

[0085] Fermentation medium: glucose 60g / L, ammonium sulfate 25g / L, potassium dihydrogen phosphate 2.0g / L, magnesium sulfate heptahydrate 1.0g / L, soybean meal hydrolysate 10g / L, calcium carbonate 30g / L, adjust pH to 7.0.

[0086] The lysine fermentation method is as follows:

[0087] 1. Seed activation: Take the strain to be verified from the cryopreservation tube, streak it on the seed activation medium, and incubate at 33℃ for 24h;

[0088] 2. Seed culture: One loop of activated seeds from the plate was inoculated into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium. The flask was cultured at 33 °C and 220 r / min for 6 h with shaking to obtain the seed culture.

[0089] 3. Fermentation culture: Inoculate 2 mL of seed culture into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, and culture at 33℃ and 220 r / min for 14-15 h with shaking. Perform three replicates for each strain to obtain the fermentation broth.

[0090] 4. OD 562 Determination: Take 100 μl of fermentation broth, dilute it appropriately, and use a spectrophotometer to detect the OD at a wavelength of 562 nm. Perform three replicates for each strain, calculate the average value, and the detected OD is... 562 As shown in Table 2.

[0091] 5. Lysine concentration determination: Centrifuge 2 mL of fermentation broth (12000 rpm, 2 min), collect the supernatant, and use HPLC to detect the L-lysine content in the fermentation broth of the recombinant strain and the original strain. Perform three replicates for each strain and calculate the average value. The detected lysine concentrations are shown in Table 2.

[0092] Table 2 Lysine production and growth detection of recombinant bacteria

[0093] CGMCC No.13407 15.1 25.2 47.7 <![CDATA[13407-PgluB * ::PgluB-gluB]]> 18.2 30.3 48.8

[0094] The results showed that the recombinant strain 13407-PgluB * Compared with the original strain CGMCC No.13407, ::PgluB-gluB significantly improved the lysine yield and conversion rate, with a statistically significant difference (P<0.05). Specifically, the L-lysine yield increased by 3.1 g / L, and the conversion rate increased by 5.1%. The final OD of the recombinant strain was comparable to that of the original strain.

[0095] Example 4: Introducing a mutated gluB promoter into the originating strain CGMCC No. 11942

[0096] To further verify the effect of the mutated gluB promoter on lysine production, the mutated gluB promoter was introduced into another lysine-producing bacterium, CGMCC No. 11942.

[0097] The recombinant plasmid pK18mobsacB-PgluB was prepared according to the method in Example 2. * The cells were transformed into competent cells of CGMCC No.11942. The target fragment was amplified by PCR and analyzed by nucleotide sequencing, revealing the presence of the PgluB promoter preceding the gluB gene in CGMCC No.11942. * Recombinant bacteria (using PgluB) * The natural promoter of the gluB gene was replaced and named 11942-PgluB. * ::PgluB-gluB.

[0098] Example 5: Shake-flask fermentation test of the lysine fermentation capacity of recombinant bacteria

[0099] Following the method described in Example 3, CGMCC No. 11942 and its modified recombinant strain 11942-PgluB were subjected to treatment. * ::PgluB-gluB was used for shake-flask fermentation verification. The results of the lysine fermentation experiment are shown in Table 3.

[0100] Table 3 Lysine production and growth detection of recombinant strains

[0101] CGMCC No.11942 18.5 30.1 38.7 <![CDATA[11942-PgluB * ::PgluB-gluB]]> 21.4 35.7 37.5

[0102] The results showed that the recombinant strain 11942-PgluB * Compared with the original strain CGMCC No.11942, ::PgluB-gluB showed a significant increase in lysine production (P<0.05). Specifically, the L-lysine production increased by 2.9 g / L, the conversion rate increased by 5.6%, and the final OD of the recombinant strain was comparable to that of the original strain.

[0103] Example 6: Detection of transcriptional activity of the mutated gluB promoter

[0104] To further verify the mutated gluB promoter PgluB * (SEQ ID NO.1) exhibits higher transcriptional activity compared to the natural promoter of gluB (wild-type gluB promoter, SEQ ID NO.2). Real-time quantitative PCR was used to detect the transcriptional activity of PgluB. *The transcriptional level of the gluB gene initiated by the promoter, and the primers used are shown in Table 1.

[0105] Real-time quantitative PCR method: Logarithmic growth phase bacterial cells were collected, and total RNA was extracted from *Corynebacterium glutamicum* according to the CW BIO ULITrapure RNA Kit instructions. Agarose gel electrophoresis was used to verify that the extracted RNA met experimental requirements, and the RNA concentration was quantified using a microplate reader. mRNA was reverse transcribed into cDNA using the US EVERBRIGHT reverse transcription kit from Suzhou Yuheng Biotechnology Co., Ltd. in a two-step process. Real-time quantitative PCR was performed using 2×Super EvaGreen Master Mix (USEVERBRIGHT) and a CFX96 real-time PCR detection system (Bio-Rad). Negative controls and standard corrections were included in each reaction, and three biological replicates and three technical replicates were set up to ensure the validity of the experimental data. The specificity of the PCR products was analyzed based on melting curves after the reaction. 16S rDNA was used as an internal reference gene. The difference in CT values ​​obtained from different strains was recorded as ΔCt value. The transcriptional level of the reporter gene periplasmic binding protein gluB was normalized to the transcriptional level of the 16S rRNA gene, which was used as an endogenous control. The method employed by Livak et al. was used. -△△Ct The data were processed using the method (Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T))[J].Methods,2001,25(4):402-408.), and the transcription level of the recombinant periphyte binding protein gene gluB was finally obtained. The results are shown in Table 4.

[0106] Table 4. Relative transcriptional levels of promoters

[0107]

[0108] The transcription level of the periplasm-binding protein gene in recombinant bacteria was detected by real-time quantitative PCR. The results showed that the gluB gene plays a key role in the PgluB promoter. * The transcriptional level under the control of the mutated gluB promoter was 3.6 times that under the control of the natural gluB promoter, and the difference was statistically significant (P < 0.05), indicating that the mutated gluB promoter PgluB... * Compared with the natural promoter PgluB, it has higher transcriptional initiation activity. Combined with the fermentation experiment results of Examples 3 and 5, it can be seen that enhancing the expression of the gluB gene is beneficial to lysine production.

[0109] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Langfang Meihua Biotechnology Development Co., Ltd. <120> A Mutated GluB Promoter and Its Applications <130> KHP211123995.3 <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 200 <212> DNA <213> Artificial Sequence <400> 1 aagatacgga accagattcc ttcttcacca accctaagtc tgatcgtgca aaagacttcc 60 tcggcaagat ccttgcccac tagtttttgg ctgcgcctct atcttcagag tcacttcttt 120 cagtgtcatttttctcggcc ctaatccccc gctggagttc aatcagcgat tgcaaccttt 180 tagatatata atgagacaac 200 <210> 2 <211> 200 <212> DNA <213> Artificial Sequence <400> 2 aagatacgga accagattcc ttcttcacca accctaagtc tgatcgtgca aaagacttcc 60 120. tcggcaagat ccttgcccac tagttttcgg ctgcgcctct atcttcagag tcacttcttt cagtgtcatt tttctcggcc ctaatccccc gctggagttc aatcagcgat tgcaaccttt 180 the father of the aggagacaac <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <400> 3 cgggatccct ttgccgcacg atcaaccg <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <400> 4 ggaatctggt tccgtatctt ccacaatgag cccatccgcc <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <400> 5 fathers fathers atgtctgcaa agcgtacttt <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <400> 6 gcgtcgactc cttgaccttc tgagctgg <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <400> 7 aatggcgcat acaaagagaa gc 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 gttgcagact ccaatccgga 20 <210> 9 <211> twenty two <212> DNA <213> Artificial Sequence <400> 9 ggaaggcacc gacgctatca ac 22 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 tcttcaacaa ccacggagtc ttcac 25

Claims

1. A promoter, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Any of the following applications of the promoter according to claim 1: (1) Driving gluB gene expression in Corynebacterium glutamicum; (2) Enhance gluB gene expression in Corynebacterium glutamicum; (3) Increase the lysine production and / or conversion rate of Corynebacterium glutamicum by driving the expression of the gluB gene.

3. A recombinant microorganism, characterized in that, Its periplasmic binding protein gene gluB is expressed by the promoter described in claim 1; The recombinant microorganism is recombinant Corynebacterium glutamicum.

4. The method for constructing recombinant microorganisms according to claim 3, characterized in that, Replace the natural promoter of the periplasmic binding protein gene gluB with the promoter described in claim 1.

5. Any of the following applications of the recombinant microorganism according to claim 3: (1) Application in the fermentation production of lysine; (2) Application in the selection of lysine production strains as starting bacteria.

6. A method for producing lysine by fermentation, characterized in that, Lysine was isolated from the culture of the recombinant microorganism described in claim 3.

Images